CN1390940A - 4-coumaric acid: CoA ligase gene and its clone - Google Patents
4-coumaric acid: CoA ligase gene and its clone Download PDFInfo
- Publication number
- CN1390940A CN1390940A CN 02132631 CN02132631A CN1390940A CN 1390940 A CN1390940 A CN 1390940A CN 02132631 CN02132631 CN 02132631 CN 02132631 A CN02132631 A CN 02132631A CN 1390940 A CN1390940 A CN 1390940A
- Authority
- CN
- China
- Prior art keywords
- coumaric acid
- coa ligase
- gene
- puc19
- clone
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The present invention relates to a 4-coumaric acid: CoA ligase gene 4CL taken from Amorpha fruticosa, its sequence, the sequence of relative amino acid, the clonal carrier pUC19/4CL containing 4CL, and the E. coli cell JM109/pUC19/4CL containing said carrier. It can be used to configure its genetically engineering bacteria for transgenic plant.
Description
Technical field
The present invention is a kind of 4-coumaric acid: CoA ligase gene and clone thereof, belong to bioengineering field, and specially refer to false indigo (Amorpha fruticosa) coding 4-coumaric acid: the gene of CoA ligase and clone thereof.
Background technology
The value of trees not only is timber yield in the production of forestry, also is embodied on the physical and chemical index of xylon.Xylon mainly is made up of xylogen and Mierocrystalline cellulose.Mierocrystalline cellulose is the polymer substance of the complexity that mainly is formed by connecting with the 1-4 glycosidic link by β-D-glucosyl group, is the main raw material of papermaking.The process of paper-making pulping is exactly to remove the lignin material from plant fiber material, keeps Mierocrystalline cellulose and hemicellulose as far as possible.Content of lignin is quite high in timber and the straw plant cell wall, and Here it is, and paper making raw material commonly used produces the basic reason of polluting in pulp and paper industry.In order to reduce pollution, people have carried out multi-disciplinary broad research.Develop rapidly along with molecular biology of plants, people begin to pay attention to from paper making raw material---and plant is started with, attempt on the basis of understanding growth and development of plants mechanism and molecular regulation, research and develop out to base oneself upon by the genetically engineered approach and alleviate environmental pollution, be more suitable for plant resources, fundamentally solve the paper-making pollution problem in pulp and paper industry.Therefore relate to plant cellulose synthetic and reduce plant lignin content or change its composition engineered research, use Pulp industry had important effect.The present invention attempts to study problem how to improve the trees material from reducing this angle of plant lignin content, and studies genes involved in the intravital effect of plant by gene clone and the expression in transgenic plant thereof.The success of this research will fundamentally alleviate and even eliminate the pollution that environment is produced because of lignin degrading greatly, improves the productivity of paper-making pulping industry, preserves the ecological environment.Therefore, by genetic engineering technique control content of lignin and composition, can in producing, agroforestry be applied.
4-coumaric acid: CoA ligase (4-Coumarate:CoA ligases, 4CL, EC 6.2.1.12) major function is the reaction of catalysis hydroxyl phenylacetic acid to corresponding thioesters, keep the required metabolic function of phenylpropionic acid (as xylogen and flavonoid compound) biosynthesizing, can utilize coumaric acid, coffic acid, forulic acid and styracin as substrate, lignin monomer is synthesized in catalysis, and it is synthetic to regulate xylogen.The 4CL inverted defined gene, can suppress the 4-coumaric acid: the expression of CoA ligase enzyme in transgenic plant, reduce content of lignin.Study problem how to improve the trees material from reducing this angle of plant lignin content, can fundamentally alleviate and even eliminate the pollution that environment is produced because of lignin degrading greatly, improve the productivity of paper-making pulping industry, preserve the ecological environment.
Summary of the invention
The purpose of this invention is to provide a kind of false indigo (Amorpha fruticosa) coding 4-coumaric acid: the gene 4CL sequence and the amino acid sequence corresponding thereof of CoA ligase.Cloning vector pUC19/4CL that contains 4CL and the E.coli cell JM109/pUC19/4CL that contains this carrier are provided.Utilize achievement of the present invention, can make up the 4-coumaric acid: the CoA ligase gene engineering bacteria, be used for the gene transformation of plant, reach the purpose of improving plant quality.
The technical solution used in the present invention is to utilize degenerate oligonucleotide PCR method in conjunction with the terminal rapid amplifying PCR of cDNA method, with false indigo stem RNA is template, use earlier the degenerate pcr primer, method by RT-PCR, obtained the 4CL gene fragment, fragment designs reverse nested primers in view of the above again, has obtained 5 ' and 3 ' unknown end group because of fragment with the RACE method, thereby cloned false indigo 4CL full-length cDNA, and measured nucleotide sequence.4CL and cloning vector pUC19 are cut with restriction enzyme respectively, form the complementary sticky end, the T4DNA ligase enzyme connects, and forms 4CL cloning vector pUC19/4CL.The heat shock method imports competence E.coli cell JM109 with this cloning vector, becomes the Bacillus coli cells JM109/pUC19/4CL that contains pUC19/4CL.
False indigo (Amorpha fruticosa) 4-coumaric acid: CoA ligase gene 4CL complete sequence is at the GenBanK database registration, and number is AF435968. Specific sequence is as follows: 1 tcacaaacac aaaataccat tcccgcaatg gcatttgaga cagaagaacc aaaggaattc 61 atcttcaggt caaaattacc agaaatccca atctccaaac accttcccct tcactcttac 121 tgctttgaga acctctcaga attcgggtca cgtccatgct tgatcagtgc cccaacaggg 181 gacgtgtaca cctactatga cgtggaactc accgctagaa gagttgcctc tggactcaac 241 aaattgggtg tccaacaagg tgatgtcatc atgctccttc ttcctaattc accagaattt 301 gtgttctcct tcttgggtgc ctcttaccgt ggtgccatga tcactgctgc caacccattc 361 ttcacatccg ctgagattgc aaaacaggcc aaagcctcca acaccaagtt gcttataaca 421 caagcttctt actacgacaa ggttaaggat ttggatgtga agttggtgtt cgtggactct 481 ccccctgatg ggcacatgca ctattcagag ctgcgtgagg ctgatgagag tgacatgcct 541 gaggtgaaga ccaaccctga tgatgtggtg gcacttccct attcgtcagg gacaacaggg 601 ttgcccaaag gggtgatgtt atctcacaaa gggttggcga ccagcatagc acaacaagtt 661 gatggggaaa accccaacct ctactttcac aatgaggatg tcatattgtg tgtgcttcca 721 ctctttcata tatattctct caattctgtt ctgttgtgtg ggttgagagc caaggctgct 781 attttgctga tgccaaagtt tgagatcaat gccttgttgg gtctcattca gaaacaccga 841 gtaacaattg cccctattgt cccacccatt gttttggcca ttgccaagtc accggatctt 901 gaaaagtatg atctctcttc cattagggtg ttgaaatctg gaggggcttc tctgggcaaa 961 gaactcgaag acactgtgag ggctaaattc cccaaggcca aacttggaca gggatacgga 1021 atgactgagg cagggccagt gctaacaatg tgcttagcat ttgctaagga accgatagat 1081 gtaaaaccag gtgcatgtgg aaccgttgta agaaatgcag agatgaagat tgtggatcct 1141 gaaactggta attcgttgcc acgaaaccag tccggtgaaa tttgcataag aggcgaccag 1201 atcatgaaag gttatctaaa tgatcaagag gctacgcaga gaaccataga caaagaaggg 1261 tggttgcata caggtgacat cggctacatc gacgatgacg atgagttatt catcgttgac 1321 aggcttaagg aattgatcaa atacaaagga tttcaggtgg ctcctgctga actcgaagcc 1381 cttcttctct ctcatcccaa gatcaccgat gctgctgtgg ttccaatgaa ggatgaagca 1441 gctggagagg tacctgttgc atttgtggtg agatcaaatg gtcacacaga cacaaccgag 1501 gatgaaatta agcagtttat ctccaaacag gtggtgtttt ataaaagaat aagcagagta 1561 ttcttcattg atgcaattcc caagtcaccg tcaggtaaaa tcttacgaaa ggatctaaga 1621 gcaaagcttg cagcaggtgt tccaaattga aaattctaat tccaagatat atgatattac 1681 cattatcata cgatgcccgc acaaagctcc ataaaccttg aaggccagag tgcggacgcg 1741 tgcttggagc ttgaccgcat tacttatatt cacacgaggg cagacatgat taccttaaaa 1801 gggggggttg ctaattatat tttaaaacta tattgggtaa aatttgattc gatcaaggac 1861 tttcatatta tataatatcg aagtataatt tttcaaaaaa aaaaaaaaaa a...
Wherein ATG is the transcription initiation password, and TAG is the Transcription Termination password.According to above nucleotide sequence, infer false indigo (Amorpha fruticosa) 4-coumaric acid: the CoA ligase aminoacid sequence is as follows:
1 MAFET?EEPKE?FIFRS?KLPEI?PISKH?LPLHS?YCFEN?LSEFG
41?SRPCL?ISAPT?GDVYT?YYDVE?LTARR?VASGL?NKLGV?QQGDV
81?IMLLL?PNSPE?FVFSF?LGASY?RGAMI?TAANP?FFTSA?EIAKQ
121?AKASN?TKLLI?TQASY?YDKVK?DLDVK?LVFVD?SPPDG?HMHYS
161?ELREA?DESDM?PEVKT?NPDDV?VAL
VMLSH
201?KGLAT?SIAQQ?VDGEN?PNLYF?HNEDV?ILCVL?PLFHI?YSLNS
241?VLLCG?LRAKA?AILLM?PKFEI?NALLG?LIQKH?RVTIA?PIVPP
281?IVLAI?AKSPD?LEKYD?LSSIR?VLKSG?GASLG?KELED?TVRAK
321?FPKAK?LGQGY?GMTEA?GPVLT?MCLAF?AKEPI?DVKPG?ACGTV
361?VRNAE?MKIVD?PETGN?SLPRN?QS
D?QIMKG?YLNDQ
401?EATQR?TIDKE?GWLHT?GDIGY?IDDDD?ELFIV?DRLKE?LIKYK
441?GFQVA?PAELE?ALLLS?HPKIT?DAAVV?MKDEA?AGEVP?VAFVV
481?RSNGH?TDTTE?DEIKQ?FISKQ?VVFYK?RISRV?FFIDA?IPKSP
521?SGKIL?RKDLR?AKLAA?GVPN
False indigo (Amorpha fruticosa) 4-coumaric acid: CoA ligase gene 4CL total length 1911bp, 28-1650 is the coding region, 540 amino acid of encoding altogether.Protein domain prediction shows the 4-coumaric acid of false indigo 4CL full-length cDNA coding: the CoA ligase enzyme, contain the AMP-binding site PYSSG TTG LPKG of expectation, and catalytic activity reaction zone GEICIRG and conservative Cys residue are typical 4CL albumen.
Effect of the present invention and benefit are that 4CL is false indigo (Amorpha fruticosa) the 4-coumaric acid that is extracted first, checks order and clone: CoA ligase gene.Because of its coded 4-coumaric acid: CoA ligase involved in plant xylogen anabolic process, so the clone of this gene can be used for construction expression 4-coumaric acid: the genetic engineering bacterium of CoA ligase, be used for the gene transformation of plant, reach the purpose of improving plant quality.
Embodiment
Below by embodiment the present invention is described further.
Embodiment 1:4CL cDNA segmental clone of total length purpose and order-checking
Get the false indigo branch of green sprouting, peel off crust, scrape with cleaning blade and get secondary meristem, liquid nitrogen grinding becomes powder, adds TRIzol reagent, extracts RNA.According to BcabEST
TMRNA PCR KitVer.1.1 (TAKALA) method is a primer with Oligo dT, is template with the total RNA that extracts, and carries out reverse transcription reaction, synthetic cDNA.Going up coding 4CL albumen conserved regions sequences Design degenerated primer 4CLF1 and 4CLR1 (table 1) according to GenBank, is template with above-mentioned synthetic cDNA, carries out the PCR reaction.With TaKaRa Ex Taq
TMTest kit, modulation reaction solution, PCR reactant (50 μ l system) composed as follows: 5 μ l dNTP, 5 μ l ExTag buffer, 0.25 μ l (5U/ μ l) ExTag, RT reaction product 1 μ l, each 1 μ l of primer 4CLF1 and 4CLR1.Reaction conditions is: 94 ℃ of pre-sex change 5min, and 98 ℃ of 10s then, 55 ℃ of 30s, 72 ℃ of 55s, totally 30 circulations, 72 ℃ were continued to extend 7min when reaction finished.The PCR product is reclaimed fragment 4CL1 clone, and order-checking is also analyzed.
According to acquired false indigo 4CL1 cDNA partial sequence, the reverse transcription primer ART1 of a 5 ' terminal phosphateization of design.Two couples of reverse nested PCR primer AF1 of the inboard design of reverse transcription primer AR1 and AF2 AR2, amplification comprises 5 ' terminal cDNA fragment.Primer sequence is as follows:
4CLF1 AAGGAATTNATNAAATACAAN
4CLR1 AANACNACNAGTTTNGAGATAAA
RT1 (P)-CCACCTGTTTGGAG
AF1 ACACAGACACAACCGAGGAT
AR1 GCTGCTTCATCCTTCATTGG
AF2 CATCCCAAGATCACCGATGCT
AR2 CGAGTTCAGCAGGAGCCAC
AF3 TCACAAACACAAAATACCAT
AF ATGGCATTTGAGACAGAAGAA
AR TCAATTTGGAACACCTGCTGC
Reaction according to 5 '-method of Full RACE Core Set (TAKARA) carries out.
The PCR reaction conditions: 94 ℃ of pre-sex change 5min, 94 ℃ of 1min, 55 ℃ of 30s, 72 ℃ of 60s repeat 30 circulations, and 72 ℃ were continued to extend 7 minutes when reaction finished.The PCR product is reclaimed order-checking.
According to 3 '-FULL RACE Core Set (TAKARA) method, carry out reverse transcription reaction with the OligodT-3sitesAdaptor primer.Contain 3 ' terminal cDNA fragment 4CL3 with OligodT-3sites Adaptor primer and AF1 primer amplification again.The PCR reaction conditions: 94 ℃ of pre-sex change 5min, 94 ℃ of 1min, 55 ℃ of 30s, 72 ℃ of 60s repeat 30 circulations, and 72 ℃ were continued to extend 7 minutes when reaction finished.The PCR product is reclaimed order-checking.
According to the nucleotide sequence design special primer AF3 of 5 ' RACE and 3 ' RACE amplified production, according to BcaBEST
TMRNA PCR Kit Ver.1.1 (TAKALA) method is a downstream primer with Oligo dT, and amplification 4CL full-length cDNA and order-checking obtain false indigo (Amorpha fruticosa) 4-coumaric acid: CoA ligase gene 4CL.
The reorganization of embodiment 2:4CL and cloning vector pUC19
4CL and cloning vector pUC19 use the EcoRI/SphI double digestion respectively.The enzyme tangent condition is as follows: Eppendorf A:ddH2O 11 μ l1 * H 2 μ lPCR fragments (1 μ g/ μ l) 5 μ lEcoRI 1 μ lSphI, 1 μ lEppendorf B:ddH2O, 15 μ l1 * H, 2 μ l plasmids (1 μ g/ μ l) 1 μ lEcoRI 1 μ lSphI 1 μ l
37 ℃ of enzymes were cut 3 hours, reclaimed two purpose fragments behind the electrophoresis respectively, connected with the T4DNA ligase enzyme.Condition of contact is as follows: ddH2O 6 μ lPCR fragments (0.1 μ g/ μ l) 1 μ l plasmids (0.05 μ g/ μ l) 1 μ l10 * T4DNA ligase enzyme Buffer 1 μ lT4DNA ligase enzyme (1U/ μ l) 1 μ l
16 ℃ connect 1 hour, and electrophoresis detection connects product, and reclaiming wherein about 3.5kb fragment is the cloning vector pUC19/4CL that contains 4CL, is used for transformed into escherichia coli.
Embodiment 3: cloning vector pUC19/4CL transformed into escherichia coli JM109
Add the competence E.coli JM109 that 60 μ l thaw and be connected liquid to Eppendorf with 10 μ l, 30 seconds on ice, 42 ℃ 50 seconds, 2 minutes on ice, add 37 ℃ LB substratum 930 μ l, 37 ℃ of concussions were cultivated 1 hour.Bacterium liquid be coated with on the LB flat board that contains 50mg/Ap 37 ℃ of overnight incubation after 4 μ l IPTG and 40 μ l X-gal mix.Select white colony and do the PCR detection, present the positive conversion bacterium colony of the special band person of 1.5kb in the agarose gel electrophoresis, for containing e. coli jm109/pUC19/4CL of pUC19/4CL.From JM109/pUC19/4CL, extract plasmid, measure the nucleotide sequence of external source insertion sequence 4CL with the order-checking universal primer of pUC19, consistent with PCR sequencing result described in the embodiment 1.
Claims (4)
1. 4-coumaric acid: CoA ligase gene 4CL is characterized in that it is false indigo (Amorphafruticosa) coding 4-coumaric acid: the gene of CoA ligase (4-Coumarate:CoA ligases).
(2) as claimed in claim 1, wherein 4 - coumaric acid: coenzyme A ligase 4CL gene nucleotide sequence of SEQ IDNo.1, the specific sequence is as follows: 1 tcacaaacac aaaataccat tcccgcaatg gcatttgaga cagaagaacc aaaggaattc 61 atcttcaggt caaaattacc agaaatccca atctccaaac accttcccct tcactcttac121 tgctttgaga acctctcaga attcgggtca cgtccatgct tgatcagtgc cccaacaggg181 gacgtgtaca cctactatga cgtggaactc accgctagaa gagttgcctc tggactcaac241 aaattgggtg tccaacaagg tgatgtcatc atgctccttc ttcctaattc accagaattt301 gtgttctcct tcttgggtgc ctcttaccgt ggtgccatga tcactgctgc caacccattc361 ttcacatccg ctgagattgc aaaacaggcc aaagcctcca acaccaagtt gcttataaca421 caagcttctt actacgacaa ggttaaggat ttggatgtga agttggtgtt cgtggactct481 ccccctgatg ggcacatgca ctattcagag ctgcgtgagg ctgatgagag tgacatgcct541 gaggtgaaga ccaaccctga tgatgtggtg gcacttccct attcgtcagg gacaacaggg601 ttgcccaaag gggtgatgtt atctcacaaa gggttggcga ccagcatagc acaacaagtt661 gatggggaaa accccaacct ctactttcac aatgaggatg tcatattgtg tgtgcttcca721 ctctttcata tatattctct caattctgtt ctgttgtgtg ggttgagagc caaggctgct781 attttgctga tgccaaagtt tgagatcaat gccttgttgg gtctcattca gaaacaccga841 gtaacaattg cccctattgt cccacccatt gttttggcca ttgccaagtc accggatctt901 gaaaagtatg atctctcttc cattagggtg ttgaaatctg gaggggcttc tctgggcaaa961 gaactcgaag acactgtgag ggctaaattc cccaaggcca aacttggaca gggatacgga1021 atgactgagg cagggccagt gctaacaatg tgcttagcat ttgctaagga accgatagat1081 gtaaaaccag gtgcatgtgg aaccgttgta agaaatgcag agatgaagat tgtggatcct1141 gaaactggta attcgttgcc acgaaaccag tccggtgaaa tttgcataag aggcgaccag1201 atcatgaaag gttatctaaa tgatcaagag gctacgcaga gaaccataga caaagaaggg1261 tggttgcata caggtgacat cggctacatc gacgatgacg atgagttatt catcgttgac1321 aggcttaagg aattgatcaa atacaaagga tttcaggtgg ctcctgctga actcgaagcc1381 cttcttctct ctcatcccaa gatcaccgat gctgctgtgg ttccaatgaa ggatgaagca1441 gctggagagg tacctgttgc atttgtggtg agatcaaatg gtcacacaga cacaaccgag1501 gatgaaatta agcagtttat ctccaaacag gtggtgtttt ataaaagaat aagcagagta1561 ttcttcattg atgcaattcc caagtcaccg tcaggtaaaa tcttacgaaa ggatctaaga1621 gcaaagcttg cagcaggtgt tccaaattga aaattctaat tccaagatat atgatattac1681 cattatcata cgatgcccgc acaaagctcc ataaaccttg aaggccagag tgcggacgcg1741 tgcttggagc ttgaccgcat tacttatatt cacacgaggg cagacatgat taccttaaaa1801 gggggggttg ctaattatat tttaaaacta tattgggtaa aatttgattc gatcaaggac1861 tttcatatta tataatatcg aagtataatt tttcaaaaaa aaaaaaaaaa a...
3. according to the described 4-coumaric acid that contains of claim 1: the recombinant vectors pUC19/4CL of the nucleotide sequence of CoA ligase gene 4CL.
4. according to the described 4-coumaric acid that contains of claim 3: the host cell JM109/pUC19/4CL of the recombinant vectors of the nucleotide sequence of CoA ligase gene 4CL.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 02132631 CN1390940A (en) | 2002-07-19 | 2002-07-19 | 4-coumaric acid: CoA ligase gene and its clone |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 02132631 CN1390940A (en) | 2002-07-19 | 2002-07-19 | 4-coumaric acid: CoA ligase gene and its clone |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1390940A true CN1390940A (en) | 2003-01-15 |
Family
ID=4746856
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 02132631 Pending CN1390940A (en) | 2002-07-19 | 2002-07-19 | 4-coumaric acid: CoA ligase gene and its clone |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1390940A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009140839A1 (en) * | 2008-05-20 | 2009-11-26 | Oil Crops Research Institute, Chinese Academy Of Agricultural Sciences | Use of a chimeric gene 4-cl encoding 4-coumarate: coa ligase in brassicaceae |
| CN1733924B (en) * | 2004-08-10 | 2010-05-05 | 北京林业大学 | A method for regulating plant lignin content |
| CN102458099A (en) * | 2009-06-05 | 2012-05-16 | 佛罗里达大学研究基金公司 | Isolation and targeted suppression of lignin biosynthetic genes from sugarcane |
| CN108531504A (en) * | 2018-04-04 | 2018-09-14 | 辽宁大学 | A method of efficiently formulating low content of lignin alfalfa using genetic engineering means |
| CN109810985A (en) * | 2019-04-03 | 2019-05-28 | 长江师范学院 | A kind of Ming River lily Lr4CL-1 gene and its application |
| CN115820577A (en) * | 2022-11-29 | 2023-03-21 | 中国科学院华南植物园 | Wolfberry 4-coumaric acid: application of encoding gene and protein of coenzyme A ligase |
-
2002
- 2002-07-19 CN CN 02132631 patent/CN1390940A/en active Pending
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1733924B (en) * | 2004-08-10 | 2010-05-05 | 北京林业大学 | A method for regulating plant lignin content |
| WO2009140839A1 (en) * | 2008-05-20 | 2009-11-26 | Oil Crops Research Institute, Chinese Academy Of Agricultural Sciences | Use of a chimeric gene 4-cl encoding 4-coumarate: coa ligase in brassicaceae |
| CN102458099A (en) * | 2009-06-05 | 2012-05-16 | 佛罗里达大学研究基金公司 | Isolation and targeted suppression of lignin biosynthetic genes from sugarcane |
| CN102458099B (en) * | 2009-06-05 | 2015-08-19 | 佛罗里达大学研究基金公司 | The separation of sugarcane Lignin biosynthesis gene and targeted inhibition |
| CN108531504A (en) * | 2018-04-04 | 2018-09-14 | 辽宁大学 | A method of efficiently formulating low content of lignin alfalfa using genetic engineering means |
| CN109810985A (en) * | 2019-04-03 | 2019-05-28 | 长江师范学院 | A kind of Ming River lily Lr4CL-1 gene and its application |
| CN109810985B (en) * | 2019-04-03 | 2020-06-05 | 长江师范学院 | Lilium regale Lr4CL-1 gene and application thereof |
| CN115820577A (en) * | 2022-11-29 | 2023-03-21 | 中国科学院华南植物园 | Wolfberry 4-coumaric acid: application of encoding gene and protein of coenzyme A ligase |
| CN115820577B (en) * | 2022-11-29 | 2023-06-20 | 中国科学院华南植物园 | Medlar 4-coumaric acid: encoding gene of coenzyme A ligase and application of protein |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112646792B (en) | Low-temperature inulase exonuclease mutant MutA122 delta 5 with reduced thermal stability and application | |
| CN112708607B (en) | Inulase mutant MutS120R with changed thermal adaptability and application thereof | |
| CN112725307B (en) | Low-temperature inulase exonuclease mutant MutG169 delta 4 with reduced heat resistance and application thereof | |
| CN112725309B (en) | Low-temperature inulase exo-mutant MutP126R stable at medium temperature | |
| CN112813052B (en) | Exo-inulase mutant MutDP121ET6 with improved low-temperature activity | |
| CN107012130A (en) | A kind of glucose oxidase mutant and its encoding gene and application | |
| KR20040020896A (en) | Cloning and Sequencing of Pyruvate Decarboxylase (PDC) Genes from Bacteria and Uses Therefor | |
| CN112980814A (en) | Exo-inulinase mutant MutV268 delta 13 with improved low-temperature adaptability | |
| CN112980813A (en) | Low-temperature modified exoinulase mutant MutS117G | |
| CN112852781A (en) | Heat-sensitive inulase mutant MutY119N and application thereof | |
| CN1390940A (en) | 4-coumaric acid: CoA ligase gene and its clone | |
| CN102719417B (en) | High-temperature resistance arabinfuranosidease Abf51B8, as well as gene and application thereof | |
| CN1401774A (en) | Uridine diphosphate glucose pyrophosphorylase gene and clone thereof | |
| CN105200068A (en) | Coding gene of meso-2,3-butanediol dehydrogenase, recombinase and preparation method and application of recombinase | |
| CN114410562B (en) | Klebsiella engineering bacterium and application thereof in ethanol production | |
| CN114736881B (en) | Glucose oxidase GoxM10 mutant A4D with improved acid stability and derivative mutant and application thereof | |
| CN1245507C (en) | High temperaturebeta- glucosaccharase, coding gene and uses thereof | |
| CN113430182B (en) | Bacterial laccase from Astrospiraceae of elephant intestinal tract and gene thereof | |
| CN105420218B (en) | A kind of xyloside of low temperature/arabinofuranosidase glucosides bifunctional enzyme AX543 and its gene and application | |
| JP2003502021A (en) | Epoxide hydrolase of Aspergillus origin | |
| WO2018114576A1 (en) | Glutathione reductase | |
| CN108865914B (en) | Recombinant saccharomyces cerevisiae strain capable of degrading lignocellulose and application thereof | |
| CN112852655A (en) | Saccharomyces cerevisiae engineering bacterium for displaying acid protease on cell surface as well as construction method and application thereof | |
| CN115896065B (en) | Stereoselective carboxylesterase, coding gene, vector and application thereof | |
| CN1500871A (en) | High temperaturealpha- amylase and coding gene thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |