CN113430182B

CN113430182B - Bacterial laccase from Astrospiraceae of elephant intestinal tract and gene thereof

Info

Publication number: CN113430182B
Application number: CN202110906606.1A
Authority: CN
Inventors: 黄遵锡; 张呈波; 苗华彪; 吴倩
Original assignee: Yunnan Normal University
Current assignee: Yunnan Normal University
Priority date: 2021-08-09
Filing date: 2021-08-09
Publication date: 2023-01-13
Anticipated expiration: 2041-08-09
Also published as: CN113430182A

Abstract

The invention discloses a bacterial laccase from Astrospiraceae of Asian elephant intestinal tract and a gene thereof, wherein the amino acid sequence of the bacterial laccase is shown as SEQIDNO.1, the coding gene is shown as SEQIDNO.2, the genome of a strain of bacteria of NK4A136 genus of the Astrospiraceae is obtained by assembling by using a metagenome component box technology, the gene containing multi-copper polyphenol oxidoreductase laccase is annotated by InterPro and Pfam databases, and the bacterial laccase is prepared by a gene engineering technology. Compared with laccase from fungi, the bacterial laccase has better pH stability and temperature stability.

Description

Bacterial laccase from Asian elephant intestinal lachnospiraceae and gene thereof

Technical Field

The invention belongs to the technical field of enzyme genetic engineering, and relates to bacterial laccase from Astrospiraceae of elephant intestinal tract and a gene thereof.

Background

Laccases (laccanase, EC 1.10.3.2), also known as phenolase, polyphenol oxidase, belong to the class of multicopper oxidases, which are capable of oxidizing a variety of aromatic compounds, ultimately reducing molecular oxygen to water. Therefore, laccase is a green catalyst with important application value.

Laccase is widely distributed in fungi and bacteriaBacteria, insects, and animals and plants. Compared with laccase from animals and plants, the microbial laccase has richer sources. The laccase from fungi has higher activity under the conditions of pH 4-6 and 30-55 ℃, and the industrial application usually needs high temperature and strong alkali environment, so that the laccase is limited in application and higher in cost. And the long growth period of the fungi has strict requirements on the culture medium, so that the fermentation tank is easily damaged mechanically, and the application of the fungal laccase in the industry is seriously influenced due to the problems. The bacterial laccase does not need glycosylation modification, usually exists in a monomer proteosome form, has wide pH application range and good thermal stability, and has Cu ²⁺ Resistance, and the like. These are of great significance for the broader application of laccases. At present, the excavation of bacterial laccase gene resources is less, and novel bacterial laccase with high activity and high stability needs to be further explored.

With the development of the second generation sequencing technology and the combination of metagenomic analysis means, the method can successfully avoid the difficult problem of the traditional microorganism pure culture technology in the aspect of digging the functional enzyme genes of the microorganisms, can quickly discover a large amount of functional enzyme genes in a short time, and improves the functional enzyme genes

The universality and the effectiveness of the screening greatly promote the improvement of the cloning efficiency of the functional enzyme gene, and provide a new research strategy for searching and discovering novel laccase genes.

Disclosure of Invention

The invention aims to overcome and avoid the defects of laccase in industrial production application, and provides a novel bacterial laccase coding gene from Asian elephant intestinal uncultured lachnospiraceae and an engineering strain for expressing the novel bacterial laccase gene.

According to the invention, the encoding gene of the novel laccase is derived from Asian elephant intestinal microorganism metagenome, a genome (the integrity is 96.44% and the pollution rate is 0) of a strain of uncultured lachnospiraceae NK4A136 bacteria is obtained by applying a Binning (Binning) technology, the genes (IPR 003730 and PF 02578.16) containing multi-copper polyphenol oxidoreductase laccase genes are annotated by InterPro and Pfam databases, and the highest consistency of the amino acid sequence of the laccase gene and the existing laccase amino acid sequence of the NR database is about 52%. The novel laccase coding gene is cloned and expressed in a bacillus subtilis expression system, and a bacillus subtilis high-stability laccase recombinant strain is obtained.

In order to achieve the technical purpose, the invention is specifically realized by the following technical scheme:

a bacterial laccase from Astrospiraceae is disclosed, wherein the amino acid sequence of the bacterial laccase is shown in SEQ ID NO. 1.

When the enzymatic properties of the novel laccase are determined by using a substrate 2,2' -biazonitrogen-di (3-ethyl-benzothiazole-6-sulfonic acid) diammonium salt (ABTS), the optimal action temperature is 70 ℃, and the optimal action pH is 5.

The pH stability and the thermal stability of the novel laccase are determined by using a substrate ABTS, and the results show that: has good stability within the pH range of 5-6 at 60 ℃, and has better pH stability and thermal stability than laccase from fungi as a novel laccase from uncultured lachnospiraceae bacteria in intestinal tracts of Asian elephants.

The encoding gene of the bacterial laccase is also prepared within the protection range of the invention, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO.2.

In another aspect of the invention, the gene encoding the bacterial laccase is inserted into an expression vector such that its nucleotide sequence is linked to an expression control sequence. A recombinant vector comprising the encoding gene is provided.

As a preferred embodiment of the invention, the coding gene of the bacterial laccase is connected with an expression vector pBE-S to obtain a recombinant Escherichia coli expression plasmid pBE-S-Laac2.

More preferably, the host cell used to express the bacterial laccase is e.

In another aspect of the invention, there is also provided a recombinant strain comprising a gene encoding said bacterial laccase.

Preferably, the recombinant strain is Bacillus subtilis, and more preferably, the recombinant strain is WB600/pBE-S-Lacc2.

In another aspect of the invention, there is provided a method for preparing the above novel bacterial laccase, comprising the following steps:

1) Taking Asian elephant intestinal metagenome DNA as a template, assembling genes for encoding laccase in the uncultured lacospiraceae bacterial genome according to metagenome binning technology, analyzing conserved sequences of the genes, designing encoding gene amplification primers Pf and Pr of the laccase, and obtaining a target laccase encoding gene lacc2 through PCR amplification;

an upstream primer Pf: CAATTCATGAATGATGATATGACAGCAG,

and a downstream primer Pr: gtcgacctadtctagcaaggcatgataac;

2) Carrying out EcoRI and SalI double enzyme digestion on a laccase coding gene lacc2 and an expression vector pBE-S, connecting T4 ligase, and then transforming to a cloning host E.coli DH5 alpha, and obtaining a recombinant plasmid pBE-S-lac 2 after colony PCR, enzyme digestion and sequencing verification are correct;

3) Transforming the recombinant plasmid pBE-S-lac 2 into a host bacillus subtilis WB600 and successfully expressing to obtain a recombinant strain for producing the novel laccase with high stability;

4) And a novel laccase Lacc2 with high yield and high stability is obtained by optimizing a fermentation process.

In another aspect of the invention, the laccase Lacc2 is used for decoloring crystal violet, alizarin red, isatin and active black 5.

The decolorization rates of the novel laccase Lacc2 to crystal violet, alizarin red, isatin and active black 5 within 6h are respectively 80.8%, 81.6%, 68.5% and 45.85% under the condition of no mediator; after mediator acetosyringone is added into the system, the decolorization rate of the novel laccase Lacc2 to active black 5 is improved to 84.95% within 6 h.

The beneficial effects of the invention are as follows:

the invention obtains a genome (with the integrity of 96.44% and the pollution rate of 0%) of a bacterium of the genus NK4A136 of the family lachnospiraceae without culture by assembling through a metagenome binning technology, annotates a multi-copper polyphenol oxidoreductase laccase gene by an InterPro and Pfam database, and obtains the bacterial laccase Lacc2 by preparing through a gene engineering technology. Compared with laccase from fungi, the bacterial laccase Lacc2 has good stability at 70 ℃ within the pH range of 5-6, and has better pH stability and temperature stability.

Drawings

FIG. 1 is a PCR amplification verification electrophoretogram of the novel laccase coding gene of the invention;

FIG. 2 is an enzyme-cutting electrophoresis diagram of recombinant plasmid pBE-S-lac 2 of the present invention;

FIG. 3 is the optimum temperature curve of Lacc2 for the laccase of the present invention;

FIG. 4 is the pH curve for optimum action of the novel laccase Lacc2 of the present invention;

FIG. 5 shows the decolorizing effect of the novel laccase Lacc2 of the present invention on 4 dyes, wherein A is the decolorizing effect of the novel laccase Lacc2 on 4 dyes under the condition of no mediator, and B is the decolorizing effect of the novel laccase Lacc2 on 4 dyes under the condition of mediator.

Detailed Description

The technical solutions of the present invention will be described clearly and completely with reference to specific embodiments of the present invention, and it should be understood that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be obtained by a person skilled in the art without making any creative effort based on the embodiments in the present invention, belong to the protection scope of the present invention.

The Asian elephant intestinal metagenome sequencing original data used by the invention is stored in a genome sequence archive library of a big data center of China academy of sciences, and the accession number is CRA003369.

Example 1 obtaining of laccase Gene from novel bacteria of the family Astrospiraceae uncultured in the intestinal tract of elephant Asian elephant

1. The novel laccase coding gene is derived from an Asian elephant fresh excrement metagenome stored in a laboratory, and the metagenome DNA of the Asian elephant fresh excrement metagenome is extracted by using a Kit (QIAamp DNA Stool Mini Kit), wherein the extraction steps of the Asian elephant fresh excrement metagenome DNA are as follows:

1) Weighing 0.2g of Asian elephant excrement into a sterilized centrifuge tube;

2) Adding 1.4mL buffer ASL, continuously swirling for several minutes until the mixture is fully mixed, incubating at 70 ℃ for 5min, and then swirling and mixing for 15s;

3) Centrifuging at 20,000g for 1min to remove fecal impurities, and collecting the supernatant to a new centrifuge tube;

4) Adding 1 inhibitor Tablet, mixing for 1min, standing at room temperature for 1min to adsorb the inhibitor onto the inhibitor matrix, and centrifuging at 20,000g for 3min;

5) Taking the supernatant to a new centrifugal tube, and centrifuging for 1 time again in the same way as in 4);

6) Sucking the supernatant into a new centrifuge tube added with 15 mu L of protease K, adding 200 mu L of buffer AL, fully and uniformly mixing, and then incubating at 70 ℃ for 10min;

7) Adding 200 μ L of anhydrous ethanol, mixing well, transferring to QIAamp adsorption column, and centrifuging for 1min at 20,000g (if the liquid does not completely pass through the column, repeating the centrifugation for 1 time);

8) Washing the column with 500. Mu.L buffer AW1 and AW2, respectively, centrifuging for 3min, and transferring the column to a new collection tube;

9) And adding a proper amount of buffer AE in the center of the adsorption column, standing at room temperature for 1min, centrifuging for 1min for elution, and allowing the obtained metagenome DNA to be used in downstream molecular biology experiments or stored at-20 ℃ for later use.

2. By a box separation (Binning) assembly technology of macrogenomics analysis, a genome (the integrity is 99.73 percent and the pollution rate is 0) of a bacterium of the genus NK4A136 of the family lacospiraceae without culture is obtained, an InterPro and Pfam database is annotated to contain a multicopper polyphenol oxidoreductase laccase gene (IPR 003730 and PF 02578.16), the result of a blast of an NR database shows that the consistency with the highest amino acid of laccase of the NR database is about 52 percent, the conserved sequence of the novel laccase is analyzed, and the amplification primers of the laccase coding gene are designed as follows:

an upstream primer Pf: CAATTCATGAATGATGATATGACAGCAG,

and a downstream primer Pr: gtcgacctadctatctagcaaggcatgataac;

the upstream and downstream primers Pf and Pr are used to amplify laccase gene expressed in Bacillus subtilis, and restriction sites EcoRI and SalI are introduced into the upstream and downstream primers, respectively.

The amplification template is Asian elephant intestinal metagenome DNA, and the PCR amplification reaction system is as follows: EX Taq 1.25. Mu.L, 10XBuffer 10. Mu.L, dNTP mix 5. Mu.L, pf and Pr each 2.5. Mu.L, DNA 5. Mu.L, ddH ₂ 0.75. Mu.L, total volume 100. Mu.L.

The amplification reaction conditions are as follows: 94 ℃,5min; 30s at 94 ℃; the temperature is between 55 and 61 ℃ for 30s;72 ℃ for 1min (2-4, 30 cycles); 72 ℃ for 10min;4 ℃ for 10min.

The PCR product is verified by 0.8% agarose gel electrophoresis to obtain a band of 795bp (figure 1), and the PCR product gel is recovered, then subjected to double enzyme digestion and purification recovery to obtain the novel bacterial laccase coding gene lacc2 of the Asian elephant intestinal unculture lachnospiraceae, shown as a sequence SEQ ID NO.2.

Example 2 construction of novel bacterial laccase recombinant plasmid derived from uncultured lachnospiraceae of elephant intestinal tract

1) Carrying out double digestion on the expression plasmid pBE-S by using restriction endonucleases EcoRI and SalI, carrying out double digestion on the expression plasmid pBE-S by using T4 ligase, carrying out enzyme digestion on a purified product of the pBE-S plasmid, connecting the purified product with a target gene after enzyme digestion at 16 ℃ overnight, and chemically converting the connected product to E.coli DH5 alpha.

2) Obtaining recombinant plasmid pBE-S-lacc2 after colony PCR identification, double enzyme digestion identification (figure 2) and correct sequencing;

3) A correctly verified clone of the recombinant plasmid pBE-S-lac 2 E.coli DH 5. Alpha./pBE-S-lac 2 plus 15% glycerol was stored at-80 ℃.

Example 3 construction of novel high-stability laccase recombinant bacteria of Bacillus subtilis

1) Adding 1 mu L (50 ng/. Mu.L) of pBE-S-lacc2 recombinant plasmid into the WB600 competent cells of the bacillus subtilis, and gently mixing the mixture evenly;

2) After mixing, transferring the mixture into a precooled electric rotating cup, carrying out electric shock once (3.0 kV, 3.0-4.5 ms) after ice bath for 1-1.5 min, and immediately adding 1mL of recovery culture medium (LB +0.5mol/L sorbitol +0.38mol/L mannitol) after the electric shock is finished;

3) After shaking culture at 37 ℃ for 3h, spreading the bacterial liquid on an LB plate containing Kan resistance, and culturing at 37 ℃ for about 16 h;

4) And (3) selecting positive transformants, carrying out double enzyme digestion verification, and determining to obtain the bacillus subtilis recombinant strain WB600/pBE-S-lac 2 for expressing lac 2.

Example 4 determination of laccase Activity

The determination of the enzyme activity is three parallel experiments, and the results are averaged.

Enzyme activity unit (U): the amount of laccase required to oxidize 1. Mu. Mol of ABTS in 1 min.

480. Mu.L of disodium hydrogenphosphate-citric acid buffer and 100. Mu.L of 3mmol/L ABTS were thoroughly mixed in advance, and then the mixture was subjected to water bath at 50 ℃ for 5min. 20 μ L of Lacc1 laccase solution was added quickly. OD was read at a wavelength of 420 nm.

The laccase enzyme activity has the following calculation formula:

enzyme activity (U/L) = (delta) _OD ×V ₁ ×n)/(Δ _t ×V ₂ ×ε×10 ^-6 )

In the formula,. DELTA. _OD The difference in absorbance at the beginning and end; v ₁ Is the total volume (mL) of the reaction system; n is the dilution multiple of the enzyme solution; delta _t Reaction time (min); v ₂ Is the volume (mL) of enzyme solution in the system; ε represents the molar digestion coefficient (L/(mol. Cm)).

pH optimum of laccase: at 50 ℃, the reaction system is placed in buffer solutions with different pH values (2.0-11.0), the enzyme activity is measured, the highest enzyme activity is 100 percent, and the optimal reaction pH value is obtained by comparison.

Optimum temperature: and (3) under the condition of the optimal reaction pH, respectively measuring the enzyme activity of the reaction system at different temperatures (30, 40, 50, 60, 70, 80, 90 and 100 ℃), and obtaining the optimal reaction temperature of the laccase by taking the highest enzyme activity as 100%.

pH stability: placing the enzyme solution in buffer solutions with different pH values, maintaining the temperature at 4 ℃ for 5h, taking the highest enzyme activity as 100%, and determining the residual enzyme activity.

And (3) measuring the thermal stability: under the condition of the optimal reaction pH, the laccase is placed under the condition of different temperature gradients (30-90 ℃) for incubation for 2 hours, and the residual enzyme activity of the Lacc1 laccase is determined by taking the highest enzyme activity as 100%.

The enzymatic properties of the novel laccase are determined by the method, and the enzymatic properties of the novel laccase are as follows:

when ABTS is used as a substrate to determine the enzymatic properties of the novel laccase, the optimal temperature is 70 ℃ (figure 3), and the optimal pH is 5 (figure 4);

the pH stability and the thermal stability of the novel laccase are determined by taking ABTS as a substrate, and the result shows that: the novel bacterial laccase has good stability within the range of pH 5-6 at 60 ℃. When the enzyme is stored for 4 days at 4 ℃ and pH =5, the residual enzyme activity reaches about 300%, and when the enzyme is stored for 4 days at 4 ℃ and pH =6.5, the residual enzyme activity reaches about 200%; when the enzyme is stored at 4 ℃ and pH =5 for 10 days, the residual enzyme activity reaches about 200%, and when the enzyme is stored at 4 ℃ and pH =6.5 for 10 days, the residual enzyme activity reaches about 200% (the enzyme activities are all determined at 70 ℃ and pH5, and the initial enzyme activity is taken as 100%).

Example 5 expression and preparation of novel laccases in recombinant strains of Bacillus subtilis

1) Selecting a Bacillus subtilis recombinant strain WB600/pBE-S-lacc2 single colony, inoculating the single colony into an LB liquid culture medium containing kanamycin, and oscillating at 37 ℃ for overnight culture;

2) Inoculating the seeds obtained by the culture in the step 1) into 50mL of LB liquid culture medium in an amount of 2%, and performing shake culture at 37 ℃ for about 48 hours;

3) Centrifuging the fermentation liquor obtained in the step 2), and collecting the supernatant to obtain a high-stability crude enzyme solution of the novel laccase;

4) Measuring the activity of crude laccase liquid enzyme (under the conditions of pH5 and 70 ℃) by using ABTS as a substrate, wherein the enzyme activity of laccase can reach 300U/mL after the novel laccase recombinant strain expressed by the bacillus subtilis is fermented, then precipitating the novel laccase by adopting a fractional salting-out method, collecting protein precipitate, dialyzing and desalting after dissolving, and then carrying out ion exchange chromatography and gel chromatography, and carrying out freeze drying to obtain the novel laccase pure enzyme powder.

Example 6 decolorization of 4 dyes and calculation of decolorization ratio by novel laccase Lacc2

The initial concentration of the alizarin is 1,000mg/L, the final concentration is 100mg/L, and the maximum absorption wavelength is 520nm; the initial concentration of the active black 5 is 400mg/L, the final concentration is 40mg/L, and the maximum absorption wavelength is 597nm; the initial concentration of the isatin is 250mg/L, the final concentration is 25mg/L, and the maximum absorption wavelength is 610nm; the initial concentration of crystal violet is 50mg/L, the final concentration is 5mg/L, and the maximum absorption wavelength is 583nm. The total volume of the medium-free decolorization reaction system is 12mL, and the medium-free decolorization reaction system comprises 1.2mL of dye mother liquor, 100 mu L of novel laccase Lacc2 crude enzyme solution and 0.2mol/L of Na with the pH value of 5 ₂ HPO ₄ -NaHPO ₄ Buffer 10.7mL. The total volume of the decolorizing reaction system with mediator is 12mL, and comprises 12 mu L of 0.1mol/L acetosyringone, 1.2mL of dye mother liquor, 100 mu L of crude enzyme solution of novel laccase Lacc2 and 0.2mol/L Na with pH value of 5 ₂ HPO ₄ -NaHPO ₄ Buffer 10.688mL. Decoloring in a shaking table at the temperature of 37 ℃ and at the speed of 200r/min, measuring the optical density values of different dyes at the maximum absorption wavelength at 2h, 4h and 6h, and calculating the decoloring rate of the novel laccase Lacc2 to various dyes. The decolorization ratio calculation formula is as follows: r = (A) ₀ -A)/A ₀ X 100%, where A is the optical density value of the dye at regular sampling, A0 is the optical density value of the initial dye, 3 replicates.

The decolouring rates of the novel laccase Lacc2 to crystal violet, alizarin red, isatin and active black 5 within 6h are respectively 80.8%, 81.6%, 68.5% and 45.85% under the condition of no mediator, and the decolouring effects to crystal violet and alizarin red are better; after the mediator acetosyringone is added into the system, the decolorization rate of the novel laccase Lacc2 on the active black 5 is improved to 84.95% within 6h (figure 5).

Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and alterations can be made in these embodiments without departing from the principles and spirit of the invention, the scope of which is defined in the appended claims and their equivalents.

Sequence listing

<110> university of Yunnan

<120> a bacterial laccase derived from Astrospiraceae family of elephant intestine and gene thereof

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 264

<212> PRT

<213> laccase (Lacc 2)

<400> 1

Met Asn Asp Met Thr Ala Val Ile Lys Thr Ser Ser Lys Ile Lys Ser

1 5 10 15

Pro His Gly Phe Ser Thr Arg Ile Gly Gly Val Ser Thr Gly Ile Phe

20 25 30

Asp Ser Leu Asn Leu Gly Met Asn Arg Gly Asp Asp Glu Asn Leu Val

35 40 45

Lys Glu Asn Trp Arg Arg Phe Met Glu Ala Ser Gly Ile Ser Glu Glu

50 55 60

Lys Phe Val Cys Gly Lys Gln Val His Gly Asn Tyr Val Gln Ile Ala

65 70 75 80

Thr Ser Lys Ile Ala Arg Pro Ala Tyr Gly Pro Gly Trp Met Ala Glu

85 90 95

Ala Asp Gly Tyr Val Thr Asn Glu Pro Gly Leu Pro Leu Ala Val Phe

100 105 110

Thr Ala Asp Cys Val Pro Val Leu Leu Glu Asp Tyr Val Ala Gly Val

115 120 125

Val Ala Ala Val His Cys Gly Trp Arg Ser Thr Val Ala Asp Ile Glu

130 135 140

Lys Glu Thr Ile Glu Lys Met Val Gly Leu Gly Ala Ser Thr Thr Asn

145 150 155 160

Ile Asn Val Ala Ile Gly Pro Ala Ile Cys Asp Lys Cys Phe Gln Val

165 170 175

Gly Ser Glu Val Ile Gly Ala Val Asn Lys Leu Leu Asn Gly Val Glu

180 185 190

Thr Gly Asp Leu Tyr Phe Pro Asp Lys Glu His Asp Asp Lys Phe Tyr

195 200 205

Leu Asn Leu Arg Gly Val Val Lys Arg Arg Phe Met Met Leu Gly Val

210 215 220

Leu Glu Asp Asn Ile Glu Val Ser Arg Glu Cys Thr Met His Gln Pro

225 230 235 240

Thr Glu Tyr Trp Ser His Arg Tyr Thr His Gly Glu Arg Gly Ser Gln

245 250 255

Ala Asn Val Ile Met Leu Ala Arg

260

<210> 2

<211> 795

<212> DNA

<213> laccase Gene (lac 2)

<400> 2

atgaatgata tgacagcagt tattaaaact tcttctaaaa taaagagtcc tcatggcttt 60

tcaacaagaa ttggaggcgt gagtacagga atattcgatt ctcttaatct tggaatgaat 120

agaggcgacg atgaaaatct cgtcaaggaa aactggcgac gattcatgga ggccagtgga 180

ataagtgaag aaaaattcgt gtgtggcaag caggtgcatg gtaattatgt gcagattgct 240

acaagtaaaa tcgcgaggcc tgcatatgga cctggctgga tggcagaggc cgatggctat 300

gttaccaatg aaccagggct tccgctagct gtttttacag ctgattgtgt gccagtgctg 360

ctagaagatt atgtggccgg agttgtcgca gcggtacact gtggatggcg aagtacagtg 420

gctgatatag aaaaggaaac cattgagaag atggtgggac taggcgctag cactactaat 480

attaatgtgg caataggacc agccatatgt gacaagtgct ttcaagttgg tagtgaagtt 540

attggtgccg ttaataaact tcttaatggt gttgaaacag gggatttata ttttccagat 600

aaagagcatg atgataaatt ctatcttaac ctaagagggg tagtaaaaag acggtttatg 660

atgcttggtg tactagaaga caatattgaa gtatccaggg aatgtacaat gcatcaacca 720

actgaatact ggtctcatcg atatacacat ggtgagagag gaagtcaggc caacgttatc 780

atgcttgcta gatag 795

<210> 3

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

caattcatga atgatatgac agcag 25

<210> 4

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gtcgacctat ctagcaagca tgataac 27

Claims

1. A bacterial laccase derived from Asian elephant intestinal metagenome is characterized in that the amino acid sequence of the bacterial laccase is shown in SEQ ID NO. 1.

2. The gene encoding the bacterial laccase of claim 1, wherein the nucleotide sequence is shown in SEQ ID No.2.

3. A recombinant plasmid comprising the coding gene of claim 2.

4. A recombinant bacterium comprising the coding gene according to claim 2.

5. Use of the bacterial laccase enzyme of claim 1 for the decolorization of crystal violet, alizarin red, isatin and active black 5.