CN1330664A - Platelet-derived growth factor C, DNA coding therefor and uses thereof - Google Patents

Abstract

A method for modulating vasculogenesis or angiogenesis using the core domain protein of PDGF-C, a new member of the PDGF/VEGF family of growth factors, or a homodimer or a heterodimer comprising the core domain. Also disclosed are pharmaceutical compositions comprising the core protein, nucleotide sequences encoding the protein, and uses thereof in medical and diagnostic applications.

Description

Platelet-derived growth factor C, its coding DNA and application thereof

The present invention relates to the somatomedin of phoirocyte, inoblast, myofibroblast and neuroglia archeocyte and/or the somatomedin of endotheliocyte, relate in particular to new Thr6 PDGF BB/vascular endothelial growth factor like growth factor, the polynucleotide sequence of this factor of encoding, and utilize or derived from medicine and the diagnosis composition and the method for this factor.

Background of invention

In the embryo who grows, the formation of nascent vasoganglion realizes that by the differentiation of mesoblastema original position this process is called blood vessel and takes place.Subsequently all relate to the process of the generation of neovascularity in the generation of new vessel among the embryo or the adult, sprouting or fission process decision all by the capillary vessel in the established vascular system, this process is called vasculogenesis (Pepper et al., Enzyme ﹠amp; Protein, 1,996 49 138-162; Breier et al., Dev.Dyn.1995 204 228-239; Risau, Nature, 1,997 386 671-674).Angiogenesis not only growth, reparation and the regeneration with fetal development and healthy tissues is relevant, and relates to the reproductive cycle of female, the formation of gestation and the recovery process of maintenance and wound and fracture.Vasculogenesis not only takes place in normal individual, also the pathologic process with a large amount of is relevant, especially with growth of tumor and shift relevant, also with some other and vascular proliferation, especially the pathologic process of capillary blood vessel system propagation is relevant, for example retinopathy, psoriasis and the sacroiliitis of diabetes initiation.So, suppress the symptom that vasculogenesis just helps prophylactic generation or palliates a disease.

On the other hand, in some occasions that need carry out vascularization or need to promote vascularization, for example after tissue or organ transplantation, perhaps be common in coronary heart disease, the occlusive vasculitis when need in wound tissue or narrow artery is other setting up branch, promote the generative process of blood vessel to wish again to carry out.

The angiogenesis high complexity comprises that keeping endotheliocyte is in the cell cycle, the matrix that degradation of cell is outer, move into and insert around tissue, form pipeline at last.The molecular mechanism of angiogenesis complexity also head and shoulders above people now to its understanding.

Because the vital role of vasculogenesis in many physiology and pathologic process, people have carried out careful research to the factor relevant with the control vasculogenesis.Many somatomedins are proved to be can the modulating vascular generative process.These somatomedins comprise fibroblast growth factor (FGFs), Thr6 PDGF BB (PDGF), transforming growth factor α (TGF α) and pHGF (HGF).See Folkman et al., J.Biol.Chem., 1992267 10931-10934 (review).

Someone thinks, special class in the growth factor family of endothelial cell specific, be vascular endothelial growth factor (VEGFs), the growth and the differentiation of VEGFs and their pairing acceptors and stimulating endothelial cell, directly related thereby differentiation becomes the process with specific function cell.These factors all belong to PDGF family, and mainly all are to realize function by endothelium receptor tyrosine kinase (RTKs).

Nine kinds of different protein in the PDGF family are determined, difference called after PDGF-A, PDGF-B, VEGF, remaining six protein and VEGF ten minutes are close, be respectively: VEGF-B, as seen international monopoly PCT/US96/02957 (WO 96/26736) and United States Patent (USP) 5,840,693 and 5,607,918 (Ludwig cancer research institute and Helsinki universities); VEGF-C, visible Joukov et al., EMBO J., 1,996 15 290-298 and Lee etal., Proc.Natl.Acad.Sci.USA, 1,996 93 1988-1992; VEGF-D, visible international monopoly PCT/US97/14696 (WO 98/07832) and Achen et al., Proc.Natl.Acad.Sci.USA, 1,998 95 548-553; Placenta growth factor (P1GF), visible Maglione et al., Proc.Natl.Acad.Sci.USA, 1,991 88 9267-9271; VEGF2, visible international monopoly PCT/US94/05291 (WO 95/24473) (HumanGenome Sciences, Inc.) and VEGF3, and visible international monopoly PCT/US95/07283 (WO 96/39421) (Human Genome Sciences, Inc.).Member in the VEGF family compares with VEGF, and it is identical that aminoacid sequence all has 30%-45%.The member of VEGF family is contained the homeodomain of a VEGF, the cysteine knot that is made of six cysteine residues.The function of VEGF family comprises the degree that changes endothelial cell mitogen, the variation that causes vascular permeability, vasculogenesis and lymphatic vessel character.

Vascular endothelial growth factor (VEGF) is a homologous dimerization glycoprotein, can separate from multiple source.VEGF can high special the endotheliocyte that makes produce the mitotic division activity.In the embryonic blood vessel generating process, form new blood vessel or in the angiogenesis of adult, VEGF plays very important regulating and controlling effect (Carmeliet et al., Nature, 1996380 435-439; Ferrara et al., Nature 1,996 380 439-442; Freeara, Davis-Smyth, Endocrine Rev., 1,997 18 4-25).If make the allelic inactivation of a VEGF, the embryo will cause death because vascular system can't be grown, importance (Carmeliet et al., Nature, 1,996 380 435-439 of the visible performed function of VEGF; Ferrara etal., Nature 1,996 380 439-442).In addition, VEGF also has very strong chemical derivatization to monocyte, can produce plasminogen activators and plasminogen activators inhibitor in the inducing endothelial cell, can also impel capillary blood vessel to produce permeability.Owing to can impel capillary blood vessel to produce permeability, so usually be also referred to as blood vessel permeability factor (VPF).The separation method of VEGF and character can be referring to Ferrara et al., J.Cellular Biochem., 1,991 47 211.218 and Connolly et al., J.CellularBiochem..1991 47 219-223.The brachymemma of VEGF gene on the mRNA level produced the isomer of five kinds of VEGF.

VEGF-B compares with VEGF, have similar vasculogenesis and other character, but the tissue of VEGF expression-B and VEGF expression is different.VEGF-B is great expression in heart, and in lung seldom, and VEGF is on the contrary.This shows that though VEGF-B and VEGF are expressed simultaneously, the function that may exercise is variant in many tissues.

VEGF-B catches triage techniques by the interaction of yeast cohybridization to carry out isolating.Interactional cell protein can take place with I type cell arborescens acidity conjugated protein (CRABP-I) in screening.Visible patent PCT/US96/02957 of concrete sepn process and character thereof and Olofsson et al., Proc.Natl.Acad.Sci.USA, 1996 932576-2581.

VEGF-C is from the substratum of cultivating PC-3 prostate cancer cell line (CRL1435), screens and obtains according to whether carrying out this phenomenon of tyrosine phosphorylation to receptor tyrosine kinase VEGFR-3 (Flt4) special on the endotheliocyte.Wherein, VEGFR-3 is expressed by cells transfected system.Utilize the affinity column that is connected with reorganization VEGFR-3 that VEGF-C is carried out purifying again, again it is cloned from PC-3 cDNA library.Concrete sepn process and its visible Joukov et of related properties al., EMBO J., 1,996 15 290-298.

VEGF-D can separate from human mammary cDNA library and obtains, and this library can directly be bought from Clontech.Screen as hybridization probe with this EST of " Soares Breast3NbHBst " among the human cDNA library (Achen et al., Proc.Natl.Acad.Sci.USA, 1,998 95 548-553).Concrete sepn process and its visible international monopoly PCT/US97/14696 of related properties (WO98/07832).

The VEGF-D gene is wide expression in becoming human body, but neither express everywhere certainly.VEGF-D is great expression in heart, lung and skeletal muscle.The intermediate of VEGF-D also has expression at spleen, ovary, small intestine and colon, and the expression degree in kidney, pancreas, thymus gland, prostate gland and testis reduces.And in brain, placenta, liver or peripheral leukocytes, detect mRNA less than VEGF-D.

PlGF can separate from mature placenta cdna library and obtains.Concrete sepn process and its visible Maglione et of related properties al., Proc.Natl.Acad.Sci.USA, 1,991 88 9267-9271.Its concrete biological function it be not immediately clear.

VEGF 2 can never rely on to separate among the estrogenic human breast cancer cell line and obtain.VEGF 2 and PDGF have 22% homology, have 30% homology with VEGF.Also do not have method to separate now to encode the gene of VEGF2, do not have the relevant data of VEGF 2 biologic activity yet.

VEGF 3 can separate from the cDNA library that derives from colon and obtains.VEGF3 compares with VEGF, and it is identical that 36% part is arranged, and 66% part is similar.Also do not have method to separate now to encode the gene of VEGF3, do not have the relevant data of VEGF 3 biologic activity yet.

Two proteic similarity degrees are by the variation decision of conserved amino acid between comparing amino acid sequence and two protein, and relatively two proteinic same degree are the comparing amino acid sequence, and do not compare the variation of conserved amino acid between two protein.

The PDGF/VEGF family member can with the tyrosine kinase receptor combination.Five kinds of distinctive tyrosine kinase receptors of endotheliocyte have been had been found that now, respectively called after VEGFR-1 (Flt-1), VEGFR-2 (KDR/Flk-1), VEGFR-3 (Flt-4), Tie and Tek/Tie-2.They all have the necessary tyrosine kinase activity of signal conduction.VEGFR-1, VEGFR-2, VEGFR-3, Tie and Tek/Tie-2 play a part very key and special in blood vessel generation and vasculogenesis, and this is by being proved the test of these acceptor inactivations by rite-directed mutagenesis in mice embryonic.

Energy and VEGFs bonded tyrosine kinase receptor now are VEGFR-1VEGFR-2 and VEGFR-3.VEGFR-1 and VEGFR-2 can be high special with the VEGF combination, simultaneously VEGFR-1 can also and VEGF-B and PlGF combination.VEGF-C is the part of VEGFR-3, also can activate VEGFR-2 (Joukov et al., TheEMBO Journal, 1,996 15 290-298) simultaneously.VEGF-D and VEGFR-2 and VEGFR-3 can in conjunction with.About the part of Tek/Tie-2 can referring to international monopoly No.PCT/US95/12935 (WO 96/11269) (Regeneron Pharmaceuticals, Inc.).The part of Tie is not still found so far.

Recently, a kind of special acceptor of new VEGF shaped body is purified and clones, and size is 130-135Kda (Soker et al., Cell, 1,998 92 735-745).This vegf receptor can by the sequences of outer unit 7 codings very special and VEGF ₁₆₅In conjunction with, but it has only more weak binding ability (Soker et al., Cell, 1,998 92 735-745) with heparin.Surprisingly, this acceptor is identical with human NP-1, and NP-1 relates to a neural early stage acceptor that takes place.PlGF-2 also can have an effect (Migdal et al., J Biol.Chem., 1,998 273 22272-22278) with NP-1.

VEGFR-1, VEGFR-2 and VEGFR-3 are expressed by endotheliocyte.VEGFR-1 and VEGFR-2 express (Oelrichs et al., Oncogene, 1,992 8 11-18 by blood vessel endothelium; Kaipainen et al., J.Exp.Med., 1,993 178 2077-2088; Dumont et al., Dev.Dyn., 1,995 203 80-92; Fong et al., Dev.Dyn., 1,996 207 1-10).VEGFR-3 expresses (Kaipanen et al., Proc.Natl.Acad.Sic.USA, 1,995 9 3566-3570) by the lymph endothelium of adult tissue.VEGFR-3 simultaneously also can be by the vascular expression around tumour.

Remove the VEGFR gene and can cause vascular system heteroplasia, make in embryonic death second trimester of pregnancy.Show that by analysis this acceptor is necessary (Fong et al., Nature 1995376 66-70) in endothelial function sex organization process to the embryo that has complete deactivation VEGFR-1 gene.But the gene that has only lacked the interior Tyrosylprotein kinase area part of born of the same parents of coding VEGFR-1 but produces the mouse with normal blood vessels system (Hiratsukaet al., Proc.Natl.Acad.Sci.USA 1,998 95 9349-9354) that can survive.The reason of above-mentioned difference still remains to be explained, but can infer thus that the receptor signal conduction undertaken by Tyrosylprotein kinase is not necessary for the realization of the normal function of VEGFR-1.By the homozygote mouse of VEGFR-2 gene with inactivation be studies show that this acceptor is necessary (Shalaby et al., Nature, 1,995 376 62-66 for the generation of cell proliferation, hemopoietic and vascular system; Shalaby et al., Cell, 1,997 89 981-990).The inactivation of VEGFR-3 can cause the mistake of cardiovascular systems, because this can make great vessels recombinate unusually (Dumont et al., Science, 1,998 282 946-949).

Though VEGFR-1 mainly expresses in endotheliocyte in growth course, the embryo (Fong et al., Nature 1995 37666-70) take place also to produce in early days in the green blood precursor cell.In adult, monocyte and scavenger cell are also expressed this acceptor (Barleon etal., Blood, 1,996 87 3336-3343).In the embryo, VEGFR-1 is by the overwhelming majority, but is not whole vascular expressions (Breier et al., Dev.Dyn., 1,995 204 228-239; Fong et al., Dev.Dyn., 1,996 207 1-10).

Acceptor VEGFR-3 is in fetal development wide expression in endotheliocyte in early days, but along with embryogenetic process, its expression amount in venous endothelial and lymph endothelium is limited (Kaipainen et al., Cancer Res., 1,994 54 6571-6577; Kaipainen et al., Proc.Natl.Acad.Sci.USA 1,995 92 3566-3570).VEGFR-3 is expressed in the lymph endotheliocyte of adult tissue.This acceptor is very crucial for vascular development in embryo's generating process.The VEGFR-3 gene of mouse is carried out directed inactivation, because having the great vessels of defect cavities takes place unusual from group, can cause the formation of defective blood vessel, thereby make liquid in pericardial cavity, be detained, 9.5 days cardiovascular systems generation dysfunctions after sexual intercourse.Find according to these, can infer that VEGFR-3 is being necessary from elementary vasoganglion to bigger vascular development process.But VEGFR-3 can't study now in the developmental function of lymphatic vessel, because above-mentioned mice embryonic is dead before lymphsystem forms.Scientists is inferred in the lymph endotheliocyte of VEGFR-3 in lymph generation and adult certain expression, thereby the do effect has been taken place for lymphatic vessel growth and lymph.This is the supposition of making according to the ectopic expression phenomenon of finding VEGF-C in the skin of transgenic mice, and what obtain is the aglucon of a kind of VEGFR-3, and its generation is owing to the propagation of lymph endotheliocyte in the corium and the increase of blood vessel.This finds also further to show, the perhaps basic functions of VEGF-C is its effect in the lymph endothelium, subsidiary function is to exercise effect in vasculogenesis jointly with VEGF in addition, and blood vessel osmotic pressure is regulated and control (Joukov et al., EMBO J., 1,996 15 290-298).

Because have the mechanism that antitumor tissue blood vessel takes place, the inhibitor of some VEGF and vegf receptor system can suppress growth of tumor.As seen Kim et al., Nature, 1993362 841-844; Saleh et al., Cancer Res., 1,996 56 393-401.

By the above-mentioned content of mentioning, the VEGF family of somatomedin all is the member of PDGF family.PDGF all has important effect (Heldin et al. aspect the growth of phoirocyte, inoblast, myofibroblast and neurogliocyte and the motion, " Structure of platelet-derived growth factor:Implications for functionalproperties ", Growth Factor, 1,993 8 245-252).In adult, PDGF can promote the healing (Robson et al., Lancet, 1,992 339 23-25) of wound tissue.On the structure, homodimer (PDGF-AA or PDGF-BB) or heterodimer (PDGF-AB) that homeopeptide chain A that PDGF is connected by disulfide linkage or B form.

PDGF and isomer thereof are to realize its function by combining with the receptor tyrosine kinase (RTKs) that interrelates of two structures on the target cell.The A chain of acceptor α and PDGF, B chain can both in conjunction with, and acceptor β can only with the B chain combination.These two kinds of acceptors can be by the expression of cell lines of many vitro culture, but is mainly expressed by intravital mesenchymal cell.PDGFs can be in the chemotaxis (as seen summarizing Heldin et al., Biochim Biophys Acta., 1,998 1378 F79-113) of external regulating cell propagation, cell survival and pair cell.In vivo, because PDGFs expresses in epithelial cell (PDGF-A) or endotheliocyte (PDGF-B), near matter between the PDGFR expression, so PDGF can bring into play effect in mode faster.In the clone of tumour cell or vitro culture, the coexpression of PDGFs and pdgf receptor can produce the automatic transmission ring of signal, this pair cell transition extremely important (Betsholtz et al., Cell, 1,984 39 447-57; Keating et al., J.R.Coll SurgEdinb., 1,990 35 172-4).The overexpression of PDGFs is found under some pathologic conditions, comprise malignant tumour, arteriosclerosis and fiber propagation sick (Heldinet al., TheMolecular and Cellular Biology of Wound Repair, New York:PlenumPress, 1996,249-273).

Importance as the PDGFs of cell proliferation and cell survival regulator is realized in the decision-orientated study of the mouse genes involved that carries out recently, test shown between the aglucon of different PDGFRs can take place some overlapping, the peculiar effect that PDGFs and their acceptor are brought into play in physiological process.Having the PDGF aglucon of two null mutations or the homozygote of its acceptor can't survive.The homozygote mouse of about 50% PDGF-A defective has the early stage phenotype that causes death, and the mouse of remaining survival has complicated phenotype in postpartum, concrete situation is for owing to lacking the abnormal formation that the alveolar myofibroblast causes alveolar membranes, thereby suffers from pulmonary emphysema (Bostrom et al., Cell, 1,996 85 863-873).In addition, the mouse of PDGF-A defective also can have the phenotype of epidermis defective, is characterized as that dermal tissue is thin, odd-shaped hair follicle and sparse hair (Karlsson et al., Development, 1,999 126 2611-2).In the process that the myelin of the growth of oligodendroglia and central nervous system forms, also need PDGF-A (Fruttiger et al., Development, 1999126 457-67).The easier generation body early embryo of the phenotype death of PDGFR-α defective, the non-complete closure of head, neural crest heteroplasia, cardiovascular systems defective and skeletal defect (Soriano et al., Development, 1,997 124 2691-70).The mouse of PDGF-B and PDGFR-β defective also has and above-mentioned similar phenotype, and feature usually is unusual (Leveen et al., Genes Dev., 1,994 8 1875-1887 of kidney, blood and cardiovascular systems; Soriano et al., Genes Dev., 1,994 8 1888-96; Lindahi et al., Science, 1997277 242-5; Lindahi, Development, 1,998 125 3313-2).Its middle kidney and cardiovascular systems unusually to the small part with the correct blood vessel of recombinating relevant (Leveen et al., GenesDev., 1,994 8 1875-1887 that lack parietal cell (cardiovascular smooth muscle cell, adventitial cell or mesangial cell); Lindahl et al., Science, 1,997 277 242-5; Lindahlet al., Development, 1,998 125 3313-2).

The present invention's general introduction

The present invention disclosed a kind of have stimulate and/or strengthen can PDGF-B expression-C acceptor cell proliferation or the new somatomedin of differentiation and/or growth and/or mobility function, these cells comprise, but be not limited only to endotheliocyte, phoirocyte, myofibroblast and neurogliocyte.In addition, all belong to category of the present invention by polynucleotide sequence new somatomedin that gives expression to and the drug regimen composition formula that is used for the treatment of and diagnose.

First, the present invention has disclosed a kind of isolating and purified polynucleotide molecule, the nucleotide sequence that this polynucleotide molecule comprises is identical with 37 to 1071 of nucleotide sequence (SEQ ID NO:2) shown in Figure 1,6 to 956 of nucleotide sequence (SEQ IDNO:3) shown in Figure 3 or nucleotide sequence (SEQ ID NO:6) shown in Figure 5 196 to 1233 at least 85% at least, have 90% identical better, preferably 95% is identical.Nascent polypeptide of 196 to 1233 codings of 37 to 1071 of nucleotide sequence shown in Figure 1 (SEQ ID NO:2), 6 to 956 of nucleotide sequence (SEQ ID NO:3) shown in Figure 3 or nucleotide sequence (SEQ ID NO:6) shown in Figure 5, called after is PDGF-C (original called after " VEGF-F "), and it is a homologous with PDGF-A, PDGF-B, VEGF, VEGF-B, VEGF-C and VEGF-D structurally.In the specific examples that proposes, nucleic acid molecule is 196 to 1233 the cDNA molecule that contains 37 to 1071 of nucleotide sequence shown in Figure 1 (SEQ ID NO:2), 6 to 956 of nucleotide sequence (SEQ IDNO:3) shown in Figure 3 or nucleotide sequence (SEQ ID NO:6) shown in Figure 5.Simultaneously, the present invention also comprises such nucleic acid molecule, it can with 196 to 1233 or their fragment hybridize under stringent condition of 37 to 1071 of nucleotide sequence (SEQ ID NO:2) shown in Figure 1,6 to 956 of nucleotide sequence (SEQ ID NO:3) shown in Figure 3 or nucleotide sequence (SEQ ID NO:6) shown in Figure 5.

Second, peptide molecule of the present invention have stimulate and/or strengthen can PDGF-B expression-C acceptor cell proliferation or the function of differentiation and/or growth and/or mobility, these cells comprise, but are not limited only to endotheliocyte, phoirocyte, myofibroblast and neurogliocyte.Its aminoacid sequence such as Fig. 2 (SEQ ID NO:3), Fig. 4 (SEQIDNO:5), Fig. 6 (SEQ ID NO:7) or their fragment and having stimulate and/or strengthen can PDGF-B expression-C acceptor cell proliferation or the analogue of the function of differentiation and/or growth and/or mobility, these cells comprise, but be not limited only to endotheliocyte, phoirocyte (as inoblast), myofibroblast and neurogliocyte.It is identical that amino acid sequence of polypeptide should have 85% part with Fig. 2 (SEQ ID NO:3), Fig. 4 (SEQ ID NO:5), Fig. 6 (SEQ ID NO:7), their fragment or aminoacid sequence with analogue of PDGF-C biologic activity, be more preferably 90% identically, preferably 95% part is identical.In specific examples of the present invention, peptide molecule is the PDGF-C truncate that includes PDGF/VEGF homeodomain (PVHD) part among the PDGF-C.This territory is from 230 to 345 of amino-acid residues.But 164 of through residues can be extended to the N end in this zone.Here, PVHD is defined as the truncate of PDGF-C.The truncate of PDGF-C is a kind of activity form of PDGF-C.

In the present invention, the sequence same degree relatively be by Lasergene software package (DNASTAR, Ltd.Abacus House, Manor Road, West Ealing, LondonW130AS United Kingdom) compare tool " MEGALIGN " in carries out.The people is for refining for the comparison procedure process.The ratio of same degree is calculated according to the sequence in the comparison.

These polypeptide or by the polynucleotide polypeptide expressed should have stimulate and/or strengthen can PDGF-B expression-C acceptor cell proliferation, differentiation, mobility, survival or cardiovascular infiltrative function, these cells comprise, but be not limited only to cardiovascular endotheliocyte, lymph endotheliocyte, phoirocyte (for example inoblast), myofibroblast and neurogliocyte.In addition, also should promote wound healing.PDGF-C also has angiogenic effect, and this is one of activity of PDGF-C.These character are referred to as " biologic activity of PDGF-C " hereinafter, can identify by method common in this area.

Here, " PDGF-C " refers to peptide molecule and their fragment or the analogue with above-mentioned PDGF-C biologic activity of Fig. 2 (SEQ ID NO:3), Fig. 4 (SEQ ID NO:5), Fig. 6 (SEQ ID NO:7).PDGF-C or its fragment or have the polynucleotide of the analogue of PDGF-C biologic activity also can refer to encode.This polynucleotide can be natural, also can be to be present in the carrier or in the liposome.

On the other hand, the present invention has disclosed a kind of polypeptide with following aminoacid sequence: PXCLLVXRCGGXCXCC (SEQ ID NO:1).These sequences only exist in PDGF-C, thereby can distinguish mutually with other member in the somatomedin PDGF/VEGF family, difference is to have inserted three amino-acid residues (NCA) between third and fourth halfcystine (seeing Fig. 9, SEQ ID NO:8-17).

With replacement, insertion or the deletion mutantion that polypeptide is guarded, still still keep the biologic activity of PDGF-C, the peptide molecule of such sudden change obviously also belongs to category of the present invention.Worker in this area should understand the method that can obtain aforementioned polypeptides, for example uses site-directed mutagenesis technique, special enzyme to cut to handle and is connected.In addition, the amino-acid residue in the mixture of this peptide species composition is substituted with non-natural amino acid or amino acid analogue, also might still be had the active protein complex of PDGF-C.Can and identify these mixtures with method preparation common in this area.Obviously, these polypeptide complexes also belong to category of the present invention.

In addition, because the possible variant of the PDGF-C peptide molecule that the spontaneous allelic variant phenomenon of nucleotide sequence of selectivity brachymemma (VEGF and VEGF-B are owing to the selectivity brachymemma produces) and coding PDGF-C produces also belongs to category of the present invention.Allelic variant is the standard terminology in this area, be meant that the sudden change that substitutes, lacks or insert has taken place one section nucleotide sequence on the position of one or several Nucleotide, but these changes the function that does not influence its polypeptide expressed.

Such PDGF-C variant can obtain by the nonessential zone of PDGF-C polypeptide is modified.These nonessential districts should be outside the zone as the pointed high conservative of Fig. 9 (SEQ ID NO:8-17).Particularly, somatomedin PDGF family, comprise VEGF, be dimer, and VEGF, VEGF-B, VEGF-C, VEGF-D, PlGF, PDGF-A and PDGF-B have 8 conservative fully halfcystine zones at the N end, for example be similar to zone (Olofsson et al., Proc.Natl.Acad.Sci.USA, 1,996 93 2576-2581 of PDGF/VEGF; Joukov et al., EMBO J., 1996 15290-298).These halfcystines may be relevant with the formation of intermolecular and intramolecular disulfide linkage.In addition, have high conservative, but be not complete conserved cysteine residue at the C end regions.Intramolecular disulfide bond has formed the ring 1,2 and 3 in each subunit, the receptors bind of these sites and somatomedin PDGF/VEGF family relevant (Andersson et al., GrowthFactors.1995 12 159-164).

Professional in this area should understand and has in the active variant these cysteine residues at those and should guard, and the amino acid of the avtive spot in the ring 1,2 and 3 also should be guarded.And other zone in the molecule does not just seem so important on biological function, can carry out certain modification.These pass through modified polypeptides and also should identify the PDGF-C activity by the activity test method of routine, for example the fibroblast proliferation analytical procedure in the use-case 6.

Some through PDGF-C polypeptide of modification have with cell on the ability of PDGF-C receptors bind, these cells comprise, but be not limited only to, endotheliocyte, phoirocyte, myofibroblast and/or neurogliocyte, but but can not stimulate cellular proliferation, break up, migration, mobility strengthens and survival, perhaps induction of vascular propagation, reticular tissue grow, wound healing.These modified polypeptides can be used as the competitiveness or the noncompetitive inhibitor of the somatomedin of PDGF-C polypeptide and PDGF/VEGF family, can be used for the occasion that needs suppress or reduce the somatomedin effect of PDGF-C polypeptide and PDGF/VEGF family.These have binding ability, still can not induce mitotic division, do not induce differentiation, do not induce migration, do not strengthen movability, do not improve survival rate, not promote the PDGF-C polypeptide variants of vascular proliferation and wound healing also to belong to category of the present invention.Here be called " can be but do not have other active variant " with receptors bind.In order to activate its unique acceptor, PDGF-C forms a dimer.If but dimer is made up of the above-mentioned somatomedin monomer of can be with receptors bind but not having a PDGF/VEGF family of the PDGF-C of other active variant monomer and another wild-type or wild-type, such dimer should with receptors bind, but can't cause the signal transmission in downstream.

Simultaneously, also exist the PDGF-C polypeptide of other modification can prevent the ability of corresponding receptors bind on the somatomedin of the PDGF-C polypeptide of wild-type and PDGF/VEGF family and the cell, these cells comprise, but be not limited only to endotheliocyte, phoirocyte (as inoblast), myofibroblast and/or neurogliocyte.Like this, the propagation that this dimer can't stimulating endothelial cell, differentiation, migration and survival rate increase, and also can't stimulate the enhancing of propagation, differentiation and the mobility of phoirocyte, myofibroblast and/or neurogliocyte.These modified polypeptides can be used as the competitiveness or the noncompetitive inhibitor of the somatomedin of PDGF-C polypeptide and PDGF/VEGF family, can be used for the occasion that needs suppress or reduce the somatomedin effect of PDGF-C polypeptide and PDGF/VEGF family.These occasions comprise the tissue remodelling's process that takes place when the tumour cell of elementary or migration-type is invaded normal cell group.These have binding ability with PDGF-C acceptor and somatomedin PDGF/VEGF family receptors, still can not induce mitotic division, do not induce differentiation, do not induce migration, do not strengthen movability, do not improve survival rate, not promote the PDGF-C growth factor variants of vascular proliferation and wound healing also to belong to category of the present invention.Here be called " can form PDGF-C somatomedin dimer but do not have other active variant or intermediate ".

Example that can form PDGF-C somatomedin dimer but not have other active variant or an intermediate is a kind of PDGF-C that has suddenlyd change, and this sudden change can prevent the cutting of proteolytic enzyme to the CUB structural domain.Can form PDGF-C somatomedin dimer but do not have other active variant or intermediate can be by having active monomer, for example VEGF, VEGF-B, VEGF-C, VEGF-D, PDGF-C, PDGF-A, PDGF-B or PlGF connect with the CUB structural domain that can tolerate proteolytic cleavage that has suddenlyd change and form.By above-mentioned can form PDGF-C somatomedin dimer but do not have other active variant or dimer that the monomer of the CUB structural domain that intermediate and being connected with has suddenlyd change constitutes can not with they corresponding receptors bind.

Above-mentioned dimeric a kind of variant is by having active monomer, for example between VEGF, VEGF-B, VEGF-C, VEGF-D, PDGF-C, PDGF-A, PDGF-B or PlGF and the CUB structural domain that suddenlyd change, inserts a protease cutting site again.This protease cutting site of inserting can be cut being connected of CUB structural domain and reactive monomer, discharge can with the active body of corresponding receptors bind.In this way, can prepare the dimer that the may command reactive monomer discharges.

The 3rd, the present invention has disclosed a kind of nucleic acid molecule of encode aforementioned polypeptides or polypeptide fragment.Nucleic acid molecule can be DNA, genomic dna, cDNA or RNA, can be strand, also can be double-stranded.The source of nucleic acid can obtain from cell or tissue in extracting, and also can recombinate obtains, perhaps direct synthetic.Because the degeneracy of genetic code, thus can express the peptide molecule shown in have Fig. 2 (SEQ ID NO:3), Fig. 4 (SEO ID NO:5), Fig. 6 (SEQ ID NO:7), they fragment, have corresponding biologic activity analogue, can be with receptors bind but do not have other active variant or can form PDGF-C somatomedin dimer but the nucleic acid molecule kind that do not have an aminoacid sequence of other active variant or intermediate should have many kinds.

The 4th, the present invention has disclosed and has had the cDNA molecule or as the carrier of the described nucleic acid molecule of the third aspect, and can suppressed by vector or nucleic acid molecule transforms or the host cell of transfection.They can derive from eucaryon, also can derive from protokaryon.Host cell should be suitable for expressing peptide molecule of the present invention, comprises insect cell such as Sf9 cell, can obtain from USS culture presevation tissue (ATCC SRL-171), can use the baculovirus vector transfection; Perhaps the human embryonic kidney cell is 293-EBNA, can be transformed by suitable expression plasmid.The carrier of first-selection of the present invention is to connect the expression vector that one or several suitable promotors or other regulating and controlling sequence form by above-mentioned nucleotide sequence, and the carrier that again this can be expressed peptide molecule of the present invention transforms or transfection host cell.The carrier of other recommendation also has those to be suitable for transfection not as zooblast, perhaps can be used for Vectors in Gene Therapy, for example adenovirus, vaccinia virus, retrovirus vector or liposome.

The present invention has disclosed a kind of preparation simultaneously can have the method that nucleic acid molecule gives expression to the carrier of polypeptide by it, and the step that comprises is: in carrier, promotor or regulating and controlling sequence that nucleic acid molecule and one or several are suitable link to each other.

The present invention has disclosed a kind of method for preparing peptide molecule of the present invention simultaneously, the step that comprises is: in host cell nucleic acid molecule or carrier are expressed, isolate expressed peptide molecule again from the substratum of host cell or culturing cell.

The 5th, the present invention has obtained a kind of antibody molecule that can carry out specific reaction with peptide molecule of the present invention or its fragment.This antibody can discern PDGF-C variant, have immunocompetent fragment, analogue and recombinant chou.Such antibody can be used as inhibitor or the agonist of PDGF-C, can detect with quantitative PDGF-C.Antibody can be polyclonal antibody, also can be monoclonal antibody.Can use such mono-clonal or polyclonal antibody to collect peptide molecule of the present invention and their variant, fragment and analogue.Can on peptide sequence, connect an epi-position mark, for example the FLAG octapeptide (Sigma, St.Louis, MO) so that carry out the affinity chromatography enrichment.In some occasion, for example need to use monoclonal antibody to suppress PDGF-C when active clinically, monoclonal antibody that should the end user source.Can further add cytotoxicity or cell in these antibody and suppress reagent.The preparation above-mentioned substance, the method that comprises recombinant DNA all is a technology common in this area.

Simultaneously, identification PDGF-C that can be special, and the antibody that self has a mark also belongs to category of the present invention.

For the ease of detecting, peptide molecule of the present invention or antibody can have detectable marker.Like this, the peptide molecule of tape label just can its corresponding acceptor of in situ detection.Peptide molecule antibody can covalency, also can be non-covalent be connected with super magnetic material, paramagnetic substance, electron density material or radioactive substance so that detect.If be used for diagnositc analysis, can use radioactive or inactive mark.Radio-labeling comprises radio isotope, for example ¹²⁵I or ³²P.The nonradioactive labeling comprises enzyme marking reagent, as horseradish peroxidase and fluorescent reagent, as FITC.Mark can be direct mark, also can be indirect labelling, can be covalent labeling, also can be non-covalent labeling.

The present invention's application clinically comprises that the blood vessel generating process of tissue that quicken to transplant or organ, the healing that stimulates wound tissue, the growth that stimulates reticular tissue, the bypass of setting up damaged tissue and artery occlusion (for example coronary heart disease) are connected, suppress the angiogenesis in tumor tissues or the diabetic retina disease and the tissue that suppresses to take place in elementary or the transport property tumour cell intrusion normal cell group process makes the transition.In addition, in tumor biopsy, the amount of PDGF-C is detected, for judging that metastases danger is very helpful.

In addition, the physiological phenomenon of PDGF-C and many lungs is relevant.The detection of PDGF-C can be used for the diagnosis of many tuberculosis.PDGF-C can be used in the middle of the treatment of many tuberculosis simultaneously, to strengthen pulmonary vascular circulation, the exchange that improves air in lungs and blood.Similar, for heart trouble defective patient, PDGF-C can also be used to strengthen the blood vessel circulation of heart and the perviousness of oxygen.Equally, stop up the disease patient for chronic tracheae, PDGF-C can also strengthen blood and gaseous interchange.

The present invention has disclosed a kind of method that can stimulate the generation of Mammals blood vessel, lymphatic vessel generation, neural network generation, reticular tissue growth and wound healing, and the step that comprises is: Mammals is applied PDGF-C, its fragment of effective dose or the analogue with PDGF-C biologic activity.PDGF-C, its fragment or analogue and following one or several VEGF, VEGF-B, VEGF-C, VEGF-D, PlGF, PDGF-A, PDGF-B, FGF and/or heparin can be imposed on experimental animal simultaneously.

The PDGF-C agonist (for example antibody or can be competitive or noncompetitively form dimer and and the inhibitor of receptors bind in conjunction with PDGF-C) can be in order to handle for example situation of the congested obstacle of heart, by at other organ, for example increase the perviousness of blood vessel in the lung, causing the accumulation of liquid, thereby offset the problem of the vascular permeability in the heart.PDGF-C can also handle the fibrotic situation that can find simultaneously in lung, kidney and liver.In enteron aisle, apply PDGF-C, can treat indigestion, but the blood circulation and the vascular permeability of liver, kidney have all strengthened simultaneously.

The present invention has also disclosed a kind of method that can suppress the generation of Mammals blood vessel, lymphatic vessel generation, neural network generation, reticular tissue growth and wound healing, and the step that comprises is: the PDGF-C agonist that Mammals is applied effective dose.Agonist can be anyly can suppress the active material of PDGF-C, and mechanism can be to suppress corresponding receptors bind on PDGF-C and the cell, also can be the activation that suppresses acceptor, for example by use " can be with receptors bind but do not have other active variant ".Agonist comprises, but be not limited only to, the antibody of anti-PDGF-C, can be emulative or noncompetitive the inhibitor of inhibition PDGF-C and receptors bind thereof, for example above-mentioned " can form PDGF-C somatomedin dimer but do not have other active variant or intermediate ", can and modify PDGF-C so that its deactivated mixture in conjunction with PDGF-C, also have the antisense nucleic acid molecule of above-mentioned polynucleotide sequence.

The present invention also provides a kind of and has determined and the active fragments bonded compositions and methods of PDGF-C that step is: active fragments and the detection reagent of PDGF-C are mixed, use appropriate means monitoring bonded degree.Reagent can comprise mixture and other protein.

The invention allows for a searching can with the active fragments bonded screening system of PDGF-C.The first active fragments of preparation PDGF-C with itself and reagent mix to be detected, re-uses the combination degree of the active fragments of appropriate means quantitative assay reagent to be detected and PDGF-C.This screening system also can be used for definite material that can suppress the proteolytic cleavage of total length PDGF-C, can prevent to discharge the active fragments with active PDGF-C like this.Certainly, must be ready to the PDGF-C of total length earlier.

Use this cover screening system can seek the compound that those may change the PDGF-C biologic activity.This screening method can be transformed into extensive, the automated installation that is similar to PANDEX (Baxter-DadeDiagnostics) system, to adapt to possible medicine is carried out effective high-throughout screening.

In this screening system, the active fragments of PDGF-C or the PDGF-C of total length want prepared beforehand, preferably adopt recombinant DNA technology.Detection reagent, for example mixture and protein are introduced into the reaction vessel of the PDGF-C of the active fragments that includes PDGF-C or total length.The combination of the active fragments of detection reagent and PDGF-C or the PDGF-C of total length can use appropriate means to determine, these methods comprise, but is not limited only to, and uses radio isotope or chemical labeling to carry out mark detection reagent.The method of the combination degree of the active fragments of other detection reagent and PDGF-C or the PDGF-C of total length also can be referring to U.S. Patent Publication 5,585,277, it be by monitor folded and folding proteinic ratio determine the combination degree of the PDGF-C of the active fragments of detection reagent and PDGF-C or total length.The example of such detection protein folding comprises, but be not limited only to, the PDGF-C of the monitoring active fragments of PDGF-C or total length is to the tolerance degree of special proteolytic enzyme, perhaps detects the combination degree of protein and antibody that can specific combination protein folding attitude.

Worker in this area should understand IC ₅₀The size of value is relevant with selected detection reagent.For example, IC ₅₀Value is highly suitable for the pharmacological agent situation less than the detection reagent of 10nM.But specificity is higher and reagent that bonding strength is lower more is used in this situation in fact.Worker in this area should be realized that the information of binding ability, inhibition activity and specific selectivity about reagent is very useful for the corresponding medicine of research.

When using PDGF-C or PDGF-C agonist in treatment, the dosage of use and mode will be decided in its sole discretion according to judgement by doctor and animal doctor by individuality that is applied in and concrete pending situation decision.That the mode of administration comprises is oral, subcutaneous injection, intramuscular injection, abdominal injection, intravenous injection, implantation, local use and without use-pattern of Digestive tract or the like.The method of the local PDGF-C of use is similar with the method for using VEGF.For example when promoting wound healing, perhaps other need strengthen the occasion of angiogenic effect, PDGF-C can be applied directly on the tissue or organ that needs, effectively dosage according to the ratio of dosage/body weight between 0.1 to 1000 μ g/Kg.

PDGF-C or PDGF-C agonist can use in conjunction with suitable pharmaceutical carrier.Last consists of, and has the PDGF-C or the PDGF-C agonist of the appropriate amount of drug effect, biocompatible nontoxic salt and biocompatible solid or liquid support or adjuvant.The such carrier or the example of adjuvant comprise, but be not limited only to the combination of alkali salt, buffering alkali salt, Ringer solution, mineral oil, talcum, starch, gelatin, lactose, sucrose, Microcrystalline Cellulose, kaolin, mannitol, Lin Suanergai, sodium-chlor, glucose, water, glycerine, ethanol, thickening material, stablizer, suspension agent or above-mentioned substance.They can make solution, suspension liquid, tablet, capsule, ointment, elixir, syrup, wafer, ointment or other form.The form of medicine should determine according to the mode of administration.Here, the composition that contains PDGF-C also can change one or several following material: PDGF-A, PDGF-B, VEGF, VEGF-B, VEGF-C, VEGF-D, PlGF and/or heparin into.The weight ratio of the active substance PDGF-C that contains in the medicine is between 0.1% to 90%, generally between 10% to 30%.

For the intramuscular preparation, should be aseptic form, the active fragments of PDGF-C with soluble salt for example the form of hydrochloride exist, be dissolved in the pharmaceutical diluents, for example do not contain the distilled water, physiological saline of pyrogen or 5% glucose solution.Can be prepared into the outstanding turbid aqueous solution for insoluble compound, perhaps make in its oily alkali that is suspended in biocompatibility, for example contain in the ester of longer chain fatty acid, for example the ethyl oleic acid ester.

Invention thought of the present invention can also be as making diagnosis/disease forecasting equipment, for example with the form of detection kit.In the example of a concrete test kit of the present invention, test kit comprises the antibody of anti-PDGF-C, and a kind of detection, more precisely, measures the method for estimating bonding state between PDGF-C and the antibody thereof.In another specific examples, it is one anti-that above-mentioned anti-PDGF-C antibody is called, on it except can with PDGF-C bonded site, also have the antigen of certain animal, test kit a kind of two anti-antibody molecules of also having carried structure resist the animal antigen that has in addition.Two have detectable marker on anti-, a PDGF-C or a unlabelled resistive connection are combined in the surface of substrate, a PDGF-C and an anti-interaction degree can be according to the quantity decisions of corresponding marker in the substrate like this, and this marker is to introduce by two resistive connections anti-and that combine PDGF-C are closed.In a specific examples, diagnosis of the present invention/disease forecasting equipment provides with the form of Enzyme Linked Immunoadsorbent Assay (ELISA) test kit.

In another specific examples of the present invention, this diagnosis/disease forecasting equipment also can comprise the method for polymerase chain reaction, to amplify individuality to be detected, and the sequential structure that its sequential structure and the present invention are announced compares, have no abnormally with detection, judge whether PDGF-C expresses unusual relevant with the specified phase of some disease.

In addition, in the specific examples of the present invention, can also use restricted length polymorphism (RFLP) analytical procedure, use the genomic dna of restriction enzyme cutting testing sample, electrophoresis produces specific DNA band.The sequence band that these bands and this are announced in clearly demarcated compares again, has no abnormally with detection, judges whether PDGF-C expresses unusual relevant with the specified phase of some disease.

The present invention includes a kind of PDGF-C gene that can detect detected sample that may be relevant whether unusual method takes place with disease stage.The step of this method is: obtain DNA or RNA sample from sample, add special primer, method by PCR, optionally amplify the relevant gene of PDGF-C, the sequence among the nucleotide sequence that will amplify from sample and Fig. 1 (SEQ ID NO:2) or Fig. 3 (SEQ ID NO:5) compares.Those include can be special in conjunction with the primer of the PDGF-C gene of sample and the test kit of the polysaccharase that comes out of the PDGF-C gene can being increased from the DNA sample also belong to category of the present invention.

The present invention has provided a kind of method that detects PDGF-C in biological sample.Concrete steps are: can react with PDGF-C bonded reagent and sample mix, and detect combination degree again.Wherein can be in conjunction with the part of the PDGF-C preferably antibody of anti-PDGF-C, preferably monoclonal anti PDGF-C antibody.In a specific examples, combination degree is realized detecting by detectable marker, and the marker that is suitable for is above discussed.

The present invention relates to the albumen dimer that PDGF-C constitutes, particularly the albumen dimer that connects by disulfide linkage.The homodimer that dimer can be made up of two PDGF-C polypeptide also can be by a PDGF-C polypeptide and the heterodimer that VEGF, VEGF-B, VEGF-C, VEGF-D, PlGF, PDGF-A or PDGF-B form.

The present invention gives the method for separating PDGF-C, and the step that comprises is: the cell of PDGF-B expression-C is handled with heparin, so that cell discharges PDGF-C, again the PDGF-C that discharges is carried out purifying.

The present invention gives a kind of carrier that comprises anti sense nucleotide sequence.Anti sense nucleotide sequence wherein is at least with coding PDGF-C, PDGF-C fragment or to have the dna sequence dna part of analogue of PDGF-C biologic activity complementary.Perhaps, anti sense nucleotide sequence also can with the promoter region effect of PDGF-C gene, perhaps other non-coding region with gene interacts, thereby reaches inhibition, is the expression degree that reduces PDGF-C at least.

According to mentioned above, the carrier that comprises anti sense nucleotide sequence like this can be the expression degree that reduces PDGF-C in order to suppress at least.In the occasion of those PDGF-C expression and disease-related, it is quite effective using this carrier that can suppress the PDGF-C expression, these occasions for example, tumour produces PDGF-C to promote vasculogenesis, when the tumour cell that perhaps tissue reconstruction, this process occur in primary or migration is invaded normal populations.Transform this tumour cell with the carrier that carries anti sense nucleotide sequence and will suppress or hinder growth of tumor or tissue reconstruction.

What invent may be that the potential somatomedin is relevant with discovery total length PDGF-C albumen on the other hand.This somatomedin need have active PDGF/VEGF homeodomain by proteolysis release and be activated.Known protein hydrolysis site is positioned at the residue 231-234 of full-length proteins, i.e. residue-RKSR-.This is the binary motif.This site structure in mouse PDGF-C is conservative.In PDGF-A, PDGF-B, PDGF-C and PDGF-D, also find known-RKSR-proteolysis site.In these four kinds of albumen, in the place ahead sequence in the minimal structure territory of PDGF/VEGF homeodomain, also found known protein hydrolysis site.All these facts all show-RKSR-is proteoclastic site.

Preferred proteolytic enzyme comprises, but is not limited only to Tryptase, factor X and enteropeptidase.N-end CUB structural domain may work as suppressing structural domain, and this structural domain may be used for keeping PDGF-C to have some cell mistress with the potential form, and this structural domain can be removed by specific proteolysis when needing PDGF-C.

This invention provides a kind of specific method that produces the PDGF-C of activatory clipped form or regulate the receptors bind of PDGF-C.These methods comprise expressing and contain codified and have the expression vector of polynucleotide of polypeptide of PDGF-C biologic activity and the hydrolysis of supporting at least a enzyme to be used to handle the truncate that polypeptide expressed produces activated PDGF-C.

The present invention also provides a kind of selectively activate to have the method for the polypeptide of growth factor activity simultaneously.This method comprises expresses the expression vector of polynucleotide that codified has the polypeptide of growth factor activity and CUB structural domain, in this polypeptide, CUB structural domain and have and contain a proteolysis site between the active polypeptide fragment, this method supports the hydrolysis of at least a enzyme to produce the polypeptide that activated has growth factor activity to be used to handling polypeptide expressed.

In addition, this clearly also comprises and separates nucleic acid molecule that coding has the polypeptide of PDGF-C biologic activity, and separates the inner method that contains the nucleic acid molecule of proteolysis site that aminoacid sequence is RKSR or the inner polypeptide that contains the aminoacid sequence that structure guards of coding.

This aspect also comprises a kind of isolating dimer, this dimer is made of the monomer that monomer with active PDGF-C and activated are connected with VEGF, VEGF-B, VEGF-C, VEGF-D, PDGF-C, PDGF-A, PDGF-B and the PlGF of CUB structural domain, perhaps conversely, constitute by the monomer of activated VEGF, VEGF-B, VEGF-C, VEGF-D, PDGF-C, PDGF-A, PDGF-B and PlGF and monomer with active PDGF-C that is connected with the CUB structural domain.This kind dimer may comprise also may not comprise the proteolysis site that is positioned at activated monomer and CUB structural domain junction.

Aforesaid polynucleotide, the fragment of these polynucleotide, and with the variant that can have the polynucleotide of abundant similarity under stringent condition, the polynucleotide of the mammiferous PDGF-C in the inhuman source that they all can be used for discerning, purifying, separation are encoded other with the noncoding polynucleotide chain that such polynucleotide or polynucleotide passage are hybridized.Therefore these polynucleotide passages and variant are used for inventive aspect.The example of rigorous hybridization conditions is as follows: 42 ℃ of hybridization temperatures, 5X SSC, 20 mM Na ₃PO ₄, pH6.8,50% methane amide; 42 ℃ of cleaning conditions, 0.2X SSC.Those skilled in the art should understand to be needed to change concrete condition according to the length of the nucleotide sequence that will hybridize and the content of GC base pair.Specific examples is seen " molecular cloning: laboratory manual ", second edition, page or leaf 9.47-9.51, cold spring port, New York: cold spring harbor laboratory (1989).

In addition, purifying and isolating codified other, polynucleotide inhuman source, mammiferous PDGF-C also belong to category of the present invention, as purifying with separate encoded polypeptides thus and can carry out the antibody of specific immune response with inhuman source PDGF-C variant.Therefore, this invention comprises purifying and separates mammals PDGF-C polypeptide, also comprises purifying and the polynucleotide that separate coded polypeptide.

Obviously, nucleic acid in this invention and polypeptide can obtain by method synthetic or reorganization, also can extract from crude substance, purifying.

Here, when lifting concrete example, the meaning of " comprising " is " comprise, but be not limited only to ".

The accompanying drawing summary

The complete nucleotide sequence of Fig. 1 (SEQ ID NO:2) code displaying people PDGF-C (hPDGF-C) cDNA (2108bp);

Fig. 2 (SEQ ID NO:3) shows the one-dimensional sequence (translator unit of cDNA is corresponding to the Nucleotide among Fig. 1 37 to 1071) of the total length hPDGF-C that contains 345 amino-acid residues that infers;

Fig. 3 (SEQ ID NO:4) code displaying people PDGF-C (bPDGF-C) cDNA fragment sequence (1536bp);

Fig. 4 (SEQ ID NO:5) shows the segmental aminoacid sequence (being the translation of the 3rd to the 956th nucleotide sequence among Fig. 3) of hPDGF-C;

Fig. 5 (SEQ ID NO:6) shows the nucleotide sequence of the cDNA of mouse PDGF-C (mPDGF-C);

Fig. 6 (SEQ ID NO:7) shows the segmental aminoacid sequence (being formed by the 196th among Fig. 5 cDNA translation to 1233 Nucleotide) of mouse PDGF-C;

Fig. 7 shows the comparison of the aminoacid sequence of the aminoacid sequence of the people PDGF-C among Fig. 2 and mouse PDGF-C;

Fig. 8 shows the graphic texture of mouse PDGF-C, by signal peptide (showing) with the oblique line frame table, and N end Clr/Cls/ embryo's sea urchin albumen Uegf/ Delicious peptide 1 (CUB) structural domain and C end PDGF/VEGF-homeodomain (representing) with blank box;

Fig. 9 show people and mouse PDGF-C the PDGF/VEGF homeodomain sequence relatively, and and other members of the VEGF/PDGF family of somatomedin compare (SEQ IDNO:8-17);

Figure 10 shows the evolutionary tree of the somatomedin of several VEGF/PDGF of belonging to family;

Figure 11 provides the comparison (SEQ ID NO:18 and 19) of aminoacid sequence of CUB structural domain of the PDGF-Cs that is present in people and mouse and the aminoacid sequence of other the CUB structural domain that is present in people's osteogenesis albumen-1 (hBMP-1,3 CUB domain C UB1-3) (SEQ ID NO:20-22) and people NP-1 (2 CUB structural domains) (SEQ ID NO:23 and 24);

Figure 12 shows the analysis of the Northern hybridization of the transcript that PDGF-C expresses in several people's tissues;

Figure 13 shows the changes of expression level by the mRNA of the PDGF-C of hypoxia inducible;

Figure 14 shows the expression of the PDGF-C in the human tumor cell line;

Figure 15 is presented at the result who detects the people source PDGF-C of total length in the COS-1 cell of transfection by immunoblot assay;

Figure 16 shows sepn process and the Partial Feature of total length PDGF-C;

Figure 17 shows the separation and the Partial Feature of the truncate of the people source PDGF-C that only contains the PDGF/VEGF homeodomain;

Figure 18 is attached to the typical curve that obtains on the PAE-1 cell of PDGF-B expression alpha-receptor for the PDGF-BB homodimer of mark;

Figure 19 provides the figure on the PAE-1 cell of representing the PDGF-BB that suppresses mark to be attached to the PDGF-B expression alpha-receptor, and this inhibition can be by the total length of a large amount of purifying of increase and the PDGF-CC albumen of brachymemma;

Figure 20 shows the influence of the PDGF-CC homodimer of total length and brachymemma to the phosphorylation of PDGF-alpha-receptor;

Figure 21 shows that the PDGF-CC homodimer of total length and brachymemma is to fibroblastic mitogenesis activity;

Figure 22 shows that the PDGF-CC of brachymemma is attached to the qualification result on the pdgf receptor;

Figure 23 shows the immuning hybridization of the protein fragments of the 26-28kDa that indigested total length PDGF-C albumen and Tryptase take place;

Figure 24 represents that the competitiveness of the PDGF-C of total length PDGF-C and brachymemma is attached to the qualification result of PDGER-α acceptor;

Figure 25 is presented at the result who by SDS-PAGE people PDGF-C CUB structural domain is analyzed under reduction and the non-reduced condition;

Figure 26 A-26V shows the expression situation of the PDGF-C in the mice embryonic of growing;

Figure 27 A-27F show growing kidney in PDGF-C, the expression situation of PDGF-A and PDGFR-α;

Figure 28 A-28F shows from wild-type (Figure 28 A and 28c), PDGFR-α-/-(Figure 28 B and 28F), PDGF-A-/-(Figure 28 D) and PDGF-A/PDGF-B double-/-(Figure 28 E) kidney and the histology of E 16.5 kidneys.

The specific descriptions of preferred embodiment

Fig. 1 (SEQ ID NO:2) shows the nucleotide sequence of complete coding people PDGF-C (hPDGF-C) cDNA (2108bp), and this hPDGF-C is the newcomer of VEGF/PDGF family.Clone #4 (seeing Fig. 3 and Fig. 4-SEQ ID NO:4 and 5) and the mouse albumen (corresponding 27 amino acid) of hPDGF-C of relatively encoding learns that clone #4 is not a full length sequence, has lacked the encoding sequence of about 80 base pairs.Isolated other cDNA clone comprises the insertion fragment of above-mentioned deletion sequence from human fetal lung cDNA library.Clone #10 has longer insertion than clone #4.The insertion of clone #10 is since 5 ' zone, and contains the sequence of disappearance.Clone 10# comprises the complete sequence of people PDGF-C.List some 5 '-untranslated sequences among Fig. 1 (SEQID NO:2), sequence and some 3 '-untranslated nucleotide sequences of the cDNA of some translated coding people PDGF-C.Terminator codon is arranged in 21bp place, initial ATG upstream (line of the initial ATG of Fig. 1 lower end).

By search to est database and the dbEST of NCBI, search out a people's est sequence (W21436), among this sequence encoding mouse PDGF-C with people's homologous part.Thus, can begin to separate the work of undiscovered people PDGF/VEGF.According to people's est sequence of gained, two oligonucleotide chain designs are as follows:

5 '-GAA GTT GAG GAA CCC AGT G-3 ' 5 ' holds primer (SEQID NO:25)

5 '-CTT GCC AAG AAG TTG CCA AG-3 ' 3 ' holds primer (SEQID NO:26)

Use above-mentioned Oligonucleolide primers to be the polynucleotide of 348bp by the length that round pcr amplifies in human fetal lung 5 '-STRETCH PLUS λ gt10 cDNA library.Again with PCR product cloning (Invitrogen) to the PCR 2.1-carrier of TA clone test kit.Subsequently, according to standard techniques, length is that the PCR product cloning of 348bp can be used for making up the hPDGF-C probe.

In human fetal lung 5 '-STRETCH PLUS gt10 cDNA library (Clontech) 10 ⁶Planting λ-clone can screen with the hPDGF-C probe according to the method for standard.In several positive colonies, selective analysis clone #4 according to the method for standard, uses inner and carrier oligonucleotide to determine the nucleotide sequence of insertion it on.The insertion fragment of clone #4 contains the partial nucleotide sequence of cDNA of the people PDGF-C (hPDGF-C) of the total length of encoding.Fig. 3 (SEQ ID NO:4) has shown the nucleotide sequence (1536bp) that clone #4 inserts.The part of this cDNA translation comprises the 6th to the 956th in Nucleotide.Fig. 4 (SEQ ID NO:5) has shown the aminoacid sequence of inferring the translator unit that may be insertion sequence.The polypeptide that this aminoacid sequence constitutes lacks initial 28 amino-acid residues of total length hPDGF-C polypeptide, but this polypeptide comprises the proteolytic fragments that can fully activate PDGF α acceptor.Should be noted that SEQ ID NO is that first glycine (Gly) of 5 is not found in total length hPDGF-C.

In the search of passing through the dbEST database of NCBI, find a mouse est sequence (AI020581), new mouse PDGF of this sequence encoding part, the part of PDGF-C.Most mouse cDNA derives from DNA in the mice embryonic λ gt10cDNA library by use to carry out pcr amplification as template and obtain.3 ' end for the cDNA that increases, (sequence of this primer is 5 '-CTT CAG TAC CTT GGA AGA G to need to use the sense strand primer that obtains according to the mouse est sequence, primer 1 (SEQ ID NO:27)), 5 ' end for the cDNA that increases, need to use the meaningless strand primer (sequence of this primer is 5 '-CGC TTGACC AGG AGA CAA C, primer 2 (SEQ ID NO:28)) that obtains according to the mouse est sequence.λ gt10 carrier primer is sense strand primer 5 '-ACG TGA ATT CGA CAA GTT CAG CCTGGT TAA (primer 3 (SEQ ID NO:29)) and meaningless strand primer 5 '-ACG TGGATC CTG AGT ATT TCT TCC AGG GTA (primer 4 (SEQ ID NO:30)).The carrier primer reacts with the PCR that the inside primer that is derived from mouse EST is used to standard.The segmental size that is gone out by pcr amplification approximately is respectively 750bp (3 ' fragment) and 800bp (5 ' fragment).These fragment clonings are gone into the PCR2.1 carrier and are used the carrier primer and inner primer carries out nucleic acid sequence analysis.These fragments do not contain the full length sequence of mPDF-C, and mouse liver ZAP cDNA screens with the method for standard in the library.The PCR fragment of the 261bp of one section 32P mark of structure is utilized primer 1 and primer 2 and uses to come from the DNA in mouse embryo λ gt10 library as template (on seeing) as probe.With male plaque purifying, obtain the nucleotide sequence of insertion again by subclone.Carrier specificity primer and inner primer are used.The PCR that produces clones and isolated clone's nucleotide sequence information by analyzing, and can infer the aminoacid sequence (see figure 6) (SEQ ID NO:7) of the total length of mPDGF-C.

Fig. 7 has shown the comparable situation (SEQIDNO: be respectively 6 and 2) of aminoacid sequence of mouse and people's PDGF-C.The PDGF-Cs of this comparison sheet person of good sense and mouse has about 87% homogeny, has 45 amino acid to be replaced in 345 amino-acid residues of albumen total length.Nearly all observed amino acid whose replacement is guarded in essence.The site of signal peptidase hydrolysis is between residue G19 and T20 among the mPDGF-C of prediction.But this point can produce the polypeptide that the excretory of muroid is made of 326 residues.

Fig. 8 provides the structure of the diagrammatic structural domain of the mouse PDGF-C that has signal sequence (showing with the oblique line frame table), N-end CUB structural domain and C-end PDGF/VEGF homeodomain (representing with blank box).Aminoacid sequence that line shows and CUB structural domain or do not have tangible similarity with the VEGF-homeodomain.

The sequence homogeny of height shows that the PDGF-C of people and mouse has structural domain structure much at one.The PDGF-C that relatively shows mouse and people of aminoacid sequence all has a new structural domain structure.Except the PDGF/VEGF-homeodomain of the C-end regions that is positioned at two kinds of protein (residue 164 to 345), all there is a structural domain to be attributable to CUB structural domain (Bork and Beckmann at the N-of two kinds of PDGF-Cs end regions, J.Mol.Biol., 1993231,539-545).This about 110 amino acid whose structural domain is identified from complement factor Clr/Cls at first, but in other several extracellular proteins, find again recently, comprise signaling molecule, osteogenesis albumen 1 (BMP-1) (Wozney et al. for example, Science, 1,988 242,1528-1534), acceptor molecule, NP-1 (Soker et al., Cell, 1,998 92 735-745) for example.Although the function of CUB structural domain is unclear, the carbohydrate that it might participate in protein-protein interaction or participation and proteoglycan heparin sulfate and so on interacts.

Fig. 9 show people and mouse PDGF-Cs C-end PDGF/VEGF-homeodomain aminoacid sequence comparison and with PDGF/VEGF family member such as VEGF ₁₆₅, PLGF-2, VEGF-B ₁₆₇, Pox Orf VEGF, VEGF-C, VEGF-D, PDGF-A and PDGF-B the comparison (SEQ ID NO:8-17) of aminoacid sequence of C-end PDGF/VEGF-homeodomain.Some aminoacid sequences of the N-of VEGF-C and VEGF-D end and C-end regions have been omitted in this figure.The gap is introduced into to optimize relatively.This relatively uses method (Methods Enzymol., 1,990 183 626-45) and the PAM250 residue weight table of J.Hein to obtain.What show with the residue of box indicating is the amino acid that is complementary with the PDGF-Cs that is positioned at inside, two remote unit.

This shows that relatively PDGF-C has the structure that is made of cysteine residues in the expectation, except an exception.Between halfcystine 3 and 4, separate by 2 residues usually, the insertion of three amino acid (NCA) is arranged.The characteristics of this sequence are unexpected among the PDGF-C.

According to the aminoacid sequence among Fig. 9 relatively, can construct the evolutionary tree that Figure 10 shows.Data show that the PDGF/VEGF-homeodomain of PDGF-C homeodomain and VEGF-C and VEGF-D is closely related.

As shown in Figure 11, the proteinic aminoacid sequence that derives from several CUB of containing is compared.The result shows that the simple CUB structural domain of people and mouse PDGF-C has significant homogeny, and comparing with most of close CUB structural domains also has same result.Derive from people BMP-1, having the sequence of 3 CUB structural domains (SEQ ID NO:20-22) and having in the sequence chart of people NP-1 of 2 CUB structural domains (CUB1-2) (SEQ ID NO: be respectively 23 and 24) also has demonstration.The gap is introduced into to optimize relatively.This is relatively used the method (Methods Enzymol., 1,990 183 626-45) of J.Hein and PAM250 residue weight table and obtains.

Figure 12 has shown the analytical results that the Northen of the expression product of the PDGF-C transcript in several people's tissue is hybridized.This analysis revealed PDGF-C is by the transcript coding gained of a main transcript that is approximately 3.8-3.9kb and an accessory 2.8kb.The number on the right refers to the mRNA size of (representing with kb).The tissue expression of PDGF-C is by business-like MTN technology for detection (Clontech).This hybridization detects and can carry out according to supplier's guidance, uses the ExpressHyb solution incubation one hour at 68 ℃ (height stringent condition), detects with the hPDGF-C EST probe of the 353bp that derives from the fetus lung cDNA library that filters out as mentioned above.This hybridization was cleaned 30 minutes at 50 ℃ of 2X SSC that contain 0.05%SDS subsequently, and then cleaned 40 minutes in containing 50 ℃ of 0.1X SSC solution of 0.1% SDS.Then this hybridization is forwarded on the film ,-70 ℃ of exposures.Results of hybridization shows the PDGF-C transcript at heart, liver, and kidney, the abundantest in pancreas and the ovary, and in other tissue, such as placenta, skeletal muscle, prostate gland, its contents level is very low.And at spleen, colon, PDGF-C content is lower than detectable level in the peripheral blood leukocyte.

Figure 13 shows the adjusting situation of the expression of the PDGF-C mRNA that is caused by hypoxemia.Marker (representing with kb) is positioned at the left side of following face version.The PDGF-C mRNAs size of estimating is shown in the left side (be respectively 2.7 and 3.5kbs) of top panel.Whether be subjected to hypoxia inducible in order to investigate PDGF-C, the human skin fibroblast of cultivating is exposed to is respectively 0,4,8,24 hours under the hypoxia condition.Use oligomerization-dT Mierocrystalline cellulose affinitive layer purification method that Poly (A)+mRNA is separated from cell.Isolated mRNA is electrophoresis in 12% agarose, and sample 4 μ g mRNA on the per pass carry out Northern hybridization then, promptly with the probe hybridization of PDGF-C.The size of this two band determines (Enholmet al.Oncogene on the one hand by the mixture of same filter membrane and hVEGF, hVEGF-B and hVEGF-C probe is hybridized, 1,997 14 2475-2483), determine according to the interpolation of the size of known mRNA on the other hand.Result displayed shows that PDGF-C is not subjected to the adjusting of hypoxemia in human skin fibroblast among Figure 13.

Figure 14 shows the expression of the PDGF-C mRNA in the human tumor cell line.Whether PDGF-C expresses in human tumor cell line in order to investigate, and isolates Poly (A)+mRNA from several known tumor cell lines, carries out 12% agarose electrophoresis then, again by analyzing with the Northem hybridizing method of PDGF-C probe hybridization.The result displayed of Figure 14 shows that PDGF-C mRNA expresses in the human tumor cell line of several types, such as JEG3 (human choriocarcinoma, ATCC #HTB-36), G401 (WilmsShi tumour, ATCC#CRL-1441), DAMI (megakaryoblast leukemia), A549 (people's lung cancer, ATCC #CCL-185) and HEL (human erythroleukemia, ATCC #TID-180).Should be noted that can be by suppressing the further growth that PDGF-C suppresses the tumour of these PDGF-C expression.The expression that equally, also can detect PDGF-C is as a kind of method of identifying special tumor type.

Embodiment 1: at the generation of the anti-peptide antibody of specificity of people PDGF-C

Article two, synthetic peptide section is used to produce the antibody at people PDGF-C.Article one, synthetic peptide is corresponding to the 29-48 residue of the N-end of total length PDGF-C, comprising the extra cysteine residues of N-end and C-end: CKFQFSSNKEQNGVQDPQHERC (SEQID NO:31).The synthetic peptide of second is corresponding to the residue 230-250 of total length PDGF-C interior region, comprising the extra cysteine residues that is positioned at the C-end: GRKSRVVDLNLLTEEVRLYSC (SEQ ID NO:32).These two synthetic peptides that instruct according to supplier are promptly fastened the hole and are tangled hemocyanin (KLH by using N-succinimido-1-3-(2-pyridyl dithio) propionic ester (SPDP) (Pharmacia Inc.) to be connected one to the other to carrier proteins, Calbiochem) on, the 200-300 milligram connects product emulsification and carry out subcutaneous injection at the multidigit point of rabbit in Freund's complete adjuvant respectively in phosphate-buffered salt (PBS).Every two weeks rabbit is connected product with the same emulsive of measuring in Freund's complete adjuvant and carry out subcutaneous injection.Extract out and collect rabbit blood and prepare serum with known standard method.

Embodiment 2: the expression of the people PDGF-C of total length in the mammalian cell

The mammalian expression vector that the full length cDNA clone of coding people PDGF-C is gone into to have the SV40 promotor, promptly pSG5 (Stratagene, La Jolla, CA).Use the DEAE-dextran COS-1 cell harvesting of carrier transfection thus, make negative control with the pSG5 carrier that does not insert cDNA.In the COS-1 of transfection cell, add serum free medium in transfection after 24 hours, collect after 24 hours at the adding substratum and contain the proteinic liquid of excretory.These liquid are easy to produce coagulation act on 30 minutes in the trichoroacetic acid(TCA) of ice bath after, precipitate with washing with acetone again.The albumen of this coagulation is dissolved in the SDS sample-loading buffer and according to standard method under reductive condition and with SDS-PAGE glue albumen is separated.Protein electrotransfer separately uses the rabbit anti-serum at total length PDGF-C to carry out immuning hybridization to the Hybond filter membrane again, and the preparation of rabbit anti-serum as mentioned above.Bonded antibody can use enhanced chemiluminescence (ECL, Amersham Inc.) method to detect.Figure 15 shows the result of this immuning hybridization.Sample is partial reduction, and the monomer of people PDGF-C is that size is 55kDa (following band), and the dimer size is 100kDa (a top band).This result shows that protein is not to have main proteolysis process in complete form secretion and the excretory process in mammalian cell.

The total length of embodiment 3 in the Sf9 of baculovirus infection cell and the expression of the people PDGF-C of brachymemma

The total length encoding part of the cDNA of people PDGF-C (970bp) can use Deep Vent archaeal dna polymerase (Biolabs) to increase by PCR method according to the condition and the program of standard.Total length PDGF-C 30 circulations of increasing, each circulation comprises 94 ℃ of sex change 1 minute, 56 ℃ of annealing 1 minute, 72 ℃ were extended 2 minutes.5 ' end primer is 5 ' CGGGATCCCGAATCCAACCTGAGTAG3 ' (SEQ ID NO:33), and this primer comprises that a BamHI site (representing with underscore) is used to clone.3 ' end primer is 5 ' GGAATTCCTAATGGTGATGGTGATGATGTTTGTCATCGTCATCTCCTCCTGTGCTC CCTCT3 ' (SEQ ID NO:34).This primer comprises an EcoRI site (representing with underscore) and the sequence of holding 6XHis tag by the C-that the enteropeptidase site produces.In addition, the residue 230-345 of the PDGF/VEGF homeodomain (PVHD) of people PDGF-C can use Deep VentDNA polysaccharase (Biolabs) to increase by PCR method according to the condition and the method for standard.25 circulations of residue 230-345 amplification of the PVHD of PDGF-C, each circulation comprises 94 ℃ of sex change 1 minute, anneals 4 minutes for 56 ℃, 72 ℃ were extended 4 minutes.5 ' end primer is that this primer of 5 ' CGGATCCCG.GAAGAAAATCCAGAGTGGTG3 ' (SEQ ID NO:35) comprises that a BamHI site (underscore) is used for the clone.3 ' end primer is 5 ' GGAATTCCTAATGGTGATGGTGATGATGTTTGTCATCGTCATCTCCTCCTGTGCTC CCTCT-3 ' (SEQ ID NO:36), and this primer comprises the sequence that C-that an EcoRI site (underscore) and coding are produced by the enteropeptidase site holds 6X His tag.The PCR product digests with BamHI and EcoRI, and being cloned into rhabdovirus expression vector then is pAcGP67A.The correct sequence clone of confirmation PCR product is gone into carrier and can be verified by nucleic acid sequencing.According to handbook (Pharminogen) the expression vector cotransfection of linearizing baculovirus DNA is gone into Sf9 insect cell Sf9 then.Earlier recombinant baculovirus was increased for several times before beginning large-scale protein production and purifying according to handbook (Pharminogen).

With Sf9 cell (the multiplicity of infection :～7) of recombinate shape virus infection with the serum free medium cultivation.After infecting 4 days, collect the substratum that contains recombinant protein, with itself and Ni-NTA-sepharose 4B body (Qiagen) incubation.The pearl body is collected in the post, used high-intensity elution requirement: the 50mM sodium phosphate buffer, pH8 contains 300mM NaCl (elution buffer), and bonded protein can elute by the concentration (from 100mM to 500mM) that increases imidazoles in the elution buffer.The protein of wash-out SDS-PAGE by 12.5% poly-propionic acid amide glue under reduction and non-reducing condition analyzes.When carrying out the analysis of immuning hybridization, the protein electrotransfer is to the Hybond filter membrane, 45 minutes transfer time.

Figure 16 A-C shows total length people's proteic sepn process of PDGF-C and Partial Feature thereof.In Figure 16 A, hybridize (as above-mentioned) by using at the anti-peptide antibody of N-end peptide, can see the full length protein of reorganization.In Figure 16 B, hybridize (as above-mentioned) by using at the anti-peptide antibody of internal peptide, can show the band of the full length protein of reorganization.Can see the protein belt that separation obtains by the method for using coomassie brilliant blue staining.Can see the protein (Figure 16 C) that separation obtains by the method for using coomassie brilliant blue staining.The numeral of Figure 16 A-C bottom refers to the concentration that is used for imidazoles that protein is eluted from the Ni-NTA post, represents with mole.Figure 16 A-C shows whole length protein size migration with 99kDa under non-reduced condition, and the size with 55kDa under reductive condition is moved.This point shows that whole length protein is the dimer of disulfide bond crosslinking.

Figure 17 A-C shows the sepn process of clipped form of the people PDGF-C only contain the PDGF/VEGF homeodomain and the analysis of Partial Feature.In Figure 17 A, the analysis revealed protein of the segmental immuning hybridization that elutes from the Ni-agarose column can elute (scope 100-500mM) according to the change in concentration of imidazoles.Fragment under the wash-out is analyzed under non-reduced condition, hybridizes (as above-mentioned) by using at the anti-peptide antibody of internal peptide, can see the people PDGF-C after the brachymemma.The identical segments of coomassie brilliant blue staining among Figure 17 B demonstration and Figure 17 A.This point shows that this process has produced highly purified material and moved with the size of 36kDa.The band of the people PDGF-C protein that Figure 17 C shows the brachymemma under reductive condition and the non-reduced condition after with coomassie brilliant blue staining.But it is the excretory dimer that is connected by disulfide linkage that data show protein, and monomer is with the size migration of 24kDa.

Embodiment 4: the receptors bind character of the PDGF-C of total length and brachymemma

By investigating binding ability (wherein this Ig-fusion rotein comprises the ectodomain of VEGF-1, VEGF-2 or VEGF-3) total length and PDGF-C brachymemma and soluble Ig-fusion rotein, thereby can understand interaction situation (Olofsson et al. total length and PDGF-C brachymemma and vegf receptor, Proc.Natl.Acad.Sci.USA, 1998 9511709-11714).Here fusion rotein is meant VEGFR-1-Ig, VEGFR-2-Ig or VEGFR-3-Ig, and they are expressed in people 293EBNA cell.All Ig fusion roteins all are people source VEGFRs.After the transfection,, clean, continue again to cultivate 24 hours with the DMEM (Dulbecco ' s Modified Eagle Medium) that contains 0.2% bovine serum albumin with cell insulation 24 hours.Add albumin A-Sepharose pearl body, can be so that fusion rotein coagulation from substratum gets off.10X binding buffer liquid (5% bovine serum albumin of these pearl bodies and 100 μ l; the heparin of 0.2%Tween 20 and 10 μ g/ml) and 900 μ l unite use in order to the conditioned medium of cultivating 293 cells; these 293 cells with the coding contained total length or brachymemma PDGF-C the Mammals expression plasmid or with the control vector transfection, use by metabolism then ³⁵S-halfcystine and methionine(Met) were marked 4-6 hour.2.5 after hour, under the room temperature, with the binding buffer liquid washing Sepharose pearl body 3 times that once contains phosphate-buffered salt under 4 ℃ and in the SDS-PAGE damping fluid, boil.The labelled protein that is attached to the Ig-fused protein can be analyzed by the SDS-PAGE under the reductive condition.Can detect with the phosphorimetry instrument and to have radiolabeled proteins.In these all analyses, radiolabeled PDGF-C does not demonstrate with any vegf receptor interaction.

Next step is attached to ability on the pdgf receptor by analyzing they and PDGF-BB competition, to detect the ability that total length and PDGF-C brachymemma are attached to people PDGF-C acceptor α and β.In conjunction with experiment with can stably express people PDGF-C acceptor α and porcine aorta endothelium-1 cell of β be object (Erikson et al., EMBO J, 1992,11,543-550).In conjunction with the experiment detailed process with reference to Heldin et al., EMBO J, 1988,71387-1393.The total length of different concns and brachymemma people PDGF-C or people PDGF-BB and 5ng/ml's ¹²⁵I-PDGF-BB mixes in binding buffer liquid (PBS that contains the 1mg/ml bovine serum albumin).Liquid and be positioned in 24 well culture plates can expressed receptor PAE-1 cell ice bath 90 minutes.After with binding buffer liquid washing three times, by at 20mM Tris-HCl, pH 7.5,10% glycerine, lysing cell is attached on the cell with extracting among the 1%Triton X-100 ¹²⁵I-PDGF-BB.The radioactivity that cell has detects with the β counter.Figure 18 has shown ¹²⁵The PDGF-BB homodimer of I mark is attached to the typical curve on the PAE-1 cell of PDGF-B expression alpha-receptor.The unlabelled excess protein that joins in the heat insulation system is competed the cell combination of effective and radiolabeled tracer mutually.

Figure 19 shows that the effective competition of the PDGF-C of brachymemma is attached on the PDGF alpha-receptor, and the PDGF of total length is quite different.The protein of total length and brachymemma all can not be competed and be attached on the PDGF beta-receptor.

Embodiment 5:PDGF alpha-receptor phosphorylation

For the increase of verifying whether PDGF-C has caused the phosphorylation of PDGF alpha-receptor, the PDGF-C that has detected total length and brachymemma is attached on the PDGF alpha-receptor and the ability that stimulates phosphorylation to increase.Serum-free culture can stably express people PDGF alpha-receptor porcine aorta endotheliocyte and PBS placing 90 minutes on ice, this PBS is added with 1mg/ml BSA and 10ng/ml PDGF-AA, 100ng/ml total length people PDGF-CC homodimer (flPDGF-CC), the brachymemma PDGF-CC homodimer (cPDGF-CC) of 100ng/ml, the mixture of the brachymemma PDGF-CC of 10ng/ml PDGF-AA and 100ng/ml.Total length and brachymemma PDGF-CC homodimer prepare as stated above.After adding polypeptide 60 minutes, with the cell pyrolysis liquid lysing cell (20mM tris-HCl, pH7.5,0.5%Triton-X100,0.5% Septochol, 10mM EDTA, 1mM orthvanadate, 1mM PMSF, 1%Trasylol).The PDGF alpha-receptor can use the rabbit anti-serum at people PDGF alpha-receptor to carry out immune coagulation (Eriksson et al., EMBO J, 1,992 11 543-550) from clarifying lysate.The acceptor of coagulation carries out SDS-PAGE.After the SDS gel electrophoresis, the acceptor of coagulation is transferred on the nitrocellulose filter, and this film detects (Transduction Laboratories) with anti-phosphorylated tyrosine antibody PY-20.Then this film be connected with the anti-mouse antibody incubation of horseradish peroxidase.Detect bonded antibody (ECL, Amersham Inc.) with enhanced chemiluminescence method.Material on the flush away film is checked with PDGF alpha-receptor rabbit anti-serum more then, the amount of acceptor by with the anti-rabbit antibody incubation that is connected with horseradish peroxidase, detect again and decide.Detect bonded antibody (ECL, Amersham Inc.) with enhanced chemiluminescence method.By PDGF alpha-receptor detection of antibodies on the film is shown that all swimming lanes all contain the acceptor of equivalent.In the experiment with PDGF-AA in contrast.That Figure 20 shows is PDGF-CC brachymemma rather than total length, and it can effectively induce PDGF alpha-receptor tyrosine phosphorylation.This point shows that the PDGF-CC of brachymemma is the agonist of potential PDGF alpha-receptor.

Embodiment 6:PDGF-C is to fibroblastic mitogenesis

Figure 21 shows that the PDGF-CC of brachymemma and total length is to fibroblastic mitogenesis activity.Measuring method for activity is seen Moil et al., J.Biol.Chem., 1,991 266 21158-21164.The human foreskin fibroblast of serum-free culture and 1ml serum free medium incubation 24 hours, contain 0.2umCi[3H in this substratum] thymidine, 1mg/mlBSA and 3ng/ml, 10ng/ml, 30ng/ml total length PDGF-CC (flPDGF-CC) have been added again, PDGF-CC of brachymemma (cPDGF-CC) or PDGF-AA.Behind the trichoroacetic acid(TCA) coagulation, the degree that [3H] thymidine infiltrates DNA is determined by beta-counter.The result shows, is not the PDGF-CC of total length, facilitates the fibrocyte disintegrating agent but the PDGF-CC of brachymemma is only potential.In the experiment with PDGF-AA in contrast.

PDGF-C does not combine with any known vegf receptor.PDGF-C be known today unique can be in conjunction with the PDGF alpha-receptor, and increase the VEGF family member of its phosphorylation.PDGF-C also be at present known to unique potential facilitate fibrocyte splitted VEGF family member.These features show that the clipped form of PDGF-C may not be the VEGF family member, but a kind of new PDGF.In addition, whole length protein may be the potential somatomedin, needs to discharge active PDGF/VEGF homeodomain through proteolysis, and it just is activated.Known protein hydrolysis site is positioned at residue 231-234 (the binary motif of R-K-S-R-) locating of full length protein.By comparing mouse and people's PDGF-Cs, the structure that shows this site is (Fig. 7) that guards.Preferred proteolytic enzyme comprises factor X and enteropeptidase, is not limited in this certainly.N-end CUB structural domain can be used as the inhibition structural domain, be used in some cell mistress and locate potential somatomedin (for example extracellular skeleton), it can remove the words that need by specific proteolysis, for example in embryo development procedure, during the tissue regeneration and the tissue reconstruction process, comprise the bone reconstruction, active vasculogenesis, tumour worsens, tumour is invaded, and shifts to form and/or wound healing.

Embodiment 7: the pdgf receptor that is combined with the PDGF-C of brachymemma

By detect brachymemma the PDGF-C and porcine aorta endothelium-1 (PAE-1) the cell bonded ability of PDGF-B expression α or beta receptor respectively, with the assessment brachymemma PDGF-C and the interaction between PDGF α and the beta receptor (Eriksson et al., EMBO J, 1992,11,543-550).Integrating step concrete in the experiment can be referring to Heldin et al., EMBOJ, 1988,7 1687-1393.In 10 μ l sodium borate buffer liquid, with Bolton-Hunter reagent (Amersham) to brachymemma PDGF-C albumen (5 μ g) carry out radio-labeling, make its radioactivity reach 4x105cpm/ng.The binding buffer liquid (1mg/ml bovine serum albumin PBS) with the PDGF-C of radiolabeled brachymemma that will contain different concns, add 24 well culture plates, but the every Kong Zhongjun of culture plate contains the cell PAE-1 of expressed receptor, placed 90 minutes on ice, or add unlabelled albumen, placed 90 minutes on ice.Use binding buffer liquid washing three times, and the usefulness lysate (20mM Tris-HCl, pH7.5,10% glycerine, 1%Triton-100) lysing cell is combined on the cell with extracting ¹²⁵The PDGF-C of I-mark.Cell bonded radioactive dosage is measured by γ-counter.Added excessive 100 times brachymemma in some experiments PDGF-C, do not detect nonspecific combination.All binding datas are the mean value of three experiments, and the error of testing in the experiment is at 10-15%.As shown in figure 22, the PDGF-C of brachymemma only combines with the cell of PDGF-B expression α acceptor, and does not combine with the cell of PDGF-B expression beta receptor.When being with radiolabeled PDGF-C with the replacement of excessive 100 times unmarked protein quantification, the result shows that combination is specific.

Embodiment 8: proteolytic ferment influences total length PDGF-C

In order to prove that whether total length PDGF-C can be activated by specific proteolyzing and discharge and PDGF/VEGF homologous structural domain from the CUB structural domain, uses different protease treatment full-length proteins.For example, containing 1mM CaCl ₂, 1mM MgCl ₂In the 20mM Tris-HCl (PH7.5) of 0.01%Tween 20, working concentration is that the Tryptase (Sigma) of every milliliter of 2-3 unit is handled total length PDGF-C, 37 degrees centigrade incubation 1.5-4.5 hour.The structural domain that discharges is identical with the PDGF-C of the above-mentioned brachymemma that produces in transfectional cell in size substantially.The PDGF-C of plasmin enzymic digestion and the total length PDGF-C that is not digested carry out SDS-PAGE glue under reduced state.After the SDS-PAGE gel electrophoresis, albumen separately is transferred on the nitrocellulose filter, filter membrane is with the anti-polypeptide antiserum(antisera) of rabbit probe mark, and mark position is at 230-250 residue places of full-length proteins (residue GRKSRVVDLNLLTEEVRLYSC (SEQ ID NO:37) just in time is positioned at the N-end of PDGF/VEGF homeodomain).Can detect the combination of antibody with enhanced chemiluminescence method (ECL, Amersham Inc).Figure 23 has shown the result with the hybridization of the 26-28kDa protein immunization after the full-length proteins of indigested full-length proteins of 55kDa and plasmin enzymic digestion.

The PDGF-C of embodiment 9:PDGF α receptors bind plasmin enzymic digestion

Interaction for the PDGF-C that determines PDGF α acceptor and plasmin enzymic digestion, with the PDGF-C of plasmin enzymic digestion PDGF α acceptor in conjunction with porcine aorta endothelium-1 cell expressing, to detect its binding ability (Eriksson et al., EMBO J, 1992,11 543-550).The receptors bind experiment is used 30ng/ml I by the operation of example 7 steps ¹²⁵The PDGF-C of the cut-out of mark is as tracer agent.As shown in figure 24, increase the PDGF-C concentration of plasmin enzymic digestion, can more effectively combine than indigested total length PDGF-C with PDGF α receptor competition.These experiments have shown that total length PDGF-C is a potential somatomedin, can not with PDGF α acceptor interaction, and be subject to proteolyzing, make its PDGF/VEGF homeodomain that discharges the C-end, this is essential for the part/agonist that produces an activated PDGF α acceptor.

Embodiment 10: clone and expressing human PDGF-C CUB structural domain

The cDNA fragment coding CUB structural domain (at the 23-159 amino acids residue of total length PDGF-C) that 430 bases are arranged in the people PDGF-C gene, can utilize Deep VentDNA polysaccharase (Biolabs) to carry out pcr amplification under standard conditions and step, this encoding sequence 5 ' end primer is with 5 ' cgggatcccgaatccaacctgagtag3 ' (SEQ ID NO:38).This primer comprises a BamHI site (underscore) in order to the clone.This encoding sequence 3 ' end primer is with 5 ' ccggaattcctaatggtgatggtgatgatgtttgtcatcgtcgtcgacaatgttgt agtg3 ' (SEQ ID NO:39).This primer comprises an EcoRI site (underscore), and 6x histidine mark that is connected by the enteropeptidase site of the terminal coding of this sequence C.PCR fragment after the amplification is cloned on the pACgp67A conversion carrier subsequently.The correct sequence of CUB-pACgp67A expression cassette is verified by automatic nucleic acid sequencing instrument.According to the flow process (Pharmingen) of preparation, the linearizing baculovirus DNA cotransformation of expression vector and Baculogold is in insect cell Sf9 then.The baculovirus of reorganization was amplified several times before large-scale protein is produced, the protein purification step is carried out (Pharmingen) according to handbook.

With Sf9 cell (the multiplicity of infection :～7) of recombinate shape virus infection with the serum free medium cultivation.After infecting 72 hours, collect the substratum that contains recombinant protein, with itself and Ni-NTA-sepharose 4B body (Qiagen) incubation.The pearl body is collected in the post, used high-intensity elution requirement: the 50mM sodium phosphate buffer, pH8 contains 300mM NaCl (elution buffer), and bonded protein can elute by the concentration (from 100mM to 500mM) that increases imidazoles in the elution buffer.The protein of wash-out is analyzed by the SDS-PAGE of poly-propionic acid amide glue under reduction and non-reducing condition.

Figure 25 has shown the result behind the coomassie brilliant blue staining gel.People PDGF-CUB structural domain is the homodimer that disulfide linkage connects, and molecular weight is about 55kD under non-reduced state, and the monomer of two about 25 and 30kD exists under reduced state respectively.The reason that causes this species diversity may be to have carried out the glucamide reaction that different N-is connected in these two glucamide sites of CUB structural domain 25 and 55 amino acids.The figure left side is the swimming lane that is added with standard protein.

The location of embodiment 11:PDGF-C transcripton in the mice embryonic of growing

For the biological function of more understanding PDGF-C, the expression situation of observing PDGF-C by on-radiation tissue slice hybridization in situ technique in the head (Figure 26 A-26S) and urodaeum (Figure 26 T-26V) zone of mice embryonic.On-radiation tissue slice in situ hybridization use step and PDGF-A and PDGFR-α probe can be referring to Bostrom et al., Cell, 1,996 85 863-873.The PDGF-C probe comes from mouse PDGF-C cDNA.Hybridization model shown in Figure 26 A-26V is embryo E16.5, but also can see similar model at E14.5, E-15.5, E-17.5.Detection probes does not show same model at the hybridization section in contrast.

Shown in Figure 26 A is the forehead section of tooth base (t) by the oral cavity.Arrow refers to the site that oral area ectoderm PDGF-C expresses.Indicated tongue (to) simultaneously.Figure 26 B-26D has shown the expression of PDGF-C in the epithelial cell of growing the tooth pipe.The same with developmental palate ectoderm (the right arrow of Figure 26 C), individual cells demonstrates very strong mark (Figure 26 D arrow) in this zone.Figure 26 E has shown the forehead section by eye, finds that here PDGF-C expresses at hair follicle (double-headed arrow) and developmental eyelid place.Indicated retina (r) simultaneously.In Figure 26 F and 26G, the developmental hair follicle root sheath outside epithelium that is expressed in of PDGF-C is found.Among Figure 26 H, the expression of PDGF-C in the eyelid of growing is shown.There is the PDGF-C positive cell that has very strong marking signal individually to occur at the growth opening.Indicated lens (1) simultaneously.Figure 26 I, the expression of PDGF-C in growing lachrymal gland pointed out with arrow.Figure 26 J, PDGF-C expresses at developmental external ear.Expression sees the early stage auricle (e) at external auditory road (left arrow) and epidermis breach place.Figure 26 K and 26L are the expression of PDGF-C at cochlea.Expression sees semicircular pipe (26K arrow place).Close on the epithelial cell of hair cell in the growth and have the polarization distribution (Figure 26 L arrow) of PDGF-C mRNA.Figure 26 M and 26N are the expression of PDGF-C in the oral cavity.Dropping cut slice showed cheek epithelium (Figure 26 M arrow) and form in the expression of PDGF-C in the breach between low lip cheek and gums epithelium (Figure 26 N arrow).Tooth original hase (t) and tongue (to) are revealed simultaneously.Figure 26 O and 26P have shown the expression of PDGF-C in growing the nostril on the dropping cut slice.PDGF-C express the strongest appear at epithelium layering and normal pipeline form before (Figure 26 O and 26P arrow).Developmental nostril is also by dated (n).Figure 26 Q-26S has shown the expression of PDGF-C in growing salivary gland duct.Figure 26 Q is a sublingual gland.Figure 26 R and 26S have shown admaxillary gland, sialisterium (sg) and saliva pipe (sd).Figure 26 T-26V has shown the expression of PDGF-C at urodaeum.Figure 26 T has shown that PDGF-C is in the mesoblastic expression of metanephros of growing middle kidney.Figure 26 U has shown the epithelium expression on every side of PDGF-C penis in urethra (ua) and growth.Figure 26 V has shown the expression of PDGF-C ureter (u) in growth.

Embodiment 12:PDGF-C, PDGF-A and PDGFR-α are in the expression of growing middle kidney

One of strength point that PDGF-C expresses is in the kidney of growth, so the expression of PDGF-C, PDGF-A and PDGFR-α also sees in the kidney of growth.Figure 27 A-27F has shown the on-radiation results of in situ hybridization, (blueness of being dyed with the DIC optical detection under the background of not dying) be their mRNA expression in kidney when having shown E16.5, PDGF-C (Figure 27 A and 27B), PDGF-A (Figure 27 C and 27D) and PDGFR-α (Figure 27 E and 27F).White dashed line in Figure 27 B, 27D and 27F has been depicted the profile on cortex border.Figure 27 A, 27C and 27E middle short line are represented 250 μ M, represent 50 μ M among Figure 27 B, 27D and the 27F.

PDGF-C expresses and sees matter between metanephros (Figure 27 Amm), and (Figure 27 B arrow) expression level strengthens in condensing a matter, and condensing a matter can grow through epithelium conversion further carrying out tubulose, is positioned at the both sides of ureteric bud (ub).PDGF-C is the expression of nephron epithelium habitat (B arrow place) maintenance lower level in early days, does not express to tubular construction at ripe renal glomerulus (gl).

PDGF-A expresses and does not find in these early stage aggregates, but manages the late phase strong expression (Figure 24 C and 24D) of growing.PDGF-A expresses (Figure 27 D arrow place) in the epithelium aggregate of the nephron in early days, in case but the nephron further grow, PDGF-A expresses and becomes to the thin urinary catheter of growing (Figure 27 D arrow) the restricted property of stumbling.Visible expression is the strongest in the thin urinary catheter of growing marrow is stumbled (Figure 27 C arrow).In branch's ureter (u) and ureteric bud (ub), lose PDGF-A.

Therefore, PDGF-C and PDGF-A expression pattern have spatial and temporal differences in growing the nephron.Earliest stages (a matter aggregate) PDGF-B expression-C that grows in the nephron, and at stage (thin urinary catheter is stumbled) PDGF-B expression-A the latest.

Therefore the PDGFR-alpha expression can become the target of PDGF-C and PDGF-A through matter (Figure 27 E and 27F) between the growth middle kidney.Also PDGF-B expression-B in the kidney of growing, but occur over just in the vascular endothelial cell.PDGFR-β expresses and occurs in matter between surrounding blood vessel, and PDGF-B activates the necessary condition that this process of PDGFR-β is the messangial cell reorganization in the renal glomerulus.

These results have proved that the PDGF-C expression occurs near the PDGFR-alpha expression site, but not near the expression site of PDGF-A or PDGF-B.This has shown that PDGF-C may play a role by PDGFR-α in vivo, and does not need the help of PDGF-A or PDGF-B.

Since the unique expression pattern of PDGF-C shows the function of its enforcement PDGFR-alfa agonists in the kidney of growing, and it is uncorrelated with PDGF-A and PDGF-B, we have done a comparison with 16.5 days kidney of embryo in histological level: the relatively kidney (Figure 28 A and 28C) of PDGFR-α knock-out mice (Figure 28 B and 28F) and wild-type mice, and the kidney of PDGF-A knock-out mice (Figure 28 D) and the whole knock-out mices of PDGF-A/PDGF-B (Figure 28 E).Short-term is represented 250mm in Figure 28 A and 28B, expression 50 μ m in Figure 28 C-F.

Use PDGF-A, PDGF-B and PDGFR-α heterozygous mutant body (Bostron et al., Cell, 1,996 85 863-873; Leveen et al., Genes Dev., 1,994 8 1875-1887; Soriano et al., Development, 1,997 124 2691-70) make up C57B16/129sv hybridization system, hybridize again to produce the homozygous mutation embryo.PDGF-A/PDGF-B heterozygous mutant body is hybridized to be produced PDGF-A/PDGF-B and knocks out the embryo.Because PDGF-A-/-height lethality (Bostron et al., Cell, 1,996 85 863-873) before E10, the dual-gene E16.5 embryo proportion that knocks out is less than 1/40 in hybridization system.The embryo who knocks out except PDGF-A/PDGF-B is dual-gene has only obtained an exception, and all the other every kind of genotype of kidney phenotype embryo of isozygotying have been verified two examples at least.

What is interesting is PDGFR-α-/-renal cortex in (Figure 28 A arrow and Figure 28 F asterisk) lack the gap mesenchymal, and all have (Figure 28 C-E asterisk) at all other genotype intermediate gap mesenchymals.Matter (mm) and its epidermal derived thing are all acted normally at all mutant between branch's ureter (u) and metanephros.Knock out renal glomeruluss unusual among the embryo and reflect owing to lack PDGF-B and cause renal glomerulus mesonephric glomerulus cell to recombinate in that PDGF-A/PDGF-B is two.

These results have shown that phenotype that PDGFR-α has a kind of kidney in knocking out does not occur, and has therefore reflected that potential comes from the signal deletion of PDGF-C in the individuality that PDGF-A or PDGF-A/PDGF-B knock out.Phenotype is made up of the gap mesenchymal disappearance of renal cortex mark in growing.PDGFR-α-/-kidney in, the disappearance of these cells is just because of the expression site of normal PDGFR-α positive cell adjacent to PDGF-C.

The bioanalytical method of check PDGF-C function

The enforcement of experiment is whether to PDGF-A, PDGF-B, VEGF, VEGF-B, VEGF-C or VEGF-D similar growth that can influence phoirocyte, inoblast, myofibroblast and neurogliocyte and mobility to be arranged in order to assess PDGF-C, change inner skin cell function, regulate vasculogenesis, promote the effect of wound healing.According to the research that receptors bind distributes, can further test.I. to endotheliocyte PDGF-C mitogenesis

In order to detect PDGF-C to endotheliocyte mitogenesis ability, the PDGF-C polypeptide is introduced in the cell culture medium that contains 5% serum, uses the substratum breeding bovine aortic endothelial cells (BAEs) that contains 10% serum.BAEs is seeded in earlier in 24 well culture plates, and cell density reaches 10,000 adding PDGF-C the day before yesterday in each hole.Adding polypeptide separated and counting with trypsinase after 3 days.The VEGF of purifying this experiment in as positive control.

II. inner skin cell function experiment

A) endothelial cell proliferation

Well-known technological method such as Ferrara and Henzel are adopted in the endothelial cell growth experiment, Nature, 1,989 380 439-443, Gospodarowics et al., Proc.Natl.Acad.Sci.USA, 1,989 86 7311-7315, and Claffey et al., Biochem.Biophys.Acts, 1,995 1246 1-9.

B) cell attachment experiment

Detect the endotheliocyte of influence PDGF-C sticks to(for) polymorphonuclear granulocyte.

C) chemotaxis

Detect PDGF-C to chemotactic influence with the experiment of standard Boyden chamber chemotaxis.

D) proplasmin activation experiment

Endotheliocyte is used to detect PDGF-C to the active influence that suppresses generation of proplasmin, adopts Pepper et al., Biochem.Biophy.Res.Commun., the method for 1991 181902-906.

E) endothelial cell migration experiment

Migration of PDGF-C stimulating endothelial cell and formation piped ability are described in following experiment: Montesano et al., Proc.Natl.Acad.Sci.USA, 1,986 83 7297-7301.Perhaps, three-dimensional collagen gel experiment Joukov et al., EMBO J. records and narrates among 1,996 15 290-298 to some extent, perhaps can be with gelating film (Glaser et al., Nature, 1,980 288 483-484) in the Boyden chamber of modifying.

III. vasculogenesis experiment

PDGF-C induction of vascular on chorioallantoic membrane generates the ability of response and tests record below: Leung et al., Science, 1,989 246 1306-1309.Perhaps adopt rat cornea experiment Rastinejad et al., Cell, 1,989 56 345-355; This is that an individual interior vasculogenesis is tested acceptable method, and its result can be easy to be transformed into system in other body.

IV. wound healing

The ability of PDGF-C stimulating wound healing can be with most ofs clinical relevant visible models detections, as Schilling et al., Surgery, record and narrate among 1,995 46 702-710 or utilize Hunt et al., Surgery, 1,967 114 302-307.

V. promoting erythrocyte generation system

Use the special cells colony of erythropoietin system to carry out in the various bodies and external experiment.In the experiment that the external stem cell of mouse is analyzed, use the fluorocyte sorter to come purifying cells, the result is more satisfactory.

A) implant stem cell again

These cells can be implanted the marrow through the mouse of lethal exposure again, and Lin is arranged ^-, Rh ^Hl, Ly-6A/E ⁺, c-kit ⁺Several phenotypes.In these cells, add PDGF-C separately, perhaps PDGF-C is added cell with other factor, subsequently by mixing ³The H-thymidine is measured the increment of cell.

B) late period stem cell

These cells have very little relatively marrow transfer ability again, but can produce D13 CFU-S.These cells also have Lin ^-, Rh ^Hl, Ly-6A/E ⁺, c-kit ⁺Several phenotypes.In these cells, add PDGF-C, be then injected into through in the receptor of lethal exposure, to the enumeration of D13 spleen.

C) enrichment for generations (Progenitor-Enriched) cell

These cells have response in external stimulation to single somatomedin, and have Lin ^-, Rh ^Hl, Ly-6A/E ⁺, c-kit ⁺Several phenotypes.This experiment purpose is a progenitor of verifying whether PDGF-C can directly act on erythropoietin.On nutrient agar, with PDGF-C and these cell incubations, after 7-14 days with the survival enumeration.

VI. atherosclerosis

Smooth muscle cell has been played the part of important role in growth or atherosclerotic generation, need their phenotype to become the synthetic state from contraction schedule.By the growth and the phenotypic variation that influence smooth muscle cell, scavenger cell, endotheliocyte, T lymphocyte and thrombocyte are all played a role in Atherosclerosis.With the Rose chamber of modifying, wherein different cell types are inoculated into the opposite, and external experiment can dynamic measurement proliferation rate and smooth muscle cell phenotypic adaptability under the many cells environment, and it is used to detect the influence of PDGF-C to smooth muscle cell thus.

VII. shift

Do the experiment that PDGF-C suppresses transfer ability with the lung cancer model of Lewis, for example use Cao et al., J.Exp.Med., the method for 1,995 182 2069-2077.

VIII. the migration of smooth muscle cell

PDGF-C can use Koyama et al. to the influence of smooth muscle cell and the migration of other cell type, J.Biol.Chem., the method validation that 1,992 267 22806-22812 record and narrate.

The IX chemotaxis

PDGF-C is to the available Siegbahn et of the influence of inoblast, monocyte, granulocyte and other cell al., J.Clin.Invest., the method validation that 1,990 85 916-920 record and narrate.

X. the PDGF-C in other cell type

PDGF-C is to the influence of propagation, differentiation and other cell type function, and for example liver cell, cardiac muscle and other cell, endocrine cell and scleroblast etc. can be verified with known technological method, for example by absorbing in the in-vitro culture medium ³The H-thymidine.The expression of PDGF-C in these and other tissue can be measured by Northern dot hybridization or hybridization in situ technique.

The structure of XI.PDGF-C varient and analogue

PDGF-C is a member of PDGF growth factor family, and other member of it and PDGF-C family keeps highly identical homology.PDGF-C comprises 8 conserved cysteine residue, and this is the characteristics of this growth factor family.These conserved cysteine residue have formed intrachain disulfide bond, have produced the halfcystine junction structure, and the albumen dimer that interior chain disulfide linkage forms also is PDGF growth factor family member's characteristics.PDGF-C and tyrosine protein kinase growth factor receptors interact.

Know little to this protein structure with necessary avtive spot of receptors bind and the vigor that is associated thereof, according to avtive spot and important amino acid residue among many known PDGF somatomedin members of family, design PDGF-C vitality mutation body can advance people's understanding in this respect greatly.

The article of having delivered of illustrating PDGF growth factor family member's structure and vigor relation has many, wherein having about the PDGF content: Oestman et al., J.Biol.Chem., 1991266 10073-10077; Andersson et al., J.Biol.Chem., 1,992 267 11260-11266; Oefner et al., EMBO J., 1,992 11 3921-3926; Flemming et al., Molecular and Cell Biol., 1,993 13 4066-4076 and Anderson et al., GrowthFactors, 1,995 12 159-164; About comprising of VEGF: Kim et al., GrowthFactors, 1,992 7 53-64; Potgens et al., J.Biol.Chem., 1,994 269 32879-328885 and Claffey et al., Biochem.Biophys.Acta, 1,995 1246 1-9.Show in these articles, because 8 conservative cysteine residues, the group membership of PDGF somatomedin man has showed feature knot shape pleated sheet structure and dimerisation, to such an extent as to all formed the annular zone of three exposures at each end of dimer molecule, estimated that the active acceptor binding site just is positioned at here.

Based on above information, can utilize the prior biological technology manually to design the PDGF-C mutant, promptly keep 8 cysteine residues to form the fold arrangement and the dimer of knot shape, thereby may highly preserve the PDGF-C vigor, only by keeping or the displacement conservative amino acid residues, detect ring 1, ring 2 and encircle receptor sequence possible in 3 districts simultaneously at protein structure.

Forming the specific target site mutation on protein structure, is the standard technique (Kunkel et al., Methods in Enzymol., 1,987 154 367-382) in the albumen chemist research method.The visible Potgens et of the example of the direct mutagenesis in these sites on VEGF al., J.Biol.Chem., 1,994 269 32879-32885 and Claffey et al., Biochem.Biophys.Acta, 1,995 1246 1-9.In fact, site directly sudden change is extremely common, and business-like test kit is easy to realize these steps (for example Promega 1994-1995 goods catalogue is 142-145 pages).

For the PDGF-C mutant, test it to phoirocyte, inoblast, myofibroblast and neurogliocyte growth and active active, the endothelial cell proliferation activity, the effect of angiogenic activity and wound healing can be verified rapidly with the screening step of having set up.For example, can directly use for the existing descriptions such as similar step Claffey (Biochem.Biophys.Acta, 1,995 1246 1-9) of endothelial cell mitogen experiment.Similar, PDGF-C can use the existing technology for detection of people to the influence of other cell type propagation, cytodifferentiation and human metabolism aspect.

The above-mentioned description of this invention and cited specific examples only play a part to explain and explanation, do not play restriction, do not mean that promptly the present invention only comprises above-mentioned content.Professional in this area can according to the needs of oneself, carry out certain change and modification on the basis of basic inventive idea of the present invention, so the expansion of the present invention that stems from that relates in the claim also belongs to category of the present invention.

Sequence table＜110〉the Wu Erfu Eriksson

Card beautiful jade Ossir

Li Xuri

Fluffy Teng of An Nika

Ma Erke draws in the spy

Ka Lialitaluo

The A Ene Stedman

Ka Er-Heng Likeheierding

Chryst Bates Hall thatch＜120〉platelet-derived growth factor C, its coding DNA and application＜130 thereof〉sequence table＜140〉60/102; 461＜141〉1998-09-30＜150〉60/108; 109＜151〉1998-11-12＜150〉60/110; 749＜151〉1998-12-03＜150〉60/113; 002＜151〉1998-12-18＜150〉60/135; 426＜151〉1999-05-21＜150〉60/144,022＜151〉1999-07-15＜160〉39＜170〉PatentIn Ver.2.0＜210〉1＜211〉16＜212〉PRT＜213〉Homo sapiens＜400〉1Pro Xaa Cys Leu Leu Val Xaa Arg Cys Gly Gly Xaa Cys Xaa Cys Cys 1 5 10 15＜210〉2＜211〉2108＜212〉DNA＜213〉Homo sapiens＜400〉2ccccgccgtg agtgagctct caccccagtc agccaaatga gcctcttcgg gcttctcctg 60gtgacatctg ccctggccgg ccagagacga gggactcagg cggaatccaa cctgagtagt 120aaattccagt tttccagcaa caaggaacag aacggagtac aagatcctca gcatgagaga 180attattactg tgtctactaa tggaagtatt cacagcccaa ggtttcctca tacttatcca 240agaaatacgg tcttggtatg gagattagta gcagtagagg aaaatgtatg gatacaactt 300acgtttgatg aaagatttgg gcttgaagac ccagaagatg acatatgcaa gtatgatttt 360gtagaagttg aggaacccag tgatggaact atattagggc gctggtgtgg ttctggtact 420gtaccaggaa aacagatttc taaaggaaat caaattagga taagatttgt atctgatgaa 480tattttcctt ctgaaccagg gttctgcatc cactacaaca ttgtcatgcc acaattcaca 540gaagctgtga gtccttcagt gctaccccct tcagctttgc cactggacct gcttaataat 600gctataactg cctttagtac cttggaagac cttattcgat atcttgaacc agagagatgg 660cagttggact tagaagatct atataggcca acttggcaac ttcttggcaa ggcttttgtt 720tttggaagaa aatccagagt ggtggatctg aaccttctaa cagaggaggt aagattatac 780agctgcacac ctcgtaactt ctcagtgtcc ataagggaag aactaaagag aaccgatacc 840attttctggc caggttgtct cctggttaaa cgctgtggtg ggaactgtgc ctgttgtctc 900cacaattgca atgaatgtca atgtgtccca agcaaagtta ctaaaaaata ccacgaggtc 960cttcagttga gaccaaagac cggtgtcagg ggattgcaca aatcactcac cgacgtggcc 1020ctggagcacc atgaggagtg tgactgtgtg tgcagaggga gcacaggagg atagccgcat 1080caccaccagc agctcttgcc cagagctgtg cagtgcagtg gctgattcta ttagagaacg 1140tatgcgttat ctccatcctt aatctcagtt gtttgcttca aggacctttc atcttcagga 1200tttacagtgc attctgaaag aggagacatc aaacagaatt aggagttgtg caacagctct 1260tttgagagga ggcctaaagg acaggagaaa aggtcttcaa tcgtggaaag aaaattaaat 1320gttgtattaa atagatcacc agctagtttc agagttacca tgtacgtatt ccactagctg 1380ggttctgtat ttcagttctt tcgatacggc ttagggtaat gtcagtacag gaaaaaaact 1440gtgcaagtga gcacctgatt ccgttgcctt gcttaactct aaagctccat gtcctgggcc 1500taaaatcgta taaaatctgg attttttttt ttttttttgc tcatattcac atatgtaaac 1560cagaacattc tatgtactac aaacctggtt tttaaaaagg aactatgttg ctatgaatta 1620aacttgtgtc rtgctgatag gacagactgg atttttcata tttcttatta aaatttctgc 1680catttagaag aagagaacta cattcatggt ttggaagaga taaacctgaa aagaagagtg 1740gccttatctt cactttatcg ataagtcagt ttatttgttt cattgtgtac atttttatat 1800tctccttttg acattataac tgttggcttt tctaatcttg ttaaatatat ctatttttac 1860caaaggtatt taatattctt ttttatgaca acttagatca actattttta gcttggtaaa 1920tttttctaaa cacaattgtt atagccagag gaacaaagat ggatataaaa atattgttgc 1980cctggacaaa aatacatgta tntccatccc ggaatggtgc3tagagttgga ttaaacctgc 2040attttaaaaa acctgaattg ggaanggaan ttggtaaggt tggccaaanc ttttttgaaa 2100ataattaa 2108＜210〉3＜211〉345＜212〉PRT＜213〉Homo sapiens＜400〉3Met Ser Leu Phe Gly Leu Leu Leu Val Thr Ser Ala Leu Ala Gly Gln 1 5 10 15Arg Arg Gly Thr Gln Ala Glu Ser Asn Leu Ser Set Lys Phe Gln Phe

20 25 30Ser?Ser?Asn?Lys?Glu?Gln?Asn?Gly?Val?Gln?Asp?Pro?Gln?His?Glu?Arg

35 40 45Ile?Ile?Thr?Val?Ser?Thr?Asn?Gly?Ser?Ile?His?Ser?Pro?Arg?Phe?Pro

50 55 60His?Thr?Tyr?Pro?Arg?Asn?Thr?Val?Leu?Val?Trp?Arg?Leu?Val?Ala?Val?65 70 75 80Glu?Glu?Asn?Val?Trp?Ile?Gln?Leu?Thr?Phe?Asp?Glu?Arg?Phe?Gly?Leu

85 90 95Glu?Asp?Pro?Glu?Asp?Asp?Ile?Cys?Lys?Tyr?Asp?Phe?Val?Glu?Val?Glu

100 105 110Glu?Pro?Ser?Asp?Gly?Thr?Ile?Leu?Gly?Arg?Trp?Cys?Gly?Ser?Gly?Thr

115 120 125Val?Pro?Gly?Lys?Gln?Ile?Ser?Lys?Gly?Asn?Gln?Ile?Arg?Ile?Arg?Phe

130 135 140Val?Ser?Asp?Glu?Tyr?Phe?Pro?Set?Glu?Pro?Gly?Phe?Cys?Ile?His?Tyr145 150 155 160Asn?Ile?Val?Met?Pro?Gln?Phe?Thr?Glu?Ala?Val?Ser?Pro?Ser?Val?Leu

165 170 175Pro?Pro?Ser?Ala?Leu?Pro?Leu?Asp?Leu?Leu?Asn?Asn?Ala?Ile?Thr?Ala

180 185 190Phe?Ser?Thr?Leu?Glu?Asp?Leu?Ile?Arg?Tyr?Leu?Glu?Pro?Glu?Arg?Trp

195 200 205Gln?Leu?Asp?Leu?Glu?Asp?Leu?Tyr?Arg?Pro?Thr?Trp?Gln?Leu?Leu?Gly

210 215 220Lys?Ala?Phe?Val?Phe?Gly?Arg?Lys?Ser?Arg?Val?Val?Asp?Leu?Asn?Leu225 230 235 240Leu?Thr?Glu?Glu?Val?Arg?Leu?Tyr?Ser?Cys?Thr?Pro?Arg?Asn?Phe?Ser

245 250 255Val?Ser?Ile?Arg?Glu?Glu?Leu?Lys?Arg?Thr?Asp?Thr?Ile?Phe?Trp?Pro

260 265 270Gly?Cys?Leu?Leu?Val?Lys?Arg?Cys?Gly?Gly?Asn?Cys?Ala?Cys?Cys?Leu

275 280 285His?Asn?Cys?Ash?Glu?Cys?Gln?Cys?Val?Pro?Ser?Lys?Val?Thr?Lys?Lys

290 295 300Tyr?His?Glu?Val?Leu?Gln?Leu?Arg?Pro?Lys?Thr?Gly?Val?Arg?Gly?Leu305 310 315 320His?Lys?Ser?Leu?Thr?Asp?Val?Ala?Leu?Glu?His?His?Glu?Glu?Cys?Asp

325 330 335Cys?Val?Cys?Arg?Gly?Ser?Thr?Gly?Gly

340 345<210>4<211>1536<212>DNA<213>Homo?sapiens<400>4cgggtaaatt?ccagttttcc?agcaacaagg?aacagaacgg?agtacaagat?cctcagcatg?60agagaattat?tactgtgtct?actaatggaa?gtattcacag?cccaaggttt?cctcatactt?120atccaagaaa?tacggtcttg?gtatggagat?tagtagcagt?agaggaaaat?gtatggatac?180aacttacgtt?tgatgaaaga?tttgggcttg?aagacccaga?agatgacata?tgcaagtatg?240attttgtaga?agttgaggaa?cccagtgatg?gaactatatt?agggcgctgg?tgtggttctg?300gtactgtacc?aggaaaacag?atttctaaag?gaaatcaaat?taggataaga?tttgtatctg?360atgaatattt?tccttctgaa?ccagggttct?gcatccacta?caacattgtc?atgccacaat?420tcacagaagc?tgtgagtcct?tcagtgctac?ccccttcagc?tttgccactg?gacctgctta?480ataatgctat?aactgccttt?agtaccttgg?aagaccttat?tcgatatctt?gaaccagaga?540gatggcagtt?ggacttagaa?gatctatata?ggccaacttg?gcaacttctt?ggcaaggctt?600ttgtttttgg?aagaaaatcc?agagtggtgg?atctgaacct?tctaacagag?gaggtaagat?660tatacagctg?cacacctcgt?aacttctcag?tgtccataag?ggaagaacta?aagagaaccg?720ataccatttt?ctggccaggt?tgtctcctgg?ttaaacgctg?tggtgggaac?tgtgcctgtt?780gtctccacaa?ttgcaatgaa?tgtcaatgtg?tcccaagcaa?agttactaaa?aaataccacg?840aggtccttca?gttgagacca?aasaccggtg?tcaggggatt?gcacaaatca?ctcaccgacg?900tggccctgga?gcaccatgag?gagtgtgact?gtgtgtgcag?agggagcaca?ggaggatagc?960cgcatcacca?ccagcagctc?ttgcccagag?ctgtgcagtg?cagtggctga?ttctattaga?1020gaacgtatgc?gttatctcca?tccttaatct?cagttgtttg?cttcaaggac?ctttcatctt?1080caggatttac?agtgcattct?gaaagaggag?acatcaaaca?gaattaggag?ttgtgcaaca?1140gctcttttga?gaggaggcct?aaaggacagg?agaaaaggtc?ttcaatcgtg?gaaagaaaat?1200taaatgttgt?attaaataga?tcaccagcta?gtttcagagt?taccatgtac?gtattccact?1260agctgggttc?tgtatttcag?ttctttcgat?acggcttagg?gtaatgtcag?tacaggaaaa?1320aaactgtgca?agtgagcacc?tgattccgtt?gccttgctta?actctaaagc?tccatgtcct?1380gggcctaaaa?tcgtataaaa?tctggatttt?tttttttttt?tttgctcata?ttcacatatg?1440taaaccagaa?cattctatgt?actacaaacc?tggtttttaa?aaaggaacta?tgttgctatg?1500aattaaactt?gtgtcatgct?gataggacag?actgga 1536<210>5<211>318<212>PRT<213>Homo?sapiens<400>5Gly?Lys?Phe?Gln?Phe?Ser?Ser?Asn?Lys?Glu?Gln?Asn?Gly?Val?Gln?Asp 1 5 10 15Pro?Gln?His?Glu?Arg?Ile?Ile?Thr?Val?Ser?Thr?Asn?Gly?Ser?Ile?His

20 25 30Ser?Pro?Arg?Phe?Pro?His?Thr?Tyr?Pro?Arg?Asn?Thr?Val?Leu?Val?Trp

35 40 45Arg?Leu?Val?Ala?Val?Glu?Glu?Asn?Val?Trp?Ile?Gln?Leu?Thr?Phe?Asp

50 55 60Glu?Arg?Phe?Gly?Leu?Glu?Asp?Pro?Glu?Asp?Asp?Ile?Cys?Lys?Tyr?Asp?65 70 75 80Phe?Val?Glu?Val?Glu?Glu?Pro?Ser?Asp?Gly?Thr?Ile?Leu?Gly?Arg?Trp

85 90 95Cys?Gly?Ser?Gly?Thr?Val?Pro?Gly?Lys?Gln?Ile?Ser?Lys?Gly?Asn?Gln

100 105 110Ile?Arg?Ile?Arg?Phe?Val?Ser?Asp?Glu?Tyr?Phe?Pro?Ser?Glu?Pro?Gly

115 120 125Phe?Cys?Ile?His?Tyr?Asn?Ile?Val?Met?Pro?Gln?Phe?Thr?Glu?Ala?Val

130 135 140Ser?Pro?Ser?Val?Leu?Pro?Pro?Ser?Ala?Leu?Pro?Leu?Asp?Leu?Leu?Asn145 150 155 160Ash?Ala?Ile?Thr?Ala?Phe?Ser?Thr?Leu?Glu?Asp?Leu?Ile?Arg?Tyr?Leu

165 170 175Glu?Pro?Glu?Arg?Trp?Gln?Leu?Asp?Leu?Glu?Asp?Leu?Tyr?Arg?Pro?Thr

180 185 190Trp?Gln?Leu?Leu?Gly?Lys?Ala?Phe?Val?Phe?Gly?Arg?Lys?Ser?Arg?Val

195 200 205Val?Asp?Leu?Asn?Leu?Leu?Thr?Glu?Glu?Val?Arg?Leu?Tyr?Ser?Cys?Thr

210 215 220Pro?Arg?Asn?Phe?Ser?Val?Ser?Ile?Arg?Glu?Glu?Leu?Lys?Arg?Thr?Asp225 230 235 240Thr?Ile?Phe?Trp?Pro?Gly?Cys?Leu?Leu?Val?Lys?Arg?Cys?Gly?Gly?Asn

245 250 255Cys?Ala?Cys?Cys?Leu?His?Asn?Cys?Asn?Glu?Cys?Gln?Cys?Val?Pro?Ser

260 265 270Lys?Val?Thr?Lys?Lys?Tyr?His?Glu?Val?Leu?Gln?Leu?Arg?Pro?Lys?Thr

275 280 285Gly?Val?Arg?Gly?Leu?His?Lys?Ser?Leu?Thr?Asp?Val?Ala?Leu?Glu?His

290 295 300His?Glu?Glu?Cys?Asp?Cys?Val?Cys?Arg?Gly?Ser?Thr?Gly?Gly305 310 315<210>6<211>1474<212>DNA<213>Murinae?gen.sp.<400>6cacctggaga?cacagaagag?ggctctagga?aaaattttgg?atggggatta?tgtggaaact?60accctgcgat?tctctgctgc?cagagccggc?caggcgcttc?caccgcagcg?cagcctttcc?120ccgggctggg?ctgagccttg?gagtcgtcgc?ttccccagtg?cccgccgcga?gtgagccctc?180gccccagtca?gccaaatgct?cctcctcggc?ctcctcctgc?tgacatctgc?cctggccggc?240caaagaacgg?ggactcgggc?tgagtccaac?ctgagcagca?agttgcagct?ctccagcgac?300aaggaacaga?acggagtgca?agatccccgg?catgagagag?ttgtcactat?atctggtaat?360gggagcatcc?acagcccgaa?gtttcctcat?acgtacccaa?gaaatatggt?gctggtgtgg?420agattagttg?cagtagatga?aaatgtgcgg?atccagctga?catttgatga?gagatttggg?480ctggaagatc?cagaagacga?tatatgcaag?tatgattttg?tagaagttga?ggagcccagt?540gatggaagtg?ttttaggacg?ctggtgtggt?tctgggactg?tgccaggaaa?gcagacttct?600aaaggaaatc?atatcaggat?aagatttgta?tctgatgagt?attttccatc?tgaacccgga?660ttctgcatcc?actacagtat?tatcatgcca?caagtcacag?aaaccacgag?tccttcggtg?720ttgccccgtt?catctttgtc?attggacctg?ctcaacaatg?ctgtgactgc?cttcagtacc?780ttggaagagc?tgattcggta?cctagagcca?gatcgatggc?aggtggactt?ggacagcctc?840tacaagccaa?catggcagct?tttgggcaag?gctttcctgt?atgggaaaaa?aagcaaagtg?900gtgaatctga?atctcctcaa?ggaagaggta?aaactctaca?gctgcacacc?ccggaacttc?960tcagtgtcca?tacgggaaga?gctaaagagg?acagatacca?tattctggcc?aggttgtctc?1020ctggtcaagc?gctgtggagg?aaattgtgcc?tgttgtctcc?ataattgcaa?tgaatgtcag?1080tgtgtcccac?gtaaagttac?aaaaaagtac?catgaggtcc?ttcagttgag?accaaaaact?1140ggagtcaagg?gattgcataa?gtcactcact?gatgtggctc?tggaacacca?cgaggaatgt?1200gactgtgtgt?gtagaggaaa?cgcaggaggg?taactgcagc?cttcgtagca?gcacacgtga?1260gcactggcat?tctgtgtacc?cccacaagca?accttcatcc?ccaccagcgt?tggccgcagg?1320gctctcagct?gctgatgctg?gctatggtaa?agatcttact?cgtctccaac?caaattctca?1380gttgtttgct?tcaatagcct?tcccctgcag?gacttcaagt?gtcttctaaa?agaccagagg?1440caccaanagg?agtcaatcac?aaagcactgc?accg 1474<210>7<211>345<212>PRT<213>Murinae?gen.sp.<400>7Met?Leu?Leu?Leu?Gly?Leu?Leu?Leu?Leu?Thr?Ser?Ala?Leu?Ala?Gly?Gln 1 5 10 15Arg?Thr?Gly?Thr?Arg?Ala?Glu?Ser?Asn?Leu?Ser?Ser?Lys?Leu?Gln?Leu

20 25 30Ser?Ser?Asp?Lys?Glu?Gln?Asn?Gly?Val?Gln?Asp?Pro?Arg?His?Glu?Arg

35 40 45Val?Val?Thr?Ile?Ser?Gly?Asn?Gly?Ser?Ile?His?Ser?Pro?Lys?Phe?Pro

50 55 60His?Thr?Tyr?Pro?Arg?Asn?Met?Val?Leu?Val?Trp?Arg?Leu?Val?Ala?Val?65 70 75 80Asp?Glu?Asn?Val?Arg?Ile?Gln?Leu?Thr?Phe?Asp?Glu?Arg?Phe?Gly?Leu

85 90 95Glu?Asp?Pro?Glu?Asp?Asp?Ile?Cys?Lys?Tyr?Asp?Phe?Val?Glu?Val?Glu

100 105 110Glu?Pro?Ser?Asp?Gly?Ser?Val?Leu?Gly?Arg?Trp?Cys?Gly?Ser?Gly?Thr

115 120 125Val?Pro?Gly?Lys?Gln?Thr?Ser?Lys?Gly?Asn?His?Ile?Arg?Ile?Arg?Phe

130 135 140Val?Ser?Asp?Glu?Tyr?Phe?Pro?Ser?Glu?Pro?Gly?Phe?Cys?Ile?His?Tyr145 150 155 160Ser?Ile?Ile?Met?Pro?Gln?Val?Thr?Glu?Thr?Thr?Ser?Pro?Ser?Val?Leu

165 170 175Pro?Pro?Ser?Ser?Leu?Ser?Leu?Asp?Leu?Leu?Asn?Asn?Ala?Val?Thr?Ala

180 185 190Phe?Ser?Thr?Leu?Glu?Glu?Leu?Ile?Arg?Tyr?Leu?Glu?Pro?Asp?Arg?Trp

195 200 205Gln?Val?Asp?Leu?Asp?Ser?Leu?Tyr?Lys?Pro?Thr?Trp?Gln?Leu?Leu?Gly

210 215 220Lys?Ala?Phe?Leu?Tyr?Gly?Lys?Lys?Ser?Lys?Val?Val?Asn?Leu?Asn?Leu225 230 235 240Leu?Lys?Glu?Glu?Val?Lys?Leu?Tyr?Ser?Cys?Thr?Pro?Arg?Asn?Phe?Ser

245 250 255Val?Ser?Ile?Arg?Glu?Glu?Leu?Lys?Arg?Thr?Asp?Thr?Ile?Phe?Trp?Pro

260 265 270Gly?Cys?Leu?Leu?Val?Lys?Arg?Cys?Gly?Gly?Asn?Cys?Ala?Cys?Cys?Leu

275 280 285His?Asn?Cys?Asn?Glu?Cys?Gln?Cys?Val?Pro?Arg?Lys?Val?Thr?Lys?Lys

290 295 300Tyr?His?Glu?Val?Leu?Gln?Leu?Arg?Pro?Lys?Thr?Gly?Val?Lys?Gly?Leu305 310 315 320His?Lys?Ser?Leu?Thr?Asp?Val?Aia?Leu?Glu?His?His?Glu?Glu?Cys?Asp

325 330 335Cys?Val?Cys?Arg?Gly?Asn?Ala?Gly?Gly

340 345<210>8<211>192<212>PRT<213>Homo?sapiens<400>8Met?Asn?Phe?Leu?Leu?Ser?Trp?Val?His?Trp?Ser?Leu?Ala?Leu?Leu?Leu 1 5 10 15Tyr?Leu?His?His?Ala?Lys?Trp?Ser?Gln?Ala?Ala?Pro?Met?Ala?Glu?Gly

20 25 30Gly?Gly?Gln?Asn?His?His?Glu?Val?Val?Lys?Phe?Met?Asp?Val?Tyr?Gln

35 40 45Arg?Ser?Tyr?Cys?His?Pro?Ile?Glu?Thr?Leu?Val?Asp?Ile?Phe?Gln?Glu

50 55 60Tyr?Pro?Asp?Glu?Ile?Glu?Tyr?Ile?Phe?Lys?Pro?Ser?Cys?Val?Pro?Leu?65 70 75 80Met?Arg?Cys?Gly?Gly?Cys?Cys?Asn?Asp?Glu?Gly?Leu?Glu?Cys?Val?Pro

85 90 95Thr?Glu?Glu?Ser?Asn?Ile?Thr?Met?Gln?Ile?Met?Arg?Ile?Lys?Pro?His

100 105 110Gln?Gly?Gln?His?Ile?Gly?Glu?Met?Ser?Phe?Leu?Gln?His?Asn?Lys?Cys

115 120 125Glu?Cys?Arg?Pro?Lys?Lys?Asp?Arg?Ala?Arg?Gln?Glu?Asn?Pro?Cys?Gly

130 135 140Pro?Cys?Ser?Ser?Glu?Arg?Arg?Lys?His?Leu?Phe?Val?Gln?Asp?Pro?Gln145 150 155 160Thr?Cys?Lys?Cys?Ser?Cys?Lys?Asn?Thr?Asp?Ser?Arg?Cys?Lys?Ala?Arg

165 170 175Gln?Leu?Glu?Leu?Asn?Glu?Arg?Thr?Cys?Arg?Cys?Asp?Lys?Pro?Arg?Arg

180 185 190<210>9<211>170<212>PRT<213>Homo?sapiens<400>9Met?Pro?Val?Met?Arg?Leu?Phe?Pro?Cys?Phe?Leu?Gln?Leu?Leu?Ala?Gly 1 5 10 15Leu?Ala?Leu?Pro?Ala?Val?Pro?Pro?Gln?Gln?Trp?Ala?Leu?Ser?Ala?Gly

20 25 30Asn?Gly?Ser?Ser?Glu?Val?Glu?Val?Val?Pro?Phe?Gln?Glu?Val?Trp?Gly

35 40 45Arg?Ser?Tyr?Cys?Arg?Ala?Leu?Glu?Arg?Leu?Val?Asp?Val?Val?Ser?Glu

50 55 60Tyr?Pro?Ser?Glu?Val?Glu?His?Met?Phe?Ser?Pro?Ser?Cys?Val?Ser?Leu?65 70 75 80Leu?Arg?Cys?Thr?Gly?Cys?Cys?Gly?Asp?Glu?Asp?Leu?His?Cys?Val?Pro

85 90 95Val?Glu?Thr?Ala?Asn?Val?Thr?Met?Gln?Leu?Leu?Lys?Ile?Arg?Ser?Gly

100 105 110Asp?Arg?Pro?Ser?Tyr?Val?Glu?Leu?Thr?Phe?Ser?Gln?His?Val?Arg?Cys

115 120 125Glu?Cys?Arg?Pro?Leu?Arg?Glu?Lys?Met?Lys?Pro?Glu?Arg?Arg?Arg?Pro

130 135 140Lys?Gly?Arg?Gly?Lys?Arg?Arg?Arg?Glu?Asn?Gln?Arg?Pro?Thr?Asp?Cys145 150 155 160His?Leu?Cys?Gly?Asp?Ala?Val?Pro?Arg?Arg

165 170<210>10<211>188<212>PRT<213>Homo?sapiens<400>10Met?Ser?Pro?Leu?Leu?Arg?Arg?Leu?Leu?Leu?Ala?Ala?Leu?Leu?Gln?Leu 1 5 10 15Ala?Pro?Ala?Gln?Ala?Pro?Val?Ser?Gln?Pro?Asp?Ala?Pro?Gly?His?Gln

20 25 30Arg?Lys?Val?Val?Ser?Trp?Ile?Asp?Val?Tyr?Thr?Arg?Ala?Thr?Cys?Gln

35 40 45Pro?Arg?Glu?Val?Val?Val?Pro?Leu?Thr?Val?Glu?Leu?Met?Gly?Thr?Val

50 55 60Ala?Lys?Gln?Leu?Val?Pro?Ser?Cys?Val?Thr?Val?Gln?Arg?Cys?Gly?Gly?65 70 75 80Cys?Cys?Pro?Asp?Asp?Gly?Leu?Glu?Cys?Val?Pro?Thr?Gly?Gln?His?Gln

85 90 95Val?Arg?Met?Gln?Ile?Leu?Met?Ile?Arg?Tyr?Pro?Ser?Ser?Gln?Leu?Gly

100 105 110Glu?Met?Ser?Leu?Glu?Glu?His?Ser?Gln?Cys?Glu?Cys?Arg?Pro?Lys?Lys

115 120 125Lys?Asp?Ser?Ala?Val?Lys?Pro?Asp?Ser?Pro?Arg?Pro?Leu?Cys?Pro?Arg

130 135 140Cys?Thr?Gln?His?His?Gln?Arg?Pro?Asp?Pro?Arg?Thr?Cys?Arg?Cys?Arg145 150 155 160Cys?Arg?Arg?Arg?Ser?Phe?Leu?Arg?Cys?Gln?Gly?Arg?Gly?Leu?Glu?Leu

165 170 175Asn?Pro?Asp?Thr?Cys?Arg?Cys?Arg?Lys?Leu?Arg?Arg

180 185<210>11<211>133<212>PRT<213>Homo?sapiens<400>11Met?Lys?Leu?Leu?Val?Gly?Ile?Leu?Val?Ala?Val?Cys?Leu?His?Gln?Tyr 1 5 10 15Leu?Leu?Asn?Ala?Asp?Ser?Asn?Thr?Lys?Gly?Trp?Ser?Glu?Val?Leu?Lys

20 25 30Gly?Ser?Glu?Cys?Lys?Pro?Arg?Pro?Ile?Val?Val?Pro?Val?Ser?Glu?Thr

35 40 45His?Pro?Glu?Leu?Thr?Ser?Gln?Arg?Phe?Asn?Pro?Pro?Cys?Val?Thr?Leu

50 55 60Met?Arg?Cys?Gly?Gly?Cys?Cys?Asn?Asp?Glu?Ser?Leu?Glu?Cys?Val?Pro?65 70 75 80Thr?Glu?Glu?Val?Asn?Val?Ser?Met?Glu?Leu?Leu?Gly?Ala?Ser?Gly?Ser

85 90 95Gly?Ser?Asn?Gly?Met?Gln?Arg?Leu?Ser?Phe?Val?Glu?His?Lys?Lys?Cys

100 105 110Asp?Cys?Arg?Pro?Arg?Phe?Thr?Thr?Thr?Pro?Pro?Thr?Thr?Thr?Arg?Pro

115 120 125Pro?Arg?Arg?Arg?Arg

130<210>12<211>419<212>PRT<213>Homo?sapiens<400>12Met?His?Leu?Leu?Gly?Phe?Phe?Ser?Val?Ala?Cys?Ser?Leu?Leu?Ala?Ala 1 5 10 15Ala?Leu?Leu?Pro?Gly?Pro?Arg?Glu?Ala?Pro?Ala?Ala?Ala?Ala?Ala?Phe

20 25 30Glu?Ser?Gly?Leu?Asp?Leu?Ser?Asp?Ala?Glu?Pro?Asp?Ala?Gly?Glu?Ala

35 40 45Thr?Ala?Tyr?Ala?Ser?Lys?Asp?Leu?Glu?Glu?Gln?Leu?Arg?Ser?Val?Ser

50 55 60Ser?Val?Asp?Glu?Leu?Met?Thr?Val?Leu?Tyr?Pro?Glu?Tyr?Trp?Lys?Met?65 70 75 80Tyr?Lys?Cys?Gln?Leu?Arg?Lys?Gly?Gly?Trp?Gln?His?Asn?Arg?Glu?Gln

85 90 95Ala?Asn?Leu?Asn?Ser?Arg?Thr?Glu?Glu?Thr?Ile?Lys?Phe?Ala?Ala?Ala

100 105 110His?Tyr?Asn?Thr?Glu?Ile?Leu?Lys?Ser?Ile?Asp?Asn?Glu?Trp?Arg?Lys

115 120 125Thr?Gln?Cys?Met?Pro?Arg?Glu?Val?Cys?Ile?Asp?Val?Gly?Lys?Glu?Phe

130 135 140Gly?Val?Ala?Thr?Asn?Thr?Phe?Phe?Lys?Pro?Pro?Cys?Val?Ser?Val?Tyr145 150 155 160?Alg?Gys?Gly?Gly?Cys?Cys?Asn?Ser?Glu?Gly?Leu?Gln?Cys?Met?Asn?Thr

165 170 175Ser?Thr?Ser?Tyr?Leu?Ser?Lys?Thr?Leu?Phe?Glu?Ile?Thr?Val?Pro?Leu

180 185 190Ser?Gln?Gly?Pro?Lys?Pro?Val?Thr?Ile?Ser?Phe?Ala?Asn?His?Thr?Ser

195 200 205Cys?Arg?Cys?Met?Ser?Lys?Leu?Asp?Val?Tyr?Arg?Gln?Val?His?Ser?Ile

210 215 220Ile?Arg?Arg?Ser?Leu?Pro?Ala?Thr?Leu?Pro?Gln?Cys?Gln?Ala?Ala?Asn225 230 235 240Lys?Thr?Cys?Pro?Thr?Asn?Tyr?Met?Trp?Asn?Asn?His?Ile?Cys?Arg?Cys

245 250 255Leu?Ala?Gln?Glu?Asp?Phe?Met?Phe?Ser?Ser?Asp?Ala?Gly?Asp?Asp?Ser

260 265 270Thr?Asp?Gly?Phe?His?Asp?Ile?Cys?Gly?Pro?Asn?Lys?Glu?Leu?Asp?Glu

275 280 285Glu?Thr?Cys?Gln?Cys?Val?Cys?Arg?Ala?Gly?Leu?Arg?Pro?Ala?Ser?Cys

290 295 300Gly?Pro?His?Lys?Glu?Leu?Asp?Arg?Asn?Ser?Cys?Gln?Cys?Val?Cys?Lys305 310 315 320Asn?Lys?Leu?Phe?Pro?Ser?Gln?Cys?Gly?Ala?Asn?Arg?Glu?Phe?Asp?Glu

325 330 335Asn?Thr?Cys?Gln?Cys?Val?Cys?Lys?Arg?Thr?Cys?Pro?Arg?Asn?Gln?Pro

340 345 350Leu?Asn?Pro?Gly?Lys?Cys?Ala?Cys?Glu?Cys?Thr?Glu?Ser?Pro?Gln?Lys

355 360 365Cys?Leu?Leu?Lys?Gly?Lys?Lys?Phe?His?His?Gln?Thr?Cys?Ser?Cys?Tyr

370 375 380Arg?Arg?Pro?Cys?Thr?Asn?Arg?Gln?Lys?Ala?Cys?Glu?Pro?Gly?Phe?Ser385 390 395 400Tyr?Ser?Glu?Glu?Val?Cys?Arg?Cys?Val?Pro?Ser?Tyr?Trp?Lys?Arg?Pro

405 410 415Gln?Met?Ser<210>13<211>358<212>PRT<213>Homo?sapiens<400>13Met?Tyr?Gly?Glu?Trp?Gly?Met?Gly?Asn?Ile?Leu?Met?Met?Phe?His?Val 1 5 10 15Tyr?Leu?Val?Gln?Gly?Phe?Arg?Ser?Glu?His?Gly?Pro?Val?Lys?Asp?Phe

20 25 30Ser?Phe?Glu?Arg?Ser?Ser?Arg?Ser?Met?Leu?Glu?Arg?Ser?Glu?Gln?Gln

35 40 45Ile?Arg?Ala?Ala?Ser?Ser?Leu?Glu?Glu?Leu?Leu?Gln?Ile?Ala?His?Ser

50 55 60Glu?Asp?Trp?Lys?Leu?Trp?Arg?Cys?Arg?Leu?Lys?Leu?Lys?Ser?Leu?Ala?65 70 75 80?Ser?Met?Asp?Ser?Arg?Ser?Ala?Ser?His?Arg?Ser?Thr?Arg?Phe?Ala?Ala

85 90 95Thr?Phe?Tyr?Asp?Thr?Glu?Thr?Leu?Lys?Val?Ile?Asp?Glu?Glu?Trp?Gln

100 105 110Arg?Thr?Gln?Cys?Ser?Pro?Arg?Glu?Thr?Cys?Val?Glu?Val?Ala?Ser?Glu

115 120 125Leu?Gly?Lys?Thr?Thr?Asn?Thr?Phe?Phe?Lys?Pro?Pro?Cys?Val?Asn?Val

130 135 140Phe?Arg?Cys?Gly?Gly?Cys?Cys?Asn?Glu?Glu?Gly?Val?Met?Cys?Met?Asn145 150 155 160Thr?Ser?Thr?Ser?Tyr?Ile?Ser?Lys?Gln?Leu?Phe?Glu?Ile?Ser?Val?Pro

165 170 175Leu?Thr?Ser?Val?Pro?Glu?Leu?Val?Pro?Val?Lys?Ile?Ala?Asn?His?Thr

180 185 190Gly?Cys?Lys?Cys?Leu?Pro?Thr?Gly?Pro?Arg?His?Pro?Tyr?Ser?Ile?Ile

195 200 205Arg?Arg?Ser?Ile?Gln?Thr?Pro?Glu?Glu?Asp?Glu?Cys?Pro?His?Ser?Lys

210 215 220Lys?Leu?Cys?Pro?Ile?Asp?Met?Leu?Trp?Asp?Asn?Thr?Lys?Cys?Lys?Cys225 230 235 240Val?Leu?Gln?Asp?Glu?Thr?Pro?Leu?Pro?Gly?Thr?Glu?Asp?His?Ser?Tyr

245 250 255Leu?Gln?Glu?Pro?Thr?Leu?Cys?Gly?Pro?His?Met?Thr?Phe?Asp?Glu?Asp

260 265 270Arg?Cys?Glu?Cys?Val?Cys?Lys?Ala?Pro?Cys?Pro?Gly?Asp?Leu?Ile?Gln

275 280 285His?Pro?Glu?Asn?Cys?Ser?Cys?Phe?Glu?Cys?Lys?Glu?Ser?Leu?Glu?Ser

290 295 300Cys?Cys?Gln?Lys?His?Lys?Ile?Phe?His?Pro?Asp?Thr?Cys?Ser?Cys?Glu305 310 315 320Asp?Arg?Cys?Pro?Phe?His?Thr?Arg?Thr?Cys?Ala?Ser?Arg?Lys?Pro?Ala

325 330 335Cys?Gly?Lys?His?Trp?Arg?Phe?Pro?Lys?Glu?Thr?Arg?Ala?Gln?Gly?Leu

340 345 350Tyr?Ser?Gln?Glu?Asn?Pro

355<210>14<211>211<212>PRT<213>Homo?sapiens<400>14Met?Arg?Thr?Leu?Ala?Cys?Leu?Leu?Leu?Leu?Gly?Cys?Gly?Tyr?Leu?Ala 1 5 10 15His?Val?Leu?Ala?Glu?Glu?Ala?Glu?Ile?Pro?Arg?Glu?Val?Ile?Glu?Arg

20 25 30Leu?Ala?Arg?Ser?Gln?Ile?His?Ser?Ile?Arg?Asp?Leu?Gln?Arg?Leu?Leu

35 40 45Glu?Ile?Asp?Ser?Val?Gly?Ser?Glu?Asp?Ser?Leu?Asp?Thr?Ser?Leu?Arg

50 55 60Ala?His?Gly?Val?His?Ala?Thr?Lys?His?Val?Pro?Glu?Lys?Arg?Pro?Leu?65 70 75 80Pro?Ile?Arg?Arg?Lys?Arg?Ser?Ile?Glu?Glu?Ala?Val?Pro?Ala?Val?Cys

85 90 95Lys?Thr?Arg?Thr?Val?Ile?Tyr?Glu?Ile?Pro?Arg?Ser?Gln?Val?Asp?Pro

100 105 110Thr?Ser?Ala?Asn?Phe?Leu?Ile?Trp?Pro?Pro?Cys?Val?Glu?Val?Lys?Arg

115 120 125Cys?Thr?Gly?Cys?Cys?Asn?Thr?Ser?Ser?Val?Lys?Cys?Gln?Pro?Ser?Arg

130 135 140Val?His?His?Arg?Ser?Val?Lys?Val?Ala?Lys?Val?Glu?Tyr?Val?Arg?Lys145 150 155 160Lys?Pro?Lys?Leu?Lys?Glu?Val?Gln?Val?Arg?Leu?Glu?Glu?His?Leu?Glu

165 170 175Cys?Ala?Cys?Ala?Thr?Thr?Ser?Leu?Asn?Pro?Asp?Tyr?Arg?Glu?Glu?Asp

180 185 190Thr?Gly?Arg?Pro?Arg?Glu?Ser?Gly?Lys?Lys?Arg?Lys?Arg?Lys?Arg?Leu

195 200 205Lys?Pro?Thr

210<210>15<211>241<212>PRT<213>Homo?sapiens<400>15Met?Asn?Arg?Cys?Trp?Ala?Leu?Phe?Leu?Ser?Leu?Cys?Cys?Tyr?Leu?Arg 1 5 10 15Leu?Val?Ser?Ala?Glu?Gly?Asp?Pro?Ile?Pro?Glu?Glu?Leu?Tyr?Glu?Met

20 25 30Leu?Ser?Asp?His?Ser?Ile?Arg?Ser?Phe?Asp?Asp?Leu?Gln?Arg?Leu?Leu

35 40 45His?Gly?Asp?Pro?Gly?Glu?Glu?Asp?Gly?Ala?Glu?Leu?Asp?Leu?Asn?Met

50 55 60Thr?Arg?Ser?His?Ser?Gly?Gly?Glu?Leu?Glu?Ser?Leu?Ala?Arg?Gly?Arg?65 70 75 80Arg?Ser?Leu?Gly?Ser?Leu?Thr?Ile?Ala?Glu?Pro?Ala?Met?Ile?Ala?Glu

85 90 95Cys?Lys?Thr?Arg?Thr?Glu?Val?Phe?Glu?Ile?Ser?Arg?Arg?Leu?Ile?Asp

100 105 110Arg?Thr?Asn?Ala?Asn?Phe?Leu?Val?Trp?Pro?Pro?Cys?Val?Glu?Val?Gln

115 120 125Arg?Cys?Ser?Gly?Cys?Cys?Asn?Asn?Arg?Asn?Val?Gln?Cys?Arg?Pro?Thr

130 135 140Gln?Val?Gln?Leu?Arg?Pro?Val?Gln?Val?Arg?Lys?Ile?Glu?Ile?Val?Arg145 150 155 160Lys?Lys?Pro?Ile?Phe?Lys?Lys?Ala?Thr?Val?Thr?Leu?Glu?Asp?His?Leu

165 170 175Ala?Cys?Lys?Cys?Glu?Thr?Val?Ala?Ala?Ala?Arg?Pro?Val?Thr?Arg?Ser

180 185 190Pro?Gly?Gly?Ser?Gln?Glu?Gln?Arg?Ala?Lys?Thr?Pro?Gln?Thr?Arg?Val

195 200 205Thr?Ile?Arg?Thr?Val?Arg?Val?Arg?Arg?Pro?Pro?Lys?Gly?Lys?His?Arg

210 215 220Lys?Phe?Lys?His?Thr?His?Asp?Lys?Thr?Ala?Leu?Lys?Glu?Thr?Leu?Gly225 230 235 240Ala<2l0>16<211>182<212>PRT<213>Homo?sapiens<400>16Met?Pro?Gln?Phe?Thr?Asp?Cys?Val?Cys?Arg?Gly?Ser?Thr?Gly?Gly?Glu 1 5 10 15Ala?Val?Ser?Pro?Ser?Val?Leu?Pro?Pro?Ser?Ala?Leu?Pro?Leu?Asp?Leu

20 25 30Leu?Asn?Asn?Ala?Ile?Thr?Ala?Phe?Ser?Thr?Leu?Glu?Asp?Leu?Ile?Arg

35 40 45Tyr?Leu?Glu?Pro?Glu?Arg?Trp?Gln?Leu?Asp?Leu?Glu?Asp?Leu?Tyr?Arg

50 55 60Pro?Thr?Trp?Gln?Leu?Leu?Gly?Lys?Ala?Phe?Val?Phe?Gly?Arg?Lys?Ser?65 70 75 80Arg?Val?Val?Asp?Leu?Asn?Leu?Leu?Thr?Glu?Glu?Val?Arg?Leu?Tyr?Ser

85 90 95Cys?Thr?Pro?Arg?Asn?Phe?Ser?Val?Ser?Ile?Arg?Glu?Glu?Leu?Lys?Arg

100 105 110Thr?Asp?Thr?Ile?Phe?Trp?Pro?Gly?Cys?Leu?Leu?Val?Lys?Arg?Cys?Gly

115 120 125Gly?Asn?Cys?Ala?Cys?Cys?Leu?His?Asn?Cys?Asn?Glu?Cys?Gln?Cys?Val

130 135 140Pro?Ser?Lys?Val?Thr?Lys?Lys?Tyr?His?Glu?Val?Leu?Gln?Leu?Arg?Pro145 150 155 160Lys?Thr?Gly?Val?Arg?Gly?Leu?His?Lys?Ser?Leu?Thr?Asp?Val?Ala?Leu

165 170 175Glu?His?His?Glu?Glu?Cys

180<210>17<211>182<212>PRT<213>Murinae?gen.sp.<400>17Met?Pro?Gln?Val?Thr?Glu?Thr?Thr?Ser?Pro?Ser?Val?Leu?Pro?Pro?Ser 1 5 10 15Ser?Leu?Ser?Leu?Asp?Leu?Leu?Asn?Asn?Ala?Val?Thr?Ala?Phe?Ser?Thr

20 25 30Leu?Glu?Glu?Leu?Ile?Arg?Tyr?Leu?Glu?Pro?Asp?Arg?Trp?Gln?Val?Asp

35 40 45Leu?Asp?Ser?Leu?Tyr?Lys?Pro?Thr?Trp?Gln?Leu?Asp?Cys?Val?Cys?Arg

50 55 60Gly?Asn?Ala?Gly?Gly?Leu?Gly?Lys?Ala?Phe?Leu?Tyr?Gly?Lys?Lys?Ser?65 70 75 80Lys?Val?Val?Asn?Leu?Asn?Leu?Leu?Lys?Glu?Glu?Val?Lys?Leu?Tyr?Ser

85 90 95Cys?Thr?Pro?Arg?Asn?Phe?Ser?Val?Ser?Ile?Arg?Glu?Glu?Leu?Lys?Arg

100 105 110Thr?Asp?Thr?Ile?Phe?Trp?Pro?Gly?Cys?Leu?Leu?Val?Lys?Arg?Cys?Gly

115 120 125Gly?Asn?Cys?Ala?Cys?Cys?Leu?His?Asn?Cys?Asn?Glu?Cys?Gln?Cys?Val

130 135 140Pro?Arg?Lys?Val?Thr?Lys?Lys?Tyr?His?Glu?Val?Leu?Gln?Leu?Arg?Pro145 150 155 160Lys?Thr?Gly?Val?Lys?Gly?Leu?His?Lys?Ser?Leu?Thr?Asp?Val?Ala?Leu

165 170 175Glu?His?His?Glu?Glu?Cys

180<210>18<211>117<212>PRT<213>Murinae?gen.sp.<400>18Glu?Arg?Val?Val?Thr?Ile?Ser?Gly?Asn?Gly?Ser?Ile?His?Ser?Pro?Lys 1 5 10 15Phe?Pro?His?Thr?Tyr?Pro?Arg?Asn?Met?Val?Leu?Val?Trp?Arg?Leu?Val

20 25 30Ala?Val?Asp?Glu?Asn?Val?Arg?Ile?Gln?Leu?Thr?Phe?Asp?Glu?Arg?Phe

35 40 45Gly?Leu?Glu?Asp?Pro?Glu?Asp?Asp?Ile?Cys?Lys?Tyr?Asp?Phe?Val?Glu

50 55 60Val?Glu?Glu?Pro?Ser?Asp?Gly?Ser?Val?Leu?Gly?Arg?Trp?Cys?Gly?Ser?65 70 75 80Gly?Thr?Val?Pro?Gly?Lys?Gln?Thr?Ser?Lys?Gly?ASh?Met?Ile?Arg?Ile

85 90 95Arg?Phe?Val?Ser?Asp?Glu?Tyr?Phe?Pro?Ser?Glu?Pro?Gly?Phe?Cys?Ile

100 105 110His?Tyr?Ser?Ile?Ile

115<210>19<211>117<212>PRT<213>Homo?sapiens<400>19Glu?Arg?Ile?Ile?Thr?Val?Ser?Thr?Asn?Gly?Ser?Ile?His?Ser?Pro?Arg 1 5 10 15Phe?Pro?His?Thr?Tyr?Pro?Arg?Asn?Thr?Val?Leu?Val?Trp?Arg?Leu?Val

20 25 30Ala?Val?Glu?Glu?Asn?Val?Trp?Ile?Gln?Leu?Thr?Phe?Asp?Glu?Arg?Phe

35 40 45Gly?Leu?Glu?Asp?Pro?Glu?Asp?Asp?Ile?Cys?Lys?Tyr?Asp?Phe?Val?Glu

50 55 60Val?Glu?Glu?Pro?Ser?Asp?Gly?Thr?Ile?Leu?Gly?Arg?Trp?Cys?Gly?Ser?65 70 75 80Gly?Thr?Val?Pro?Gly?Lys?Gln?Ile?Ser?Lys?Gly?Asn?Gln?Ile?Arg?Ile

85 90 95Arg?Phe?Val?Ser?Asp?Glu?Tyr?Phe?Pro?Ser?Glu?Pro?Gly?Phe?Cys?Ile

100 105 110His?Tyr?Asn?Ile?Val

115<210>20<211>113<212>PRT<213>Homo?sapiens<400>20Cys?Gly?Glu?Thr?Leu?Gln?Asp?Ser?Thr?Gly?Asn?Phe?Ser?Ser?Pro?Glu 1 5 10 15Tyr?Pro?Asn?Gly?Tyr?Ser?Ala?His?Met?His?Cys?Val?Trp?Arg?Ile?Ser

20 25 30Val?Thr?Pro?Gly?Glu?Lys?Ile?Ile?Leu?Asn?Phe?Thr?Ser?Leu?Asp?Leu

35 40 45Tyr?Arg?Ser?Arg?Leu?Cys?Trp?Tyr?Asp?Tyr?Val?Glu?Val?Arg?Asp?Gly

50 55 60Phe?Trp?Arg?Lys?Ala?Pro?Leu?Arg?Gly?Arg?Phe?Cys?Gly?Ser?Lys?Leu?65 70 75 80Pro?Glu?Pro?Ile?Val?Ser?Thr?Asp?Ser?Arg?Leu?Trp?Val?Glu?Phe?Arg

85 90 95Ser?Ser?Ser?Asn?Trp?Val?Gly?Lys?Gly?Phe?Phe?Ala?Val?Tyr?Glu?Ala

100 105 110Ile<210>21<211>112<212>PRT<213>Homo?sapiens<400>21Cys?Gly?Gly?Asp?Val?Lys?Lys?Asp?Tyr?Gly?His?Ile?Gln?Ser?Pro?Asn 1 5 10 15Tyr?Pro?Asp?Asp?Tyr?Arg?Pro?Ser?Lys?Val?Cys?Ile?Trp?Arg?Ile?Gln

20 25 30Val?Ser?Glu?Gly?Phe?His?Val?Gly?Leu?Thr?Phe?Gln?Ser?Phe?Glu?Ile

35 40 45Glu?Arg?Met?Asp?Ser?Cys?Ala?Tyr?Asp?Tyr?Leu?Glu?Val?Arg?Asp?Gly

50 55 60His?Ser?Glu?Ser?Ser?Thr?Leu?Ile?Gly?Arg?Tyr?Cys?Gly?Tyr?Glu?Lys?65 70 75 80Pro?Asp?Asp?Ile?Lys?Ser?Thr?Ser?Ser?Arg?Leu?Trp?Leu?Lys?Phe?Val

85 90 95Ser?Asp?Gly?Ser?Ile?Asn?Lys?Ala?Gly?Phe?Ala?Val?Asn?Phe?Phe?Lys

100 105 110<210>22<211>113<212>PRT<213>Homo?sapiens<400>22Cys?Gly?Gly?Phe?Leu?Thr?Lys?Leu?Asn?Gly?Ser?Ile?Thr?Ser?Pro?Gly 1 5 10 15Trp?Pro?Lys?Glu?Tyr?Pro?Pro?Asn?Lys?Asn?Cys?Ile?Trp?Gln?Leu?Val

20 25 30Ala?Pro?Thr?Gln?Tyr?Arg?Ile?Ser?Leu?Gln?Phe?Asp?Phe?Phe?Glu?Thr

35 40 45Glu?Gly?Asn?Asp?Val?Cys?Lys?Tyr?Asp?Phe?Val?Glu?Val?Arg?Ser?Gly

50 55 60Leu?Thr?Ala?Asp?Ser?Lys?Leu?His?Gly?Lys?Phe?Cys?Gly?Ser?Glu?Lys?65 70 75 80Pro?Glu?Val?Ile?Thr?Ser?Gln?Tyr?Asn?Asn?Met?Arg?Val?Glu?Pro?Lys

85 90 95Ser?Asp?Asn?Thr?Val?Ser?Lys?Lys?Gly?Phe?Lys?Ala?His?Phe?Phe?Ser

100 105 110Glu<210>23<211>113<212>PRT<213>Homo?sapiens<400>23Gly?Asp?Thr?Ile?Lys?Ile?Glu?Ser?Pro?Gly?Tyr?Leu?Thr?Ser?Pro?Gly 1 5 10 15Tyr?Pro?His?Ser?Tyr?His?Pro?Ser?Glu?Lys?Cys?Glu?Trp?Leu?Ile?Gln

20 25 30Ala?Pro?Asp?Pro?Tyr?Gln?Arg?Ile?Met?Ile?Asn?Phe?Asn?Pro?His?Phe

35 40 45Asp?Leu?Glu?Asp?Arg?Asp?Cys?Lys?Tyr?Asp?Tyr?Val?Glu?Val?Phe?Asp

50 55 60Gly?Glu?Asn?Glu?Asn?Gly?His?Phe?Arg?Gly?Lys?Phe?Cys?Gly?Lys?Ile?65 70 75 80Ala?Pro?Pro?Pro?Val?Val?Ser?Ser?Gly?Pro?Phe?Leu?Phe?Ile?Lys?Phe

85 90 95Val?Ser?Asp?Tyr?Glu?Thr?His?Gly?Ala?Gly?Phe?Ser?Ile?Arg?Tyr?Glu

100 105 110Ile<210>24<211>119<212>PRT<213>Homo?sapiens<400>24Cys?Ser?Gln?Asn?Tyr?Thr?Thr?Pro?Ser?Gly?Val?Ile?Lys?Ser?Pro?Gly 1 5 10 15Phe?Pro?Glu?Lys?Tyr?Pro?Asn?Ser?Leu?Glu?Cys?Thr?Tyr?Ile?Val?Phe

20 25 30Ala?Pro?Lys?Met?Ser?Glu?Ile?Ile?Leu?Glu?Phe?Glu?Ser?Phe?Asp?Leu

35 40 45Glu?Pro?Asp?Ser?Asn?Pro?Pro?Gly?Gly?Met?Phe?Cys?Arg?Tyr?Asp?Arg

50 55 60Leu?Glu?Ile?Trp?Asp?Gly?Phe?Pro?Asp?Val?Gly?Pro?His?Ile?Gly?Arg?65 70 75 80Tyr?Cys?Gly?Gln?Lys?Thr?Pro?Gly?Arg?Ile?Arg?Ser?Ser?Ser?Gly?Ile

85 90 95Leu?Ser?Met?Val?Phe?Tyr?Thr?Asp?Ser?Ala?Ile?Ala?Lys?Glu?Gly?Phe

100 105 110Ser?Ala?Asn?Tyr?Ser?Val?Leu

115<210>25<211>19<212>DNA<213>Homo?sapiens<400>25gaagttgagg?aacccagtg 19<210>26<211>20<212>DNA<213>Homo?sapiens<400>26cttgccaaga?agttgccaag 20<210>27<211>19<212>DNA<213>Murinae?gen.sp.<400>27cttcagtacc?ttggaagag 19<2l0>28<211>19<212>DNA<213>Murinae?gen.sp.<400>28cgcttgacca?ggagacaac 19<210>29<211>30<212>DNA<213>Murinae?gen.sp.<400>29acgtgaattc?agcaagttca?gcctggttaa 30<210>30<211>30<212>DNA<213>Murinae?gen.sp.<400>30acgtggatcc?tgagtatttc?ttccagggta 30<210>31<211>22<212>PRT<213>Homo?sapiens<400>31Cys?Lys?Phe?Gln?Phe?Ser?Ser?Asn?Lys?Glu?Gln?Asn?Gly?Val?Gln?Asp 1 5 10 15Pro?Gln?His?Glu?Arg?Cys

20<210>32<211>21<212>PRT<213>Homo?sapiens<400>32Gly?Arg?Lys?Ser?Arg?Val?Val?Asp?Leu?Asn?Leu?Leu?Thr?Glu?Glu?Val 1 5 10 15Arg?Leu?Tyr?Ser?Cys

20<210>33<211>26<212>DNA<213>Homo?sapiens<400>33cgggatcccg?aatccaacct?gagtag 26<210>34<211>61<212>DNA<213>Homo?sapiens<400>34ggaattccta?atggtgatgg?tgatgatgtt?tgtcatcgtc?atctcctcct?gtgctccctc?60t 61<210>35<211>29<212>DNA<213>Homo?sapiens<400>35cggatcccgg?aagaaaatcc?agagtggtg<210>36<211>61<212>DNA<213>Homo?sapiens<400>36ggaattccta?atggtgatgg?tgatgatgtt?tgtcatcgtc?atctcctcct?gtgctccctc?60t 61<210>37<211>21<212>PRT<213>Homo?sapiens<400>37Gly?Arg?Lys?Ser?Arg?Val?Val?Asp?Leu?Asn?Leu?Leu?Thr?Glu?Glu?Val 1 5 10 15Arg?Leu?Tyr?Ser?Cys

20＜210〉38＜211〉26＜212〉DNA＜213〉Homo sapiens＜220〉＜223 come the people PDGF-C 430bp cDNA of own coding CUB structural domain

Segmental forward PCR primer, it comprises-BamHI site＜400〉38cgggatcccg aatccaacct gagtag＜210〉39＜211〉60＜212〉DNA＜213〉Homo sapiens＜220〉＜223 come the people PDGF-C 430bp cDNA of own coding CUB structural domain

Segmental inverse PCR primer, it comprises-EcoRI site and coding

It is the sequence of the C-terminal 6XHis in enteropeptidase site before

site<400>39ccggaattcc?taatggtgat?ggtgatgatg?tttgtcatcg?tcgtcgacaa?tgttgtagtg?60

Claims (74)

1. isolated nucleic acid molecule comprises the polynucleotide sequence that has with sequence at least 85% homogeny of Fig. 1, Fig. 3 or Fig. 5 (being respectively SEQ ID NO:2,4 and 6).

2. isolated nucleic acid molecule according to claim 1, wherein the homogeny of sequence is at least 90%.

3. isolated nucleic acid molecule according to claim 1, wherein the homogeny of sequence is at least 95%.

4. isolated nucleic acid molecule according to claim 1, wherein said nucleic acid is cDNA.

5. isolated nucleic acid molecule according to claim 1, wherein said nucleic acid are mammiferous polynucleotide.

6. isolated nucleic acid molecule according to claim 5, wherein said nucleic acid are the polynucleotide of muroid.

7. isolated nucleic acid molecule according to claim 6 comprises the sequence (SEQ ID NO:6) of Fig. 5.

8. isolated nucleic acid molecule according to claim 5, wherein said nucleic acid are human polynucleotide.

9. isolated nucleic acid molecule according to claim 8, wherein said nucleic acid comprise the sequence (being respectively SEQID NO:2 and 4) of Fig. 1 or Fig. 3.

10. isolated nucleic acid molecule, its encode a kind of peptide molecule or its has the analogue or the fragment of PDGF-C biologic activity, and the aminoacid sequence among the aminoacid sequence of this peptide molecule and Fig. 2 (SEQ ID NO:3), Fig. 4 (SEQ ID NO:5) has 85% homogeny at least.

11. isolated nucleic acid molecule according to claim 10, the homogeny of aminoacid sequence wherein is at least 90%.

12. isolated nucleic acid molecule according to claim 10, the homogeny of aminoacid sequence wherein is at least 95%.

13. an isolated nucleic acid molecule, the aminoacid sequence of its encoded polypeptides molecule comprises following aminoacid sequence:

PXCXXVXRCGGXXXCC(SEQID?NO：1)。

14. a carrier comprises the described nucleic acid of claim 1, this nucleic acid can be handled with one section promoter sequence and link to each other.

15. carrier according to claim 14, it is an eukaryotic vector.

16. carrier according to claim 14, it is a prokaryotic vector.

17. carrier according to claim 14, it is a plasmid.

18. carrier according to claim 14, it is a baculovirus vector.

19. a construction expression polypeptide or the analogue with PDGF-C biologic activity of polypeptide or the method for segmental carrier, the aminoacid sequence of wherein said amino acid sequence of polypeptide and Fig. 2 (SEQID NO:3) or Fig. 6 (SEQ ID NO:7) has 85% homogeny at least, and described method comprises to be inserted claim 1,10 or 13 described isolating nucleic acid in the described carrier can handle the mode that links to each other with promotor.

20. with the carrier conversion of claim 14 or a kind of host cell of transfection.

21. host cell according to claim 20, it is an eukaryotic cell.

22. host cell according to claim 20, it is the COS cell.

23. host cell according to claim 20, it is a prokaryotic cell prokaryocyte.

24. host cell according to claim 20, it is the 293EBNA cell.

25. host cell according to claim 20, it is an insect cell.

26. host cell with carrier conversion or transfection, described carrier comprises with a promotor can handle the described nucleotide sequence of the claim 1 that links to each other, thereby described host cell expression one peptide species or its have the analogue or the fragment of PDGF-C biologic activity, and the aminoacid sequence among this amino acid sequence of polypeptide and Fig. 2 (SEQ ID NO:3) or Fig. 6 (SEQ ID NO:7) has at least 85% homogeny.

27. an isolated polypeptide or its have the analogue or the fragment of PDGF-C biologic activity, this polypeptide has the aminoacid sequence with aminoacid sequence at least 85% homogeny of Fig. 2 (SEQ ID NO:3) or Fig. 6 (SEQ ID NO:7).

28. isolated polypeptide according to claim 27, it is the mouse polypeptide.

29. isolated polypeptide according to claim 27, it is human polypeptide.

30. isolated polypeptide according to claim 27, it has the propagation of the cell that stimulates and/or strengthen PDGF-B expression-C acceptor and/or the ability of differentiation and/or growth and/or motion.

31. isolated polypeptide of expressing to produce by a kind of polynucleotide, described polynucleotide comprise the polynucleotide sequence that has at least 85% homogeny with the sequence of Fig. 1, Fig. 3 or Fig. 5 (SEQ ID NO:2,4 or 6), and perhaps described polynucleotide are the polynucleotide of hybridizing with at least one above-mentioned dna sequence dna under stringent condition.

32. an isolated polypeptide comprises following characteristic sequence:

PXCXXVXRCGGXXXCC(SEQ?ID?NO：1)。

33. an isolated polypeptide dimer comprises the described polypeptide of claim 27.

34. polypeptide dimer according to claim 33, it is the homodimer of described polypeptide.

35. polypeptide dimer according to claim 33, it is the heterodimer that described polypeptide and VEGF, VEGF-B, VEGF-C, VEGF-D, PDGF-A, PDGF-B or PlGF form.

36. polypeptide dimer according to claim 33, the dimer that it connects for disulfide linkage.

37. a pharmaceutical composition comprises 27, the 31 or 32 described polypeptide that promote the cell proliferation significant quantity, and is selected from least a other somatomedin among VEGF, VEGF-B, VEGF-C, VEGF-D, PDGF-A, PDGF-B or the PlGF.

38., also comprise heparin according to the described pharmaceutical composition of claim 37.

39. a pharmaceutical composition comprises 27, the 31 or 32 described isolated polypeptide that promote the cell proliferation significant quantity, and at least a pharmaceutical carrier or thinner.

40. a pharmaceutical composition, comprise stimulate the pdgf receptor amount 27,31 or 32 described isolated polypeptide, and at least a pharmaceutical carrier or thinner.

41. a pharmaceutical composition comprises the claim 27, the 31 or 32 described isolated polypeptide that stimulate reticular tissue or wound healing significant quantity, and at least a pharmaceutical carrier or thinner.

42. the device of the described polynucleotide of amplification claim 1 in specimen, described device comprises and described at least one pair of primer of nucleic acid complementary of claim 1.

43. the device of the described polynucleotide of amplification claim 1 in specimen, described device comprise a kind of polysaccharase and with described at least one pair of primer of nucleic acid complementary of claim 1, be used for by the polymerase chain reaction (PCR) amplification polynucleotide so that these polynucleotide and the described nucleic acid of claim 1 are compared.

44. the antibody of one kind and claim 27,31 or 32 described polypeptide specific reactioies.

45. according to the described antibody of claim 44, it is a polyclonal antibody.

46. according to the described antibody of claim 44, it is a monoclonal antibody, perhaps F (ab ') ₂, F (ab '), F (ab) fragment or chimeric antibody.

47. according to claim 45 or 46 described antibody, it is with detectable marker mark.

48. according to the described antibody of claim 47, wherein said detectable mark is a radio isotope.

49. a method for preparing claim 27,31 or 32 described polypeptide, this method may further comprise the steps:

Cultivation transforms with carrier or the host cell of transfection, and described carrier comprises the polynucleotide that can handle the coding said polypeptide that links to each other with promoter sequence, thereby this nucleotide sequence of coding said polypeptide is expressed;

From described host cell or cultivate and separate described polypeptide in the substratum of described host cell.

50. a method that stimulates mammiferous connective tissue growth or wound healing comprises the claim 27, the 31 or 32 described polypeptide that give the Mammals significant quantity.

51. a method that produces activated PDGF-C clipped form comprises the step of the expression vector of expressing the described polynucleotide that comprise coded polypeptide of claim 69.

52. the specific method of receptors bind of regulating PDGF-C comprises the steps: to express and comprises the expression vector of coding as the polynucleotide of polypeptide as described in the claim 27,31 and 32; And at least a enzyme of proteolysis amount is provided, in order to polypeptide expressed is handled, obtain the active clipped form of PDGF-C.

53. a selectively activate has the method for the polypeptide of growth factor activity, comprise the steps: to express a kind of expression vector, this expression vector comprises a kind of polynucleotide, and this polynucleotide encoding has polypeptide, CUB structural domain and the polypeptide of growth factor activity and the protease cutting site between the CUB structural domain; And at least a enzyme of proteolysis amount is provided, in order to polypeptide expressed is handled, obtain having the active polypeptide of growth factor activity.

54. according to claim 27,31 and 32 described isolated polypeptide, it comprises the protease cutting site with aminoacid sequence RKSR or its structure conserved amino acid sequence.

55. nucleic acid molecule according to claim 10, the polypeptide of this nucleic acid molecule encoding comprise the protease cutting site that aminoacid sequence is RKSR or its structure conserved amino acid sequence.

56. an isolating heterodimer, it comprises the reactive monomer and the PDGF-C reactive monomer that links to each other with a CUB structural domain of VEGF, VEGF-B, VEGF-C, VEGF-D, PDGF-C, PDGF-A, PDGF-B or PlGF.

57. an isolating heterodimer, it comprises the reactive monomer of PDGF-C reactive monomer and VEGF, the VEGF-B, VEGF-C, VEGF-D, PDGF-C, PDGF-A, PDGF-B or the PlGF that link to each other with a CUB structural domain.

58., further be included in the protease cutting site between reactive monomer and the CUB structural domain according to the described heterodimer of claim 56.

59., further be included in the protease cutting site between reactive monomer and the CUB structural domain according to the described heterodimer of claim 57.

60. isolating polynucleotide, it comprises the polynucleotide sequence that has 85% homogeny with the sequence of Fig. 1, Fig. 3 or Fig. 5 (SEQ IDNO:2,4 or 6) at least, perhaps with the polynucleotide of at least a described dna sequence dna hybridize under stringent condition.

61. one kind strengthens the mitotic method of Mammals inoblast, comprise to administration promote mammiferous mitotic division significant quantity as claim 27,31 or 32 described polypeptide.

62. a method of inducing PDGF-α receptor activation, comprise the amount that add to stimulate PDGF-α acceptor as claim 27,31 or 32 described polypeptide.

63. a method that suppresses the tumor growth of the tumour of PDGF-B expression-C in the Mammals comprises the PDGF-C antagonist that described administration is suppressed the amount of PDGF-C.

64. one kind identify the human tumor particular type method, comprise and obtain tumor sample, and detect the step that its PDGF-C expresses.

65. according to the described method of claim 64, wherein specific tumor type is: choriocarcinoma, Wilms' tumor, megakaryocytic leukemia, lung cancer and erythroleukemia.

66. a method of identifying the PDGF-C antagonist comprises the steps:

The PDGF-C activation clipped form prepared product of basic purifying is mixed with detection reagent; With

Utilize any suitable mode to monitor inhibition to the PDGF-C biologic activity.

67. a method of identifying the PDGF-C antagonist comprises the steps:

The total length PDGF-C prepared product of basic purifying is mixed with detection reagent; With

Utilizing any suitable mode to monitor suppresses the cracked of CUB structural domain from PDGF-C.

68. isolated polypeptide according to claim 27, wherein said cell are endotheliocyte, phoirocyte, myofibroblast or neurogliocyte.

69. the method for a carrier construction, this vector expression one peptide species, this polypeptide comprises the aminoacid sequence that at least 85% homogeny is arranged with the 230th to the 345 amino acids residue of Fig. 2 (SEQ ID NO:3) or Fig. 6 (SEQ ID NO:7), and described method comprises inserts described carrier with the isolated nucleic acid molecule of the described amino-acid residue of coding can handle the mode that links to each other with promotor.

70. according to the described antibody of claim 46, wherein said monoclonal antibody is a human antibody.

71. comprising, a method for preparing the activation clipped form of PDGF-C, this method express as the expression vector of the polynucleotide of polypeptide as described in the claim 27,31 and 32 comprising coding; And at least a enzyme of proteolysis amount is provided, in order to polypeptide expressed is handled, obtain the activation clipped form of PDGF-C.

72. one kind is suppressed the tissue method of transition, comprises the PDGF-C antagonist that administration is suppressed the amount of PDGF-C in tumor cell invasion normal populations process.

73. a method for the treatment of mammalian hair fiber sex change symptom comprises the PDGF-C antagonist that administration is suppressed the amount of PDGF-C.

74. according to the described method of claim 73, wherein said fibrosis symptom is found in lung, kidney or liver.

Images