CN1166776C - Human vascular IBP-like growth factor - Google Patents

Abstract

The present invention discloses a human vascular IBP-like growth factor polypeptide (VIGF), DNA (RNA) used for encoding the polypeptide, and a method of producing the polypeptide through a recombination technique. The present invention also discloses a method of using the polypeptide for the wound healing or the tissue regeneration, promoting the implant fixation and the vasifaction. The present invention also discloses an antagonist against the polypeptide and the application of the antagonist which is used as a therapeutical agent of the atherosclerosis, the tumours and the cicatrization. In addition, the present invention also discloses a diagnostic measuring method of identifying mutations in VIGF nucleotide sequence and the alteration level of the VIGF polypeptide. The present invention particularly relates to the application of diagnosing vascular diseases or forming relevant neovascularization with tumors of a VIGF antibody.

Description

Human vascular IBP-like growth factor preparation is used for diagnosing vascular disease or forms the application of the diagnostic reagent of relevant neovascularization with tumour

The application is that Chinese application number is the dividing an application for the Chinese patent application of " human vascular IBP-like growth factor " that 94195229.0 (corresponding to PCT application number PCT/US94/14388), the applying date be on December 9th, 1994, denomination of invention.

Technical field

The present invention relates to the purposes of polynucleotide, polypeptide, this polynucleotide and polypeptide of up-to-date discriminating and the production method of this polynucleotide and polypeptide by this polynucleotide encoding.The present invention also relates to suppress the method for this peptide species effect.

Background technology

A family of polypeptide of the present invention and growth regulator (comprise cef 10/cyr 61, Connective Tissue Growth Factor (CTGF) and nov) and insulin-like growth factor binding proteins (IBP) family (regulating the activity of rhIGF-1 (IGF)) relevant.Express at vascular cell-type (cell-type) camber with the corresponding mRNA of polypeptide of the present invention, therefore, hereinafter claim this peptide species behaviour blood vessel IBP like growth factor or " VIGF ".

Somatomedin and other mitogen (comprising oncogene) can promptly induce by the complicated gene of a cover of some cell expressing (Lau, L.F. and Nathans, D., the cell of molecular level is regulated, 1991,6:165-202).These genes (called after immediate early gene or primary-response gene) are with after a kind of somatomedin or mitogen contact, can be activated in several minutes and transcribe, it does not rely on from the extracellular protein of synthetic these immediate early gene coding secretion property of noggin, these albumen play coordinative role (Ryseck to bioprocess such as differentiation, propagation, regeneration and the wound healing of complexity, R.P. etc., the cell Growth and Differentiation, 1991,2:235-233).

The height correlation albumen that belongs to this secreting property of component extracellular protein comprises that the cef 10 of chicken, this albumen are the oncogene pp60 in virus ^V-STCFind after inducing (Simmons, D.L. etc., PNAS, the U.S., 1989,86:1178-1182).A kind of closely related protein, cyr 61, serum or Thr6 PDGF BB (PDGF) can activate rapidly it (O ' Brien, T.P. etc., molecular cytobiology, 1990,10:3569-3577).All amino acid whose identity properties are up to 83% between cef 10 and the cyr 61.The 3rd member of this family be human Connective Tissue Growth Factor (CTGF) (cytobiology is assorted for Bradham, D.M. etc., 1991,114:1285-1294).CTGF is a kind of polypeptide that is rich in halfcystine, and human vascular endothelial cell can be secreted this peptide species high-levelly after activating with transforming growth factor-beta (TGF-β).CTGF shown the biology of class PDGF and immunologic competence and and PDGF compete a kind of surface receptor of specific cell.

The 4th member of this early protein immediately family is fisp-12, serum can induce this albumen to produce and with its mapping in a zone of musculus cdna group (Ryseck, R.P. etc., the cell Growth and Differentiation, 1991,2:235-233).Another member of this family is chicken gene nov, and this gene obtains in sophisticated nephrocyte usually, and finds its overexpression in myeloblastemia correlated virus 1 type inductive nephroblastoma.

The expression product of these immediate early genes serves as third messenger in the cascade reaction that somatomedin triggers.It is generally acknowledged that integrating and coordinate complicated bioprocess (as with cell proliferation being the differentiation and the wound healing process of joint activity) also needs these expression of gene products.

This emerging growth regulator family is called as CCN family, and this family is made up of CTGF, cef IO/cyr 61 and nov.VIGF polypeptide of the present invention is considered to a member of this growth regulator family.The VIGF polypeptide also comprises one section and the conjugated protein height homologous of rhIGF-1 (IGF) halfcystine sequence.

At least two kinds of different conjugated proteins in the HAS, have been differentiated, i.e. IGF-conjugated protein 53 and IGF-conjugated protein 1.IGF-is conjugated protein to have retarding effect again to the existing stimulatory effect of IGF.Clemmonsetal ( J.Clin.Invest., 77:1548 (1986)) etc. studies show that inoblast and smooth muscle cell surface IGF acceptor with its conjugated protein compound tense in conjunction with increase.Shown IGF-conjugated protein external to various IGF active restraining effect, this effect comprise the glucose transport that stimulates adipocyte, chondrocyte's vitriol and close with inoblast in thymidine and close that (Zapf is etc., J.Clin.Invest., 1979,63:1077).In addition, studies show that the MA of the conjugated protein confrontation somatomedin of IGF-mediation is inhibited.

Summary of the invention

According to one aspect of the present invention, the invention provides new mature polypeptide (it is VIGF) and bioactive and its diagnosis is gone up or useful fragment, analogue and derivative gone up in treatment.

According to another aspect of the present invention, the invention provides the isolated nucleic acid molecule of the human VIGF of coding, comprise mRNA, DNA, cDNA, genomic dna with and analogue and biologic activity go up with diagnosis or useful fragment and derivative gone up in treatment.

According to another aspect of the present invention, the invention provides the method that produces said polypeptide by recombinant technology, this method is included under the condition that helps said protein expression and reclaim subsequently, cultivates the reorganization protokaryon and/or the eukaryotic host cell that contain human VIGF nucleotide sequence.

According to another aspect of the present invention, the invention provides the method that the polynucleotide of this peptide species or this peptide species of encoding are used for the treatment of, for example treat muscle and consume disease (muscle wasting disease) and osteoporosis, help implant to fix, stimulate wound healing or tissue regeneration, promotion vascularization, promote vascular smooth muscle propagation and endotheliocyte to produce.

According to another aspect of the present invention, the invention provides the antibody of this peptide species.

According to another aspect of the present invention, the invention provides the antagonist of this peptide species, it can be used for suppressing the effect of this peptide species, for example generation of the excessive reticular tissue of restriction during wound healing or lung fibrosis.

According to another aspect of the present invention, the present invention also provides and has comprised nucleic acid probe sufficient length and the nucleic acid molecule hybridization of VIGF sequence-specific.

According to another aspect of the present invention, the invention provides detect not enough with the VIGF expression of polypeptides and expression is excessive and the nucleotide sequence of this peptide species of encoding in the diagnostic measurement method of the relevant disease of sudden change.

From the instruction of this paper, those skilled in the art can know these and other aspect of the present invention.

Description of drawings

Following figure is used for illustrating embodiment of the present invention, and has no intention to be used for limiting the included scope of claim of the present invention.

Fig. 1 shows the cDNA and the corresponding deduced amino acid of VIGF polypeptide.21 leader sequences that amino acid represent is inferred of beginning, like this, sophisticated polypeptide is made up of 163 amino acid.Amino acid is represented in single-letter abbreviation with standard.Use 373 automated DNA sequenators (Applied Biosystems, Inc.) to check order.Estimate that the order-checking tolerance range surpasses 97%.

Fig. 2 has shown the homology of aminoacid sequence between VIGF and other albumen of CCN family.

Fig. 3 is a kind of SDS-polyacrylamide gel, and it has shown VIGF bacteria purification and electrophoretic result.

Fig. 4 is a kind of gel, has shown the Northern hybridization analysis result of VIGF.

Fig. 5 is a kind of gel, has shown the cell type analytical results of VIGF genetic expression in listed different tissues.Road 1 is a huve cell, and road 2 is aortic smooth muscle cells, and road 3 is corium foreskin inoblasts.Fig. 5 A reveals the result who puts after 2 hours, and Fig. 5 B reveals the result who puts after 36 hours.

Specific embodiments

According to one aspect of the present invention, the invention provides a kind of isolating nucleic acid (polynucleotide), this nucleic acid encoding have Fig. 1 deduced amino acid mature polypeptide or by mature polypeptide with the cDNA clones coding of preserving number ATCC 75874 (on August 25th, 1994) preservation.

Can from human umbilical vein and aortic endothelial cell, aortic smooth muscle cell, pulmonary artery, obtain the polynucleotide of code book invention polypeptide.In human umbilical vein endothelial cell cDNA library, polynucleotide of the present invention have been found.It is structurally relevant with CCN family with IBP.It comprises the proteic open reading frame that a coding has 184 amino-acid residues, and wherein approximately 21 initial amino-acid residues are the leader sequences of inferring, and like this, this sophisticated albumen comprises 163 seed amino acids.

As the sign of the hybridization member's of two families of CCN somatomedin and IBP VIGF mainly based on the conservative property of aminoacid sequence.Infer the similarity of VIGF and CCN family by the similarity (18 halfcystines of whole VIGF have 12 and guard) of 40-45% on VIGF and the CCN family whole piece polypeptide and the identity property of IBP character zone (GCGCCXXCAXXXXXXC) 94% (this IBP feature is quite conservative) in all members of CCN family.

Also there are tangible similarity in VIGF polypeptide and IBP family.In 30-44 (IBP characteristic area) and two proximities of 55-69 amino acid, has 80% identity property at least with IBP family.These districts are included in the IBPs IGF land of inferring.By Northern hybridization analysis method, determined human tissue and cell-type specific expression.The method of use embodiment 4 has been located the VLGF mRNA of 2.3-2.4kb in adult's lung and kidney.In heart, human brain, placenta, liver, skeletal muscle and pancreas, do not find the VIGF expression of gene.Human umbilical vein endothelium of cultivating and aortic smooth muscle cell are cell-types of energy high level expression VLGF mRNA, and the fibroblastic expression level of the foreskin of corium is then very low.Generally speaking, these results show that VIGF mainly is the blood vessel origin.

Polynucleotide of the present invention can be rna form or dna form, and wherein DNA comprises cDNA, genomic dna and synthetic DNA.This DNA can be two strands or strand, if strand can be coding strand or non-coding (antisense) chain.The encoding sequence of this encoding mature polypeptide can be identical with clone's shown in Figure 1 or preservation encoding sequence; Because the Feng Yu or the degeneracy of genetic code, this encoding sequence also can be a kind of different encoding sequence, the identical mature polypeptide of cDNA coding of the DNA of its energy and Fig. 1 or preservation.

The mature polypeptide of code pattern 1 or coding can be comprised by the polynucleotide of the mature polypeptide of the cDNA coding of preservation: the encoding sequence that only is the encoding mature polypeptide; The encoding sequence of encoding mature polypeptide and additional encoding sequence are as leading or secretion sequence or preceding protein sequence; Encoding sequence of encoding mature polypeptide (with having or not having an additional encoding sequence) and non-coding sequence are as the encoding sequence 5 of intron or encoding mature polypeptide ' and/or the non-coding sequence of 3 ' end.

Like this, " polynucleotide of coded polypeptide " this term comprises polynucleotide that only contain polypeptid coding sequence and the polynucleotide that also contain additional coding and/or non-coding sequence.

The invention still further relates to above-described polynucleotide variant, this variant coding have Fig. 1 deduced amino acid polypeptide or by fragment, analogue and the derivative of the polypeptide of the cDNA clones coding of preservation.The polynucleotide variant that polynucleotide allelic variant that this polynucleotide variant can be natural generation or non-natural produce.

Like this, the present invention includes coding as shown in Figure 1 mature polypeptide or by the polynucleotide of the mature polypeptide of the cDNA clones coding of preservation, and coding as shown in Figure 1 mature polypeptide or by the polynucleotide variant of fragment, analogue and the derivative of the mature polypeptide of the cDNA clones coding of preservation.These nucleotide variants comprise disappearance variant, replacement variant, interpolation or insert variant.

As above indicated, this polynucleotide can have the encoding sequence of allelic variant of natural generation of clone's shown in Fig. 1 or preservation encoding sequence.Allelic variant is the another kind of form of polynucleotide sequence as you know in this area, and polynucleotide sequence can have replacement, disappearance or the interpolation of one or more Nucleotide, and this can be from not changing the function of coded polypeptide in fact.

The present invention also comprises such polynucleotide, the sequence of wherein said encoding mature polypeptide can be integrated into polynucleotide sequence in identical reading frame, this polynucleotide sequence helps polypeptide expression and secretion in the host cell, such as has the transhipment of polypeptide in the leader sequence control cell of secretion sequence function.Polypeptide with leader sequence is preceding albumen (preprotein), and host cell excises this leader sequence and forms sophisticated polypeptide form.This polynucleotide are proteins encoded former (proprotein) also, and this proteinogen is the maturation protein that 5 ' end has additional amino-acid residue.Maturation protein with sequence former (prosequence) is a proteinogen, is a kind of albumen form of non-activity.The excision presequence, what stay is activated maturation protein.

Like this, can encode a kind of maturation protein or the albumen or the former albumen that presequence (presequence) (leader sequence) is arranged again of existing sequence of presequence are arranged of polynucleotide of the present invention.

Polynucleotide of the present invention also can have the encoding sequence that is integrated into flag sequence in the frame, described flag sequence makes can purifying polynucleotide of the present invention, under the situation of host bacterium, described flag sequence can be to carry six histidine marks that provide by pQE-9, it makes that the mature polypeptide be integrated into mark can purifying, perhaps for example when using mammalian cell (as the COS-7 cell), flag sequence can be hemagglutinin (HA).Said hemagglutination mark corresponding to come from the proteinic epi-position of influenza hemagglutinin (Wilson, I., etc., cell, 37:767 (1984)).

The invention still further relates to and the polynucleotide (, preferably having 70% identity) of sequence hybridization described above if having at least 50% between two sequences.The present invention be more particularly directed under stringent condition polynucleotide with above-described multi-nucleotide hybrid.As used herein, term " stringent condition " refers to only have at least 95% between sequence, and hybridization just can take place when preferably having 97% identity.In a preferred embodiment, hybridize to the such peptide species of polynucleotide encoding on the above-described polynucleotide, it keeps in fact and identical biological function or the activity of mature polypeptide by the cDNA coding of the cDNA of Fig. 1 or preservation.

The mentioned preservation thing of this paper was preserved in American type culture collection (ATCC), preserving number ATCC75874 on August 25th, 1994 according to being specified in of microbial preservation budapest treaty of the international recognition that is used for patented procedure.

These keep thing only is in order to provide convenience to those skilled in the art, is not 112 required preservations of 35 U.S.C.Be included in the described preserved material polynucleotide sequence and by its amino acid sequence coded this paper reference in the lump, and be used to solve any contradiction on this paper sequence description, any manufacturing to preserved material, using or selling needs not give any such permission through permission at this.

The invention still further relates to the VIGF polypeptide of deduced amino acid or have VIGF polypeptide by the cDNA amino acid sequence coded of preservation with Fig. 1, and the fragment of this peptide species, analogue and derivative.

Term " fragment ", " derivative " and " analogue " during when the polypeptide of relevant Fig. 1 or by the cDNA encoded polypeptides of preservation, refer to the biological function or the active polypeptide that keep identical with such polypeptide basically.

Polypeptide of the present invention can be a recombinant polypeptide, natural polypeptides or synthetic polypeptide, preferably recombinant polypeptide.

Said Fig. 1's or can be by fragment, derivative or the analogue of the cDNA encoded polypeptides of preservation: (I) a kind of like this, wherein one or more amino-acid residues can be to be encoded by genetic codon by amino acid that conservative or non-conservative amino acid residues (preferably conservative amino acid residues) replace and replace.Perhaps (II) is a kind of like this, wherein one or more amino-acid residues comprise substituting group, perhaps (III) is a kind of like this, wherein mature polypeptide and another kind of compound merge, described compound is as increasing the compound (for example polyethylene glycol) of polypeptide transformation period, perhaps (IV) is a kind of like this, and wherein additional amino acid is integrated into mature polypeptide, and it is used for the purifying mature polypeptide.By the elaboration of this paper, such fragment, derivative and analogue are considered within those skilled in the art's ken.

The present invention preferably provides the polypeptide and the polynucleotide of divergence type, simultaneously the preferred purifying of polypeptide and polynucleotide is become homogeneous.

Term " isolating " means described material and has broken away from its primal environment (for example, natural surroundings is if it is natural generation).For example, a kind of polynucleotide or polypeptide that is present in the natural generation in the animal alive is not isolating, but with natural system in the material of some or all coexistence identical polynucleotide or the polypeptide that separate be isolating.Such polynucleotide can be that the part of carrier and/or such polynucleotide or polypeptide can be the parts of composition, if this carrier or composition be not its natural surroundings a part its remain isolating.

The present invention also relates to comprise the carrier of polynucleotide of the present invention and the host cell that produces through genetically engineered with carrier of the present invention, and the method that produces polypeptide of the present invention through recombinant technology.

Host cell produces (transduction, conversion or transfection) with carrier of the present invention through genetically engineered, and said carrier can be cloning vector or expression vector, and this carrier for example can be, forms such as plasmid, virion phage.Said engineering host cell can be in the cultivation in the conventional nutritional medium of modifying, and described substratum is modified to such an extent that be suitable for activating promotor, selects transformant or amplification VIGF gene.Culture condition, for example pH value and temperature etc. are to be used to select those of the host cell of expressing in the past.To those of ordinary skill is conspicuous.

Polynucleotide of the present invention can be used for producing polypeptide through recombinant technology.Like this, for example, polynucleotide can be included in expression vector any of various express polypeptides.Such carrier comprises karyomit(e), non-chromosome and synthetic dna sequence dna, for example simian virus 40 derivative; Bacterial plasmid; Phage DNA; Baculovirus; Yeast plasmid; From plasmid and phage DNA combination deutero-carrier; Viral DNA (as cowpox, adenovirus, fowl avipoxvirus, and pseudorabies virus).Yet any other carrier also can use, as long as it is reproducible and stable in the host.

Can suitable dna sequence dna be inserted in the carrier with several different methods.In general, with methods known in the art dna sequence dna is inserted into suitable restriction endonuclease site.Such method and other method are considered in those skilled in the art's ken.

Said dna sequence dna in expression vector can effectively be connected on the suitable expression control sequenc (promotor), and is synthetic to instruct mRNA.The representative example of such promotor can should be mentioned that: LTR or simian virus 40 promotor, intestinal bacteria, lac or trp, phage P _LPromotor and known other promotor that controlling gene is expressed in protokaryon or eukaryotic cell or their virus.Said expression vector also comprises the ribosome bind site that is used for translation initiation and Transcription Termination.This carrier also can comprise the suitable sequence of expressing for amplification.

In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic characteristic of transformed host cells, Tetrahydrofolate dehydrogenase or the neomycin resistance cultivated of eukaryotic cell for example, or tsiklomitsin and the amicillin resistance in the intestinal bacteria for example.

Comprise above-described suitable dna sequence dna and suitable promotor or the carrier of control sequence and can be used to change suitable host, so that it can marking protein.

As the representative example of suitable host, can should be mentioned that here: bacterial cell, as intestinal bacteria, streptomycete, Salmonella typhimurium; The fungal cell is as yeast; Insect cell such as fruit bat S2 and Sf9; Zooblast such as CHO, COS or Bowes melanoma; Adenovirus; Vegetable cell, etc.By the elaboration of this paper, suitable host's selection is considered within those skilled in the art's ken.

More particularly, the present invention also comprises recombinant precursor, and this construct comprises above broadly described one or more sequences.This construct comprises carrier, and the carrier as plasmid or virus has wherein inserted sequence of the present invention forward or backwards.Under the even more ideal situation of this embodiment, construct also comprises the adjusting sequence that can effectively be connected on the described sequence, comprise, for example, promotor.A large amount of carrier and promotors that are fit to are well known by persons skilled in the art, and are obtainable by commercial sources.Provide following carrier by way of example.Bacterium: pQE70, pQE60, pQE-9 (Qiagen), pBS, pD10, phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene), ptrc99a, pKK223-3, pKK233-3, pDR540, pRITS (Pharmaca).Eucaryon: pWLNEO, pSV2CAT, pOG44, pXT1, pSG (Stratagene), pSVK3, pBPV, pMSG, pSVL (Parmacia).Yet any other plasmid or carrier as long as they are reproducible and stable in the host, can use.

Can be with CAT (gene of CAT) carrier or other carrier that has selected marker from any required gene Selection promoter region.Two kinds of suitable carriers are PKK232-8 and PCM7.The bacterium promotor of mentioning especially comprises lacI, lacZ, T3, T7, gpt, λ P _R, P _L, and trp.Promoter in eukaryote comprises that CMV is early stage immediately, HSV thymidine kinase, early stage and complete SV40, derive from retroviral LTRs and mouse metallothionein(MT)-F.To the selection health of appropriate carriers and promotor within the level of common skill this area.

In another embodiment, the present invention relates to comprise the host cell of the above construct.Said host cell can be a higher eucaryotic cells, as mammalian cell, or eukaryotic cell such as low, as yeast cell, perhaps host cell can be a prokaryotic cell prokaryocyte, as bacterial cell.Can be by the transfection of calcium phosphate transfection, DEAE-dextran mediation, or electroporation is incorporated into construct (Davis, L., Dibner, M., Battey, I., the basic skills in the molecular biology, (1986)) in the host cell effectively.

Construct in the host cell can be used for producing in a usual manner the gene product by the recombination sequence coding.In addition, polypeptide of the present invention can be produced by conventional peptide synthesizer is synthetic.

Mature protein can be at mammalian cell, yeast, and bacterium, or express in other cell under the control of suitable promotor is adopted the RNA that derives from DNA construct of the present invention, and cell free translation system also can be used for producing this protein.Sambrook etc., molecular cloning: laboratory manual, second edition, the cold spring port, N.Y., (1989) (this paper is reference in the lump) described with protokaryon and eucaryon host and used suitable clone and expression vector.

The encode enhancer sequence that is inserted in the carrier of transcribing of DNA of polypeptide of the present invention of higher organism strengthens.Enhanser is the cis-acting elements of DNA, and usually about 10 to 300bp, and acting on increases it and transcribe on the promotor.Example comprises the simian virus 40 enhanser on the replication orgin rear side 100 to 270bp, cytomegalovirus early promoter enhanser, polyoma enhanser on the replication orgin rear side and adenovirus enhanser.

Usually, recombinant expression vector comprises replication orgin and allows the selected marker (for example, the ampicillin resistance gene of intestinal bacteria and Saccharomyces cerevisiae TRP1 gene) of host cell conversion and the promotor that instructs the downstream configurations genetic transcription that comes from cance high-expression gene.Such promotor can be come own coding glycolytic ferment (for example glycerol 3-phosphate acid kinase (PGK)), α-factor, the operon of acid phosphatase or heat shock protein etc.The allos structure sequence is in suitable stage and translation initiation and terminator sequence assembling, and preferably, the leader sequence that advances periplasmic space or extracellular substratum with the protein secreting that can instruct translation assembles.Heterologous sequence can be also encoding fusion protein not, comprise the terminal peptide of differentiating of the N-that gives required feature, required feature for example, the recombinant products of expression is stable or purifying is simple.

By with the reading operated with functional promotor mutually the suitable translation initiation in (poerable reading phase) and the termination signal structural DNA sequence construct that inserts the coding desired protein together be used for the useful expression vector of bacterium.Said carrier comprises one or more Phenotypic Selection marks and replication orgin, with the maintenance that guarantees carrier with amplification is provided in the host when appropriate.The prokaryotic hosts that be fit to transform comprises the intestinal bacteria subtilis, Salmonella typhimurium, Rhodopseudomonas, each kind of streptomyces and Staphylococcus, though other also can select use.

As one representational but be not restrictive example, the useful expression vector that is used for bacterium can comprise selected marker and the bacterium replication orgin that comes from commercially available plasmid (genetic elements that comprises well-known cloning vector pBR322 (ATCC37017)).Commercially available carrier like this comprises, for example, and pKK223-3 (Pharmacia Fine chemical company, Vppsala, Sweden) and GEM1 (Promega Biotec, Madison, WI, the U.S.).These pBR322 " skeleton " fragment and suitable promotor and structure sequence combination to be expressed.

Transform and appropriate host strain growth extremely after the suitable cell density at the appropriate host bacterial strain, induce the promotor of selection with suitable method (for example temperature inversion or chemical induction), other for some time of cell cultures.

Typically,, keep formed crude product to be used for further purifying through physics or chemical process smudge cells through centrifugal cell harvesting.

Can be used for the microorganism cells of marking protein through the method fragmentation of any routine, described method comprises to be freezed-thaw cycles, sonication, and Mechanical Crushing or use lysis agent, these methods those skilled in the art will know that.

Various mammalian cell culture systems also can be used for the express recombinant body protein.The example of mammalian expression system comprises by Gluzman, cell, and 23:175 (1981), the monkey kidney inoblast COS-7 clone of description and other can be expressed the clone of compatible carrier, for example, C127,3T3, CHO, HeLa and bhk cell system.Mammiferous expression vector comprises replication orgin, and suitable promotor and enhanser also can comprise any essential ribosome bind site, polyadenylation site, donor splicing site and acceptor site, transcription termination sequence and 5 ' flank non-transcribed sequence.The dna sequence dna that derives from SV40 montage and polyadenylation site can be used to provide required non-transcribed genetic elements.

Said VIGF polypeptide can reclaim and purifying from the reconstitution cell culture with several different methods, and described method comprises ammonium sulfate or ethanol sedimentation, sour extraction, negatively charged ion or cation-exchange chromatography, phosphorus Mierocrystalline cellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography and Sugar receptors chromatography.In finishing the configuration of mature protein, can use the protein refolding step when needing.At last, can use high performance liquid chromatography (HPLC) as last purification step.

Polypeptide of the present invention can be the product of natural purifying, or the product of chemical synthesis process, produces from protokaryon or eucaryon host (for example bacterium, yeast, higher plant, the insect of cultivation and mammalian cell) through recombinant technology.According to the host that reorganization is used in the production method, polypeptide of the present invention can be glycosylated maybe can be nonglycosylated.Polypeptide of the present invention also can comprise the initial methionine amino-acid residue.

VIGF polypeptide of the present invention can be used for wound healing with the relevant therapy of tissue (as reticular tissue, skin, bone, cartilage, muscle, lung or kidney) regeneration.

Can promote to have the vascular smooth muscle of stimulation vascularization effect and the growth of endotheliocyte with VIGF polypeptide of the present invention.The increase of VIGF in the vascularization process of mediation helps the ischemic tissue of crown narrow heart and the growth of attached crown tissue.

Also can utilize the VIGF polypeptide to stimulate the growth of implant peripheral cell, thereby help implant and tiing up in predetermined site.

Also can utilize the VIGF polypeptide to increase in the tissue or serum I GF stability.Also can increase the combination of itself and IGF acceptor.Since shown the growth that IGF can improve human marrow red corpuscle and granulocyte progenitor cell under the isolated condition, therefore also can utilize the VIGF polypeptide to stimulate erythropoiesis or granulocyte to generate.

According to another aspect of the present invention, the polynucleotide that the invention provides this peptide species or this peptide species of encoding are as external scientific research, DNA is synthetic, dna vector is made research reagent, and are used for developing to the useful therapeutics of human disease treatment and the method for diagnostics.

The fragment of total length VIGF gene can be used for separating total length VIGF gene and with the VIGF gene sequence similarity or similar bioactive other gene highly be arranged as the hybridization probe in cDNA library.Such probe can be for example between 20 to 20000 bases.Yet preferred probes is between 30 to 50 base pairs.Said probe also can be used to differentiate corresponding to total length transcript and genomic clone or comprise adjusting and promoter region, exon and intron the cDNA of interior complete gene clone clone.The embodiment of screening comprises the coding region that utilizes known dna sequence to separate the VIGF gene, with synthetic oligonucleotide probe.The complementary sequence of the oligonucleotide tool gene of the present invention of mark can be used for screening human cDNA library, genomic dna or mRNA, to determine probe and which library member hybridization.

The invention provides the method that is used to differentiate the VIGF acceptor.Can come the gene of the said acceptor of identifier number with many methods well known by persons skilled in the art, as part elutriation and FACS classification (immunology latest draft such as Coligan, the 1 (2), the 5th chapter, (1991)).What preferably use is cloning by expression, and polyadenylic acid RNA wherein is divided into different storehouses to the cDNA library of being created by said RNA, other cell that is used for rotaring redyeing COS cell or VIGF is not responded by the cell preparation to the VIGF response.The transfectional cell that is grown on the slide glass is exposed among the VIGF of mark.VIGF can be with the various means marks that comprise the protein kinase recognition site iodate of specificity site or its inclusion body.Following fixing and cultivate, slide glass is easy to radioautographic analysis.Differentiated positive set, utilized simultaneously and repeat inferior set (iterative sub-pooling) and screen the preparation of (rescreen) method again and transfectant set again that final generation coding is inferred the mono-clonal of acceptor.

As another kind of acceptor discrimination method, mark VIGF can be a photoaffinity, can be connected with the cytolemma or the extract formulation of energy expressed receptor molecule.With PAGE differentiate cross-coupled material and its exposure on the X-ray film.Can cut off the labeled complex that comprises the VIGF-acceptor, resolve into the peptide fragment that is easy to protein micrometering preface.The aminoacid sequence that obtains from the micrometering preface can be used for designing a cover degenerate oligonucleotide probe and be used for the cDNA library of the acceptor gene that identifier number infers with screening.

The present invention also relates to SCREENED COMPOUND to differentiate the method for simulating VIGF (stimulant) or stoping those compounds of VIGF effect.An example of this method utilizes the ability of VIGF stimulating endothelial cell propagation under the situation of mitogen ConA existence altogether.Obtain the human umbilical vein endothelial cell and it is cultivated on the flat culture plate in 96-hole (Costar, Cambridge MA), add being suitable as the reaction mixture that promotes cell proliferation in the cultivation, this mixture comprise ConA (Calbiochem, La Jolla, CA).The Con-A and this compound of screening are added in the substratum, after 37 ℃ of cultivations, in culture, carry with pulse ³[H]-thymus gland glycosides is gathered in the crops culture (PhD simultaneously on glass fibre filter; Cambridge technology, Watertown, MA).Utilize liquid scintillometer to determine triple culture intermediary ³[H]-thymidine binding substances (cpm) (Beekman instrument Irvine, CA).Noticeable ³[H]-thymidine binding substances shows the hormesis to endothelial cell proliferation.

Measure antagonist with above described measuring method, yet in this mensuration, VIGF and SCREENED COMPOUND are added together, under the situation that VIGF exists, this compound suppresses ³[H]-thymidine bonded ability shows that this compound is the antagonist of VIGF.In addition, under the condition that is fit to competitive inhibition mensuration,, detect the antagonist of VIGFD VIGF, potential antagonist and film-bonded VIGF acceptor or recombinant receptor combination.Can mark VIGF, as by radioactivity, like this and the quantity of the VIGF molecule of receptors bind can determine the usefulness of potential antagonist.

Also can be mammiferous cell or expression VIGF receptor membrane preparation, the VIGF with mark under the situation that this compound exists cultivates together.Can measure this compound raising then or block this interactional ability.In addition, VIGF can be natural and IGF bonded condition under, can cultivate IGF and a kind of potential compound of VIGF, mark.Measure this interactional degree, to determine that this compound is effective antagonist or stimulant.

The example of potential VIGF antagonist comprises antibody or is the oligonucleotide that is connected with this polypeptide in some cases.In addition, the potential antagonist can be a kind of closely-related protein, for example, the mutant form of VIGF, it can be discerned the VIGF acceptor but can not transmit influence, and then has suppressed the effect of VIGF competitively.

Another potential antagonist is the antisense constructs that adopts the antisense technology preparation, the expression that antisense technology can come controlling gene by triple helical formation or antisense DNA or RNA, and these two kinds of methods are all based on the combination of polynucleotide and DNA or RNA.For example, the encode 5 ' encoding part of polynucleotide sequence of mature polypeptide of the present invention can be used for the antisense rna oligonucleotide of about 10 to 40 base pairs of design length.A kind of DNA oligonucleotide is designed to and transcribes related gene regions complementation (triple helical-referring to Lee etc., nucleic acids research, 6:3073 (1979); Cooney etc., science, 241:456, (1988); With Dervan etc., science, 251:1360 (1991)), and then stop the generation of transcribing with VIGF.The interior oligonucleotide hybridization of sense-rna body is to mRNA, and the translation becoming of blocking-up mRNA molecule VIGF (antisense-Okano, J.Neurochem., 56:560 (1991); Oligodeoxynucleotide is as the antisense inhibitor (CRC press, Boca Raton, FL (1988)) of genetic expression.Oligonucleotide described above can be sent in the cell, so that can expression in vivo sense-rna and DNA, suppresses the generation of VIGF.

Potential VIGF antagonist comprises small molecules, the avtive spot of these small molecules and polypeptide, receptor binding site, IGF or other somatomedin binding site combination, and then the normal biological activity of blocking-up VIGF.The small molecules example includes but not limited to the molecule of little peptide or class peptide.

Use this antagonist to suppress tumor neogenetic blood vesselsization (neovascularization) and common smooth muscle cell neointimal proliferation in atherosis and restenosis after the air bag revascularization.

The undue generation of the scar tissue that uses antagonist to be suppressed in the keloid to be seen, the fibrosis of this scar surgical operation, myocardial infarction after, or and lung fibrosis associated fiber sex change damage after formation.Antagonist can be used to be combined into composition with pharmaceutically acceptable carrier, and is for example, described below.

VTGF polypeptide of the present invention and stimulant or antagonist can be used in combination with suitable pharmaceutical carrier.Such composition comprises significant quantity and the pharmaceutically acceptable carrier or the vehicle of said polypeptide treatment.Such carrier includes but not limited to salt solution, buffer saline, dextrose, water, glycerine, ethanol and their composition.The mode that its prescription should be suitable for using.

The present invention also provides pharmaceutical pack or test kit, and they comprise one or more containers that are filled with one or more compositions of pharmaceutical composition of the present invention.What be associated with this container can be the bulletin of government organs' defined form of management medicine and biological products manufacturing, use or sale, and this bulletin has reflected manufacturing, use or sold the human agreement that makes the government organs of articles for use.In addition, composition of the present invention can be treated compound with other and is used in combination.

Described pharmaceutical composition can be used in mode easily, and described mode is for example oral, the part, intravenously, intraperitoneal, intramuscular, subcutaneous, in the nose or the intradermal approach use.Said pharmaceutical composition is used with the significant quantity that treats and/or prevents specified disease.In general, they are used with the amount of about at least 10 micrograms/kg body weight, and in most of the cases, they are used with the amount that is no more than about 8 mg/kg body weight every day.Under most applications, consider factors such as route of administration and illness, dosage from every day about 10 microgram/kilograms to 1 mg/kg body weight.

VIGF combines with other somatomedin, can quicken its physiological response, and this point is seen in wound healing.These somatomedins include but not limited to PDGF, IGF, FGF, EGF or TGF-B.

The stimulant of VIGF polypeptide and polypeptide form and antagonist can be used for the such polypeptide of expression in vivo according to the present invention, and this often is known as " gene therapy ".

Like this, for example, can carry out the genetically engineered operation with the polynucleotide (DNA or RNA) of external coded polypeptide to patient's cell, the patient who treats to quilt with engineering cell provides said polypeptide.Such method is well-known in the art.For example, can use the retroviral particle pair cell of the RNA that comprises the polypeptide of the present invention of encoding to carry out the genetically engineered operation through method well known in the art.

Similarly, can carry out the genetically engineered operation by pair cell in the methods known in the art body for example, so that the expression in vivo polypeptide.As known in the art, generation can be comprised that the production cell of retroviral particle of the RNA of the polypeptide of the present invention of encoding is administered to the patient, so that pair cell carries out genetically engineered and handles and the expression in vivo polypeptide in the body.By elaboration of the present invention, it will be apparent to those skilled in the art that by this mode these and other method through using polypeptide of the present invention.For example, the carrier of through engineering approaches cell can not be a retroviral vector, as, with suitable transport carrier and combine after, adenovirus can be used for through engineering approaches cell in the body.

The present invention also relates to the purposes of VIGF gene as diagnostic reagent.The detection of VIGF variant form can diagnose the illness or to the susceptibility of disease, as tumour, since the sudden change of VIGF can cause tumour.

Can on dna level, detect individuality with various technology with people VIGF transgenation.Can obtain diagnostic nucleic acid from patient's cell (as blood, urinate, saliva is organized examination of living tissue and necrotomy material).Genomic dna can be directly used in detection, perhaps uses PCR enzymatic amplification (Saiki etc., nature, 324:163-166 (1986)) before analysis.RNA or cDNA also can be used for identical purpose.As an example, the VIGF sudden change is differentiated and analyzed to the Nucleotide complementary PCR primer of the VIGF that can use and encode.Can be by comparing the variation detection disappearance of amplified production size with normal genotype or inserting.Point mutation can be through DNA and the radiolabeled VIGFRNA or the radiolabeled VIGF antisense dna sequence hybridization discriminating of amplification.Through ribonuclease A digestion, perhaps distinguish perfect paired sequence and mispairing duplex from the difference of melting temperature.

Can finish by detecting when being with or without denaturing agent on the gel change of dna fragmentation electrophoretic mobility based on the genetic test of dna sequence dna difference.Little sequence deletion and insertion can be demonstrated by the high resolving power gel electrophoresis.Not homotactic dna fragmentation can be in the difference on the sex change methane amide gradient gel, the migration of wherein different dna fragmentations according to its specific fusing point or part melt temperature and be stuck in gel different positions (referring to, for example, Myers etc., science, 230:1242 (1985)).

Also can protect assay method to disclose sequence variation on the specific position, described assay method such as ribonuclease protecting and S1 protection and chemical cracking method (for example, Cotton etc., PNAS, the U.S., 85:4397-4401 (1985)) by nuclease.

Like this, can detect specific dna sequence by following method, described method is for example hybridized, ribonuclease protecting, chemical cracking, directly dna sequencing, or the Southern blotting of use restriction enzyme (for example, limited fragment length polymorphism) and genomic dna.

Except that a lot of conventional gel-electrophoresis and dna sequencing method, also available original position analyzing and testing sudden change.

The VIGF protein expression is with vascular disease or form relevant neovascularization with tumour and be associated.VIGF has single chain polypeptide, and mRNA expresses at the endotheliocyte camber simultaneously, and then less in smooth muscle cell, this shows that protein is present in the serum.Therefore, can diagnose vascular disease or form relevant neovascularization with anti-VIGF antibody, because the change level of available polypeptide shows this disorder with tumour.

Can use the competition assay method, wherein the VIGF specific antibody is adsorbed on a kind of solid support, the VIGF of mark passes through said solid support with the sample that derives from host cell, and the detected marker quantity that is adsorbed on the solid support is relevant with VIGF quantity in the sample.

Sequence of the present invention is differentiated also valuable to karyomit(e).The specific position of the single human chromosome of said sequence-specific ground guiding, and hybridization with it.In addition, also need specific site on the differential staining body.Few karyomit(e) sign reagent based on actual sequence data (repetition polymorphism) can be used to the marker chromosomes position now.In those sequences of related and disease related gene, be the important the first step according to chromosomal DNAs mapping of the present invention.

In brief, can map to chromosome sequence by prepare PCR primer (preferably 15-25bp) from cDNA.The Computer Analysis of cDNA is used for selecting rapidly primer, and this primer is not crossed over the exon in the more than one genomic dna, makes amplification method complicated like this.Then, these primers are used for the somatic cell hybrid that the PCR screening comprises independent human chromosome.Only comprise those hybrids generation amplified fragments corresponding to the people's gene of primer.

The PCR mapping of somatic cell hybrid is to specify specific DNA to specific chromosomal fast method.Utilize the present invention and identical Oligonucleolide primers, can obtain inferior location in a similar fashion by one group of specific chromosomal fragment or one group of big genomic clone.Other can be used for the mapping strategy to its chromosome mapping similarly, and described strategy comprises in situ hybridization, with the airflow classification karyomit(e) prescreen of mark with through hybridizing preselected structure chromosome specific-cDNA library.

In a step, the cDNA clone's of Metaphase Chromosome diffusion fluorescence in situ hybridization (FISH) can be used to provide accurate chromosome position.This technology can be used with the cDNA that is as short as 500 or 600 bases; Yet than 2, the clone that 000bp is bigger has bigger possibility and is attached to single chromosome position, and this single chromosome position has for the enough strength of signal that detect.FISH need derive the clone of EST, and the longer the better.For example, 2,000bp is good, 4,000th, better, the rational per-cent that surpasses 4,000 pairs of times that obtain a good result is likely unnecessary.The summary of this technology is referring to Verma etc., human chromosome: basic fundamental handbook, Pergamon press, New York (1988).

In case sequence accurately navigates to chromosome position, the physical location of the sequence on the karyomit(e) just can with the genetic map data association.Such data can be at for example V.McKusick, finds in the Mendelian inheritance in the people (can connect on the Welch of the JohnsHopkins university medical science library and use).Then, gene and the mutual relationship that navigated between the disease of identical chromosomal region are differentiated through linkage analysis (the common heredity of physics contiguous gene).

Then, be necessary determine to infect and the difference in cDNA or the genome sequence between the infected individuals not.If observe sudden change in some or all infected individuals, but do not observe in any normal individual, then, described sudden change is likely the cause of disease of disease.

Adopt the physical mapping and the genetic mapping technology of existing resolving power, accurately navigate to and the chromosomal region of disease-related on cDNA be one (this supposes 1 megabasse mapping resolving power, gene of every 20kb) of the pathogenic gene between 50 and 500.

Said polypeptide, its fragment or derivative or analogue, or the cell of expressing them can produce antibody thus as immunogen.These antibody for example can be, polyclone or monoclonal antibody.That the present invention also comprises is chimeric, the antibody and the Fab fragment of strand and peopleization, or the product of Fab expression library.The whole bag of tricks as known in the art can be used to produce such antibody and fragment.

Can be by using polypeptide acquisition generation at antibody corresponding to polypeptide of sequence of the present invention to animal direct injection polypeptide or to animal (preferably non-human animal).The antibodies polypeptide itself that obtains like this then.In such a way, even a fragments sequence of coded polypeptide also can be used to produce in conjunction with all natural polypeptide antibody.With this antibody isolated polypeptide from the tissue of express polypeptide.

For MONOCLONAL ANTIBODIES SPECIFIC FOR, can use any technology that the antibody that is produced by the continuous cell line culture is provided.Example comprises hybridoma technology (Kohler and Milstein, 1975, nature, 256:495-497), said three knurl technology, people B-quadroma technology (Kozbor etc., 1983, current immunology is 4:72) with the Epstein-Barr virus-hybridoma technology (Cole that produces human monoclonal antibodies, Deng, 1985, monoclonal antibody and cancer therapy, Alan R.Liss, company, pp.77-96).

The technology (United States Patent (USP) 4,946,778) that relevant generation single-chain antibody is described can adopt the single-chain antibody that produces at immunogenic polypeptide product of the present invention.Also can utilize transgenic mouse to express the antibody that is directed to immunogenic polypeptide product peopleization of the present invention.

Further describe the present invention with reference to following examples.Yet should know and the invention is not restricted to these embodiment.Unless specialize, all marks or quantity all refer to weight.

In order to help understanding the following example, method and/or term that some often occur are described below.

" plasmid " specified by the small letter p of front and/or follow-up capitalization and/or numeral.The initial plasmid of this paper be commercially available, the unconfined public obtainable or can be by published method from obtainable plasmid construction.In addition, the plasmid that is equal to of described plasmid is well known in the art, and is conspicuous to those of ordinary skill.

DNA's " digestion " refer to that with restriction enzyme catalyze cleavage DNA, this restriction enzyme only acts on the certain sequence of DNA.The all various restriction enzymes of the present invention are commercially available, use their reaction conditions, the knowledge that cofactor and other need should be appreciated that as those of ordinary skill.For the purpose of analyzing, usually be the enzyme that in about 20 microlitre damping fluids, uses 1 microgram plasmid or dna fragmentation and about 2 units.For the segmental purpose of plasmid construction body DNA isolation, usually be in comparatively large vol with enzymic digestion 5 to 50 micrograms of DNA of 20 to 250 units.The damping fluid that the specific limited enzyme is adopted and the amount of substrate are stipulated by the producer.Usually use 37 ℃ of about incubation times of 1 hour, but can change according to supplier's explanation.Digestion after, reactant directly on polyacrylamide gel electrophoresis to separate required fragment.

With Goeddel etc., nucleic acids research, 8% polyacrylamide gel that 8:4057 (1980) describes carries out the size separation of cutting fragment.

" oligonucleotide " refers to strand poly deoxynucleosides or two complementary poly deoxynucleosides chains, and it can be chemosynthesis.The synthetic oligonucleotide does not have 5 ' phosphate like this, and when not adding the phosphoric acid salt that has ATP simultaneously in the presence of kinases, it does not connect another oligonucleotide.The synthetic oligonucleotide will connect does not have dephosphorylized fragment.

" connection " refers between two double stranded nucleic acid fragments to form the process of phosphodiester bond, and (Maniatis, T. is etc., Id., p.145).Unless alternate manner is provided, can adopts known damping fluid to be connected with dna fragmentation to be connected 10 T4 of the unit dna ligases (" ligase enzyme ") of condition with the about equimolar amount of per 0.5 microgram.

Unless other explanation is arranged, press Graham, F. and van der Eb, A., virusology, the description of 52:456-457 (1973) transforms.

Embodiment 1

The bacterial expression of VIGF and purifying

Use corresponding to the PCR Oligonucleolide primers of 5 ' sequence of finished VIGF protein (negative strand peptide sequence) and the dna sequence dna of VIGF genophore sequence 3 ' initial amplification coding VIGF, ATCC#75874.

Additional nucleotide corresponding to VIGF joined respectively in 5 ' and 3 ' the sequence.Has 5 ' CGCAAGCTTA AATThe Oligonucleolide primers of AATTATGCGGTGGACTGC 3 ' sequence comprises a HindIII restriction endonuclease sites (adding black base sequence), after connect from 21 Nucleotide of the initial VIGF encoding sequence of the proteinic end amino acid codon of supposition processing (underscoring).Oligonucleolide primers 5 ' the CGCTCTAGA of 3 ' end TCAGCGTGGATTTAACCA 3 ' contains an Xba I restriction endonuclease sites (adding black base sequence), and reverse complementary sequence and translation stop codon (underscore) corresponding to 5 amino acid whose Nucleotide of said C-terminal are arranged thereafter.Said restriction endonuclease sites is equivalent to bacterial expression vector pQE-9 (Qiagen, Chatsworth company, CA) restriction endonuclease sites.PQE-9 coding antibiotics resistance (Amp ^r), bacterium replication orgin (ori), IPTG-regulate promotor operon (P/O), ribosome bind site (RBS), 6-histidine mark and restriction endonuclease sites.

With Hind III and Xba I digestion VIGF PCR product and pQE-9, use the T4DNA ligase enzyme then, they are linked together.Required recombinant chou will comprise VIGF encoding sequence and the ribosome bind site that inserts from the downstream in encoding histidine marker site.Press Sambrook J. etc., molecular cloning: laboratory manual, press of cold spring harbor laboratory, the method for describing in (1989) is with connecting mixture transformed into escherichia coli bacterial strain M15[pREP4] (Qiagen, company).M15[pREP4] comprise the plasmid pREP4 of multiple copied, this plasmid expression lacI suppresses son and also gives kalamycin resistance (Kan).Differentiate that by its energy for growth on the LB flat board this transformant selects the bacterium colony of anti-penbritin/kantlex simultaneously.Isolated plasmid dna, and confirm by restriction analysis.(O/N) cultivation of spending the night in the liquid culture of the LB substratum that replenishes Amp (100ug/ milliliter) and Kan (25ug/ milliliter) comprises the clone of required construct.Said O/N culture is used for inoculating a large amount of cultures with 1: 100 to 1: 250 ratio.Make cell grow to optical density(OD) 600 (O.D. between 0.4 and 0.6 ⁶⁰⁰).Add IPTG (sec.-propyl-B-D-sulfur sugar pyranoside) to final concentration 1mM.IPTG suppresses son by deactivation lacI, removes to cause the P/O of the genetic expression that increases to induce.Cell was cultivated 3 to 4 hours in addition, occurred the culture of exponential growth like this.Then by centrifugal cell harvesting.The M15[pREP4 that contains the VIGF/6-Histidine] cell cracking in the solution of 6M GnHCl, pH 8.0.Collect chelating nickel post on the lysate with by effluent.With 6M GnHCl, 50mM NaPO ₄, the pH value is that 8.0,6.0,5.0 solution is washed post.VIGF fusion rotein (＞90% purifying) under wash-out during pH value 2.0.Derive from the sample of pre-column lysate (Fig. 3,2 roads), effluent (3 road), pH value 5.0 elutriants (4 road), pH value 2.0 elutriants (5 road) with Sodium desoxycholate and trichloroacetic acid precipitation.For the purpose of renaturation, the elutriant of pH value 2.0 is adjusted to 3 moles of GnHCl, 100mM phosphoric acid salt sodium, 10mmolar gsh (reductibility) and 2mmolar gsh (oxidisability).In this solution, cultivate after 24 hours, said protein is dialysed to 10mmolar phosphoric acid salt sodium.In order to run glue, the particulate state precipitation is resuspended among the SDS/NaOH and SDS-PAGE of loading buffer liquid thermally denature, electrophoresis on 15% denaturing polyacrylamide gel then.Also electrophoresis Gibco BRL lower molecular weight standard substance (1 road).Show said protein with the coomassie brilliant blue staining agent.Fig. 3 is the SDS-polyacrylamide gel that shows the VIGF purification result.

Embodiment 2

Utilize the baculovirus expression system clone and express VIGF

Dna sequence dna with restriction enzyme PvuII and XbaI digestion coding full length protein.The PvuII of 639 Nucleotide, XbaI fragment comprise whole VIGF coding region, 5 ' and 3 ' the end non-translation DNA of additional 11 and 77 Nucleotide respectively.The F of digestion ₂This fragment is that (La Jolla Ca.) separates from 1% sepharose for " Geneclean ", BIO 101 companies with commercially available reagent box.

Express VIGF protein (summary referring to: Summer, M.D. and Smith, G.E.1987, the method handbook of baculovirus vector and insect cell culturing process, testing station's communique 1555 of Texas's agricultural) with carrier pA2 by bacterial expression system.This expression vector comprises the polyhedrin promotor that the polygonal virus of autographa california multinuclear type (AcMNPV) is powerful, and its back is the recognition site of restriction endonuclease SmaI and XbaI.The polyadenylation site of this monkey disease poison (SV) 40 is used for effective polyadenylation.In order easily to select recombinant virus, colibacillary beta-galactosidase gene is inserted with same direction as the polyhedrin promotor, be thereafter the polyadenylation signal of polyhedron gene.The both sides of polyhedrin sequence are the homology virus sequences of recombinant chou again that is used for the wild-type virus DNA of cell-mediated cotransfection.Can use much other baculovirus vector replacement pA2, and said carrier such as pRG1, pAc373, pVL941 and pAcIM1 (Luckow, V.A. and Summer, M.D., virusology, 170:31-39).

Digest said plasmid with restriction enzyme SmaI and XbaI, utilize calf intestinal phosphatase enzyme to make the plasmid dephosphorylation by methods known in the art then.(La Jolla is Ca.) from 1% sepharose DNA isolation for " Geneclean ", BIO 101 companies to use the commercial reagents box then.This carrier DNA is appointed as V ₂

Connect F with the T4 dna ligase ₂Fragment and said dephosphorylated plasmid.Transformed into escherichia coli strain X LIBlue (Stratagene cloning system then, 11011 North Torrey Pines Road La Jolla, Ca.92037) and utilize enzyme BamHI and XbaI to differentiate the bacterium that contains said plasmid (pBac VIGF) by VIGF cDNA.Confirm the fragments sequence cloned by dna sequencing.

With lipofection (Felgner etc., Proc. Natl. Acad. Sci.USA, 84:7413-7417 (1987)) with 5 μ g plasmid pBac VIGF with commercially available the linearized baculovirus (" BaculoGold of 1.0 μ g ^TMBaculovirus DNA ", Pharmingen, San Diego, CA.) cotransfection.

With 1 μ gBaculoGold ^TM(Life Technologies company, Gaithersburg mix in the aseptic hole of droplet plate MD) containing 50 microlitre serum-free Grace ' s substratum for viral DNA and 5 μ g plasmid pBac VIGF.After adding the substratum of 10 microlitre lipofectin reagents and 90 microlitre Grace ' s, mix to be incorporated under the room temperature and cultivated 15 minutes.Then transfection mixture is dropwise added in the Sf9 insect cell (ATCC CRL1711), said cell inoculation is on the 35mm tissue culture plate with 1ml serum-free Grace ' s substratum.The waggle flat board is to mix the solution of new interpolation.Then flat board was cultivated 5 hours down at 27 ℃.After 5 hours, remove transfection solution, add Grace ' the s insect substratum that 1 microlitre is supplemented with 10% foetal calf serum from flat board.Flat board is put back into incubator, 27 ℃ of following cultured continuously 4 days.

After 4 days, collect supernatant liquor, carry out plaque measurement with similar Summers and the described method of Smith (the same).As a kind of change, (Life Technologies company, Gaithersburg), it makes and is easy to separate the plaque that dyes indigo plant to use the sepharose with " Blue Gal ".(the detailed description of " plaque measurement " also can the insect cell of Life Technologies company (Gaithersburg) issue cultivate and baculovirus users' guidebook 9-10 page or leaf in find).

After four days, the virus of serial dilution is added in the cell, dye blue plaque with Eppendorf pipette tip picking.The agar that will comprise recombinant virus then is suspended in the Eppendcrf pipe that comprises 200 microlitre Grace ' s substratum.Through the brief centrifugal agar of removing, the supernatant liquor that will comprise recombinant baculovirus is used for infecting the Sf9 cell that is inoculated into 35 millimeters culture dish.After 4 days, gather in the crops the supernatant liquor in these culture dish, in 4 ℃ of storages.

The Sf9 cell is grown in the Grace ' substratum that is supplemented with 10% hot deactivation FBS.Infection multiplicity (MOI) 2 times with recombinant baculovirus V-VIGF cells infected.After 6 hours, remove substratum, (Life Technologies company Gaithersburg) substitutes with SF900II substratum (subtracting methionine(Met) and halfcystine).After 42 hours, add 5 μ Ci ³⁵S methionine(Met) and 5 μ Ci ³⁵S halfcystine (Amersham).Before centrifugal results, cell further to be cultivated 16 hours, labelled protein demonstrates through SDS-PAGE and radioautograph.

Embodiment 3

The expression of reorganization VIGF in Chinese hamster ovary celI

Express said VIGF albumen with carrier pN346, plasmid pN346 is plasmid pSV2-dhfr[ATCC 37146] derivative.These two kinds of plasmids all contain the mouse dhfr gene that is subjected to the control of SV40 early promoter.Can select these cells by growth Chinese hamster ovary in the selection substratum that has added the chemotherapeutics methotrexate (alpha-MES, Lift technology) or with active other cell of the shortage dihydrofolic acid of these plasmid transfections.The amplification of DHFR gene in the cell of anti-methotrexate (MTX) reported well (referring to, for example, Alt, F.W., Kellems, R.M., Bertino, J.R., and Schimke, R.T., 1978, journal of biological chemistry, 253:1357-1370, Hamlin, J.L.and Ma, C.1990, Biochem.et Biophys.Acta, 1097:107-143, Page, M.J.and Sydenham, M.A.1991, biotechnology, Vol.9:64-68).The cell that is grown in the substratum that has increased MTX concentration has developed resistance to medicine by the said target enzyme DHFR of excessive generation, and the result makes said DHFR gene amplification.If another gene is connected with said dhfr gene, this gene is total to-amplification and overexpression usually.Then, when removing methotrexate, clone comprises the amplification gene that is incorporated on the said karyomit(e).

Plasmid pN346 comprises and is used for sarcoma virus (Cullen etc., molecule and cytobiology, in March, 1985, the expression part of a powerful promoter gene of length 438-447) terminal repetition (LTR), an additional fragment (Boshart etc. that from the immediate early gene enhanser of the loose virus of human cell (CMV), separate, cell 41:521-530,1985).Said promotor downstream is following single restriction enzyme site, and it makes said gene integration: BamHI, Pvull and Nrul.In three frames, after these coding sites, said plasmid comprises translation stop codon, is thereafter the intron and the polyadenylation site of rat proinsulin protogene.Also can with other efficiently promotor express, for example, the early stage or late promoter of people's beta-actin promotor, said SV40 or to derive from other retroviral length terminal repetition is as HIV and HTLVI.For the polyadenylation of said other signal of mRNA, for example, also the tethelin that can choose and or globin gene.

Also can be according to selecting to carry the stable cell lines that is incorporated into interest genes on the said karyomit(e) with selected marker (as gpt, G418 or Totomycin) cotransfection.During beginning, use not only one selected gene is favourable, as the G418 of additional methotrexate.

Said plasmid pN346 is with restriction enzyme BamHI digestion, then by methods known in the art calf intestinal phosphatase enzyme dephosphorylation.From 1% sepharose, separate said carrier then.

Employing is corresponding to the PCR Oligonucleolide primers amplification coding total length VIGF protein DNA sequence of gene 5 ' and 3 ' sequence, ATCC#75874:

5 ' primer has sequence 5 ' CGCAGATCTCCGCCACC ATGAAGAGCGTCTTGCTGCTG3 ', comprise BglII restriction endonuclease sites (runic), at first be 8 Nucleotide (Kozak of translation initiation useful signal in the similar eukaryotic cell thereafter, M., the molecular biology magazine, 196:947-950, (1987)), remaining Nucleotide is equivalent to 7 amino acid that N-terminal comprises said translation stop codon (underscore).3 ' primer has sequence 5 ' CGCAGATCTAGCCTTCTCTCAGAAATCACA 3 ', comprises restriction endonuclease BglII cleavage site (runic) and 21 Nucleotide of the reverse complemental chain of the 3 ' non-translation DNA of 7 Nucleotide beginning from the sub-downstream of translation stop codon.(" Geneclean " BIO 101 companies, La Jolla is Ca.) from 1% this product of sepharose purifying with BglII digestion PCR product with commercially available test kit.Then with the T4 dna ligase this fragment be connected to BamHI digestion, have on the Phosphoric acid esterase pN346 plasmid.Transform X1LBlue (Stratagene) intestinal bacteria and bed board (containing 50 μ g/ml penbritins) on the LB flat board.At suitable position, the 5 ' primer that is equivalent to sarcoma virus promoter by the PCR method utilization screens the bacterium colony that contains required recombinant chou with the 3 ' primer that is equivalent to the reverse complementary sequence of VIGF codon 73-79.Confirm the sequence of institute's cloned sequence by dna sequencing.

The transfection of CHO-dhfr-cell

Carry out transfection with the Chinese hamster ovary cell that lacks active DHFR enzyme.With lipofection with the plasmid pSVneo cotransfection of said expression plasmid pN346 VIGF 5 μ g with 0.5 μ g.Said plasmid pSV-neo contains a selected marker that dominates, and the gene neo that derives from Tn5 encodes to give and comprises G418 in one group of interior antibiotic resistance, and said cell cultures is in the alpha-MEM substratum that adds 1mg/mlG418.Two days later, with these cells of tryptic digestion and be planted in hybridoma clone dull and stereotyped (Greiner, Germany) and go up and cultivated 10-14 days.After this period, use the tryptic digestion mono-clonal, use the methotrexate (25nM, 50nM, 100nM, 200nM, 400nM) of different concns to be planted in the culture dish of 6-hole then.Then the clone who is grown in the highest methotrexate concentration is transferred in the methotrexate (500Nm, 1 μ M, 2 μ M, 5 μ M) of greater concn.Repeat same method to clonal growth in the concentration of 100 μ M.

Expression by Western engram analysis and the desired gene product of SDS-PAGF methods analyst.

Embodiment 4

With Northern engram analysis method tissue positioned VIGF expression of gene

At Church damping fluid (Church, G.M.﹠amp; Gilbert, W., Proc.Natl.Acad.Sci.USA 81,1991-1995 (1984)) in to organizing Northern trace (Clontech laboratory more, company, 4030 Fabian methods: Palo Alto, California 96303) 60 ℃ of following prehybridizations are 1 hour, and the tissue that comprises in each road has: 2 μ g grow up human brain, heart, placenta, lung, liver, skeletal muscle, kidney and pancreas polyadenylic acid+mRNA.The dna sequence dna of coding VIGF, ATCC 75874, increase from the overall length cDNA that encodes at pBluescript SK (-) with M13 forward (5 ' GGGTTTTCCCAGTCACGAC3 ') and reverse (5 ' ATGCTTCCGGCTCGTATG3 ') primer.The PCR product of 25ng is to use ³²The radiolabeled random primer of P-dCTP (primer-It II, Stratagene cloning system, 11011North Torrey Pine Rd.:La Jolla, California 92037).Thermally denature VIGF probe is directly joined in the prehybridization damping fluid and at 60 ℃ to descend to cultivate 16 hours.Under 60 ℃ in 0.2 * SSC 0.1%SDS wash-out twice, each 10 minutes.Under-80 ℃, carry out autography.

Shine after four days the transcript of visible known 2.3kb (Fig. 4) in lung and kidney.

Embodiment 5

Cell-type with Northern engram analysis VIGF genetic expression

Make foreskin inoblast (Clonetics, 9620Chesapeake Drive, No. 201, the Suite of human umbilical vein endothelium, aortal smooth muscle, corium; San Diego, California 92123) grow to and be paved with 75-90%.Press the method for Sambrook etc. and extract whole RNA (Biotecx laboratory, company, 8400 HelgermanCt., P.O.Box 6009 Gaithersburg, Maryland 20884) with RNAzol.Said RNA spends the night and transfers to Hybond N+ film (Amersham company, 2636 South Clearbrook Drive; Arlington Heights, Illinois 60005) use Stratalinker UV linking agent (Stratagene cloning system, La Jolla, California) to be combined on the film simultaneously.Said hybridization is at Church damping fluid (Church, G.M.﹠amp under 60 ℃; Gilbert, W., PNAS, U.S. 81:1991-1995 (1984)) in prehybridization 1 hour.The dna sequence dna of coding VIGF, ATCC#75874 increases from the overall length cDNA that encodes at pBluescript SK (-) with M13 forward (5 ' GGGTTTTCCCAGTCACGAC 3 ') and reverse (5 ' ATGCTTCCGGCTCGTATG3 ') primer.The PCR product of 25ng is to use ³²The radiolabeled random primer of P-dCTP (primer-It II, Stratagene).Thermally denature VIGF probe directly joined in the prehybridization damping fluid and 60 ℃ of following incubations 16 hours.Under 60 ℃ in 0.2 * SSC 0.1%SDS wash-out twice, each 10 minutes.Under-80 ℃, carry out autography.Shine (Fig. 5 A) after 2 hours, (Fig. 5 B) transcript (Fig. 5 B) of visible 2.3-2.4kb in corium foreskin inoblast (3 road) at umbilical vein endothelium (1 road) and aortic smooth muscle cell (2 road) or after shining 36 hours.

Sequence table

(1) general information:

(i) applicant: HASTINGS etc.

(ii) denomination of invention: human vascular IBP-like growth factor

(iii) sequence number: 2

(iV) address:

(A) addressee: CARELLA, BYRNE, BAIN, GILFILLAN,

CECCHI，STEWART?&?OLSTEIN

(B) street: 6 BECKER FARM ROAD

(C) city: ROSELAND

(D) state: New Jersey

(E) country: the U.S.

(F)ZIP：07068

(v) computer-reader form:

(A) media type: 3.5 inches disks

(B) computer: IBM PS/2

(c) operating system: MS-DOS

(D) software: WORD PERFECT 5.1

(Vi) data of current application:

(A) application number:

(B) applying date: simultaneously

(C) classification number:

(Vii) in the data of first to file

(A) application number:

(B) applying date:

(viii) lawyer/proxy's information:

(A) name: FERRARC, GREGORY D.

(B) registration number: 36,134

(c) certificate number: 325800-219

(ix) telecom information:

(A) phone: 201-994-1700

(B) fax: 201-994-1744

(2) information of SEQ ID NO:1:

(i) sequence signature:

(A) length: 1271 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: cDNA

(xi) sequence description: SEQ ID NO:1

CTGCTTCCCA?CCAGCAAAGA?CCACGACTGG?AGAGCCGAGC?CGGAGCAGCT?GGGAAACATG 60

AAGAGCGTCT?TGCTGCTGAC?CACGCTCCTC?GTGCCTGCAC?ACCTGGTGGC?CGCCTGGAGC 120

AATAATTATG?CGGTGGACTG?CCCTCAACAC?TGTGACAGCA?GTGAGTGCAA?AAGCAGCCCG 180

CGCTGCAAGA?GGACAGTGCT?CGACGACTGT?GGCTGCTGCC?GAGTGTGCGC?TGCAGGGCGG 240

GGAGAAACTT?GCTACCGCAC?AGTCTCAGGC?ATGGATGGCA?TGAAGTGTGG?CCCGGGGCTG 300

AGGTGTCAGC?CTTCTAATGG?GGAGGATCCT?TTTGGTGAAG?AGTTTGGTAT?CTGCAAAGAC 360

TGTCCCTACG?GCACCTTCGG?GATGGATTGC?AGAGAGACCT?GCAACTGCCA?GTCAGGCATC 420

TGTGACAGGG?GGACGGGAAA?ATGCCTGAAA?TTCCCCTTCT?TCCAATATTC?AGTAACCAAG 480

TCTTCCAACA?GATTTGTTTC?TCTCACGGAG?CATGACATGG?CATCTGGAGA?TGGCAATATT 540

GTGAGAGAAG?AAGTTGTGAA?AGAGAATGCT?GCCGGGTCTC?CCGTAATGAG?GAAATGGTTA 600

AATCCACGCT?GATCCCGGCT?GTGATTTCTG?AGAGAAGGCT?CTATTTTCGT?GAYTGTTCAA 660

CACACAGCCA?ACATTTTAGG?AACTTTCTAG?ATTATAGCAT?AAGGACATGT?AATTTTTGAA 720

GACCAAATGT?GATGCATGGT?GGATCCAGAA?AACAAAAAGT?AGGATACTTA?CAATCCATAA 780

CATCCATATG?ACTGAACACT?TGTATGTGTT?TGTTAAATAT?TCGAATGCAT?GTAGATTTGT 840

TAAATGTGTG?TGTATAGTAA?CACTGAAGAA?CTAAAAATGC?AATTTAGGTA?ATCTTACATG 900

GAGACAGGTC?AACCAAAGAG?GGAGCTAGGC?AAAGCTGAAG?ACCGCAGTGA?GTCAAATTAG 960

TTCTTTGACT?TTGATGTACA?TTAATGTTGG?GATATGGAAT?GAAGACTTAA?GAGCAGGAGA?1020

AGATGGGGAG?GGGGTGGAAG?TGGGAAATAA?AATATTTAGC?CCTTCCTTGG?TAGGTAGCTT?1080

CTCTAGAATT?TAATTRTCCT?TTTTTTTTTT?TTTTTGGGCT?TTGGGAAAAG?TCAAAATAAA?1140

ACAACCAGAA?AACCCCTGAA?GGAATAAGCA?TGTTTGAAGC?TTATGGAAAT?TTGAGTAACA?1200

AACAGCTTTG?ANCTGAGAGC?AATTYCAAAA?GGCTGCTGAT?GTAGCCCCCG?GGTTNCCTNT?1260

NTCTNAAGGA?C 1271

(2) information of SEQ ID NO:2:

(i) sequence signature:

(A) length: 184 amino acid

(B) type: amino acid

(C) chain:

(D) topological framework: linearity

(ii) molecule type: protein

(xi) sequence description: SEQ ID NO:2

Met?Lys?Ser?Val?Leu?Leu?Leu?Thr?Thr?Leu?Leu?Val?Pro?Ala?His

-20 -15 -10

Leu?Val?Ala?Ala?Trp?Ser?Asn?Asn?Tyr?Ala?Val?Asp?Cys?Pro?Gln

-5 1 5

His?Cys?Asp?Ser?Ser?Glu?Cys?Lys?Ser?Ser?Pro?Arg?Cys?Lys?Arg

10 15 20

Thr?Val?Leu?Asp?Asp?Cys?Gly?Cys?Cys?Arg?Val?Cys?Ala?Ala?Gly

25 30 35

Arg?Gly?Glu?Thr?Cys?Tyr?Arg?Thr?Val?Ser?Gly?Met?Asp?Gly?Met

40 45 50

Lys?Cys?Gly?Pro?Gly?Leu?Arg?Cys?Gln?Pro?Ser?Asn?Gly?Glu?Asp

55 60 65

Pro?Phe?Gly?Glu?Glu?Phe?Gly?Ile?Cys?Lys?Asp?Cys?Pro?Tyr?Gly

70 75 80

Thr?Phe?Gly?Met?Asp?Cys?Arg?Glu?Thr?Cys?Asn?Cys?Gln?Ser?Gly

85 90 95

Ile?Cys?Asp?Arg?Gly?Thr?Gly?Lys?Cys?Leu?Lys?Phe?Pro?Phe?Phe

100 105 110

Gln?Tyr?Ser?Val?Thr?Lys?Ser?Ser?Asn?Arg?Phe?Val?Ser?Leu?Thr

115 120 125

Glu?His?Asp?Met?Ala?Ser?Gly?Asp?Gly?Asn?Ile?Val?Arg?Glu?Glu

130 135 140

Val?Val?Lys?Glu?Asn?Ala?Ala?Gly?Ser?Pro?Val?Met?Arg?Lys?Trp

145 150 155

Leu?Asn?Pro?Arg

160

Claims (1)

1. be used for diagnosing vascular disease or form the application of the diagnostic reagent of relevant neovascularization with tumour in preparation at being selected from as the antibody of a peptide species of next group, described group comprises:

(i) have Fig. 1 deduced amino acid the conjugated protein like growth factor polypeptide of people's blood vessel Regular Insulin and keep the active fragment of people's conjugated protein like growth factor of blood vessel Regular Insulin;

Polypeptide after (ii) one or more amino-acid residue is replaced by conservative or non-conservative amino acid residues in the deduced amino acid of Fig. 1, described polypeptide keeps the conjugated protein like growth factor activity of people's blood vessel Regular Insulin;

(iii) by the conjugated protein like growth factor polypeptide of people's blood vessel Regular Insulin of the cDNA of ATCC preserving number 75874 coding and the active fragment of the conjugated protein like growth factor of maintenance people blood vessel Regular Insulin of said polypeptide;

Polypeptide after (iv) being replaced by conservative or non-conservative amino acid residues by one or more amino-acid residue in the conjugated protein like growth factor polypeptide of people's blood vessel Regular Insulin of the cDNA of ATCC preserving number 75874 coding, described polypeptide keeps the conjugated protein like growth factor activity of people's blood vessel Regular Insulin.

Images