CN1242043A - Receptor ligand VEGF-C - Google Patents

Abstract

Provided are polypeptide ligands for the receptor tyrosine kinase, Flt4. Also provided are cDNAs and vectors encoding the ligands, pharmaceutical compositions and diagnostic reagents comprising the ligands, and methods of making ans using the ligands.

Description

Receptor ligand VEGF-C

The application is that the sequence number of submitting on June 28th, 1996 is 08/671, the part continuation application of 573 U.S. Patent application, and the latter is the sequence number of the submission on February 14th, 1996 is 08/601, the part continuation application of 132 U.S. Patent application, and the latter is that the sequence number of submitting on January 12nd, 1996 is 08/585, the part continuation application of 895 U.S. Patent application, and the part continuation application of the latter's to be the sequence number submitted to August 1 nineteen ninety-five be U.S. Patent application of 08/510,133.The application also is that the sequence number submitted on November 14th, 1994 is the part continuation application of 08/340,011 U.S. Patent application.

The present invention relates generally to the genetically engineered field and be particularly related to endothelial cell growth factor (ECGF) and growth factor gene.

The development growth of mature tissue, the growth of reconstruction and regeneration and solid tumor only are accompanied by vascularization just can carry out.Angioblast and hemopoietic forebody cell break up in mesoderm and form the blood island of yolk sac and embryo's elementary vascular system.Derive from these growths of blood vessel of the endotheliocyte of (original positions) differentiation in early days and be called the blood vessel generation.Be sure of that most of embryonic blood vessel takes place to produce by blood vessel, and the formation of all the other vascular trees is considered to come from the result of the angiogenic growth (a kind of process that is called vasculogenesis) of the pipe that pre-exists, Risau etc., " developmental biology " (Devel.Biol.), 125:441-450 (1988).

Endotheliocyte forms several functions pipe different with form.When tissue differentiation and when beginning to carry out its specific function, the phenotype inhomogeneity of endotheliocyte increases.Based on generating vascular stimulation, endotheliocyte can reenter the cell cycle, moves, and withdraws from and be differentiated to form again subsequently the new pipe of its organizational environment of functional adaptation from the cell cycle.Basement membrane and migration that the endotheliocyte degraded of experience vasculogenesis is original, the capillary growth of formation intravasation Zhou Jizhi.People such as Ausprunk, " capillary blood vessel summary " (Microvasc.Rev.), 14:51-65 (1977).Vascularization in tissue development and regenerative process depends on endothelial cell proliferation, migration, differentiation, and the closely-controlled process of survival.Endotheliocyte regulation system functional disorder is the principal character of numerous disease.The most important thing is that having found tumor growth and having shifted is angiogenesis-dependent.People such as Folkman, " journal of biological chemistry " (J.Biol.Chem.), 267:10931-10934 (1992).

To regulate cell be by polypeptide growth factor with the main signal of differentiation before death and manyly mediate for the transmembrane receptor of tyrosine-kinase esterase.The kinase substrate of the signal conduction that the C-terminal sequence that Tyrosylprotein kinase inserts segmental autophosphorylation peptide and activated receptors can be resetted by the genetic expression that is relevant in the effector cell is usually discerned.Several families receptor tyrosine kinase has been described.People such as Van der Geer, " cytobiology yearbook " (Ann.Rev.Cell Biol.) 10:251-337 (1994).The receptor profile that main somatomedin and conduction vasculogenesis stimulate is shown in Fig. 1.

The known fibroblast growth factor also adjusting with vasculogenesis is relevant.Found that it can be to endothelial cells cultured mitogenesis and chemotactic.Fibroblast growth factor also can stimulate the generation such as the proteolytic enzyme of Collagenase and plasminogen activator, and induces the formation of pipe by endotheliocyte.People such as Saksela, " cell biological school year summary " (Ann.Rev.Cell Biol.), 4:93-126 (1988).The common fibroblast growth factor of two classes is arranged, and FGF-1 and FGF-2, both lack conventional signal peptide.Two classes all to heparin have avidity and FGF-2 can be incorporated in heparin sulfate Saliva Orthana in the subcutaneous extracellular matrix, this heparin sulfate Saliva Orthana can discharge after wound from the matrix of position.Heparin can be strengthened endothelial cell proliferation and stimulate by the FGFs that generates blood vessel, the both is by this FGFs sex change of prevention and degraded and dimerization.Endothelial cells cultured surface FGF-1 acceptor but other high-affinity fibroblast growth factor acceptor of not expressing conspicuous level.

In other part of receptor tyrosine kinase, found platelet-derived somatomedin, PDGF-BB has weak angiogenic action at the chicken chorioallantoic membrane.People such as Risau, somatomedin, 7:261-266 (1992).Transforming growth factor-alpha (FGF α) is by several tumour cell types and scavenger cell excretory angiogenesis factor.PHGF (HGF), the part of the acceptor of C-met proto-oncogene coding also has the intensive angiogenic action.

Nearest evidence shows somatomedin and the acceptor that has endothelial-cell specific, and it may mainly cause stimulating endothelial cell growth, the function of differentiation and some differentiation.Study to such an extent that be clear that vascular endothelial growth factor (VEGF), a member of PDGF family most.VEGF is the dimeric 23KD of the glycoprotein subunit that disulfide linkage connects.Other effect of the VEGF of report comprises that cellular calcium shifts, and induces the synthetic of plasminogen activator and inhibitors of plasminogen activator inhibitor-1, stimulates hexose to transport in endotheliocyte, and promotes the monocyte migration in vitro tests.Four kinds of VEGF isoforms by different mRNA splice variant codings show identical stimulating endothelial cell splitted ability.Yet the Saliva Orthana on each isoform pair cell surface has different avidity, and this Saliva Orthana is as the low-affinity receptor of VEGF.121 and 165 amino acid whose VEGF isoforms (VEGF121) and (VEGF165) be that cell surface is connected and heparin is had intensive avidity and 189 isoforms with 206 amino-acid residues have kept with the soluble form excretory.VEGF is based on the short mitotic activity to endotheliocyte at first, also can extract from several sources according to inducing the microvascular permeability ability by it simultaneously, and therefore, it is also referred to as blood vessel permeability factor (VPF).

It is relevant to the vegf expression mode annunciations growth of normal blood vessels system and keeps and the vasculogenesis of tumour.In the mouse growth course, in 7.5 days of whole post-coitum (P.C.), the entoderm VEGF expression, and the ventricle neuroderm produces VEGF at the inside growth phase of kapillary.See people such as Breier, " growth " (Development), 114:521-523 (1992).Quail when growing two days, there is vegf expression in yolk sac and whole embryo's vascularization zone.In addition, the adjacent epithelial cell of porose endothelium of following of adult mice has lasting vegf expression, points out it keeping this specific endothelium phenotype and the effect in the function.

Two kinds of high-affinity receptors of VEGF have been described.They are VEGFR-1/Flt-1 (fms sample Tyrosylprotein kinase-1) and VEGFR-2/Kdr/Flk-1 (kinases that contains acceptor inserts fragment at/fetal livers kinases-1).These acceptors are included into the PDGF-receptor family, but they have seven rather than five immunoglobulin-like rings to be arranged in the longer kinases of its extracellular region territory (as Fig. 1) and they seeing usually than this family that has to insert fragment.The expression of vegf receptor mainly appears at vascular endothelial cell, though also there are some to come across hemocytoblast, monocyte and melanoma cells.It is reported, have only endotheliocyte to breed, and the endothelial cells exhibit of different sources goes out different reactions with VEGF.Therefore, the specificity that reveals cellular type by the signal list of VEGFR-1 and VEGFR-2 mediation.The placenta growth factor (PLGF) that recent findings VEGF is relevant is incorporated into VEGFR-1 with avidity highly.PLGF can strengthen the growth factor activity of VEGF, but itself stimulating endothelial cell not.The VEGF/PLGF heterodimer of natural generation is the mitogen of same intensity to endotheliocyte with the VEGF homodimer almost.People such as Cao, journal of biological chemistry, 271:3154-62 (1996).

Flt4 receptor tyrosine kinase (VEGFR-3) is structurally closely related with the product of VEGFR-2 gene with VEGFR-1.Although this similarity is arranged, the mutant of Flt4 is different from vegf receptor, is wherein cut into the polypeptide that two disulfide linkage connect at extracellular region by proteolysis.People such as Pajusola, " tumor research " (Cancer Res.), 52:5738-5743 (1992).4.5 with 5.8kb Flt4mRNAs coded polypeptide, and because used 3 ' exon of change, so they are terminal different at its C-.VEGF or PLGF isoform do not show the specific combination of Flt4 or bring out himself phosphorylation.

The expression that the expression of Flt4 demonstrates than VEGFR-1 or VEGFR-2 has more restricted.Flt4 expresses the at first angioblast of matter between P.C.8.5 days mouse embryos' head, mainline, and outside the embryo, allantois can detect by the original position essay.In P.C.12.5 days embryo, the Flt4 signal can be observed at the lymphatic endothelial place of vein of just growing and supposition, but arterial endothelium is negative.At the later stage of growing, the lymphatic vessel that Flt4 mRNA becomes and is confined to growing.Lymphatic endothelial and some sophisticated senior endothelium Venules in adult's tissue, express Flt4 mRNA and the lymphatic sinus of the lymphoglandula that shifting and lymphangioma in the expression of enhancing is arranged.These results have supported vein to originate from vasculolymphatic theory.

So far, the receptor tyrosine kinase Flt-1 (VEGFR-1) of five kinds of endothelial-cell specifics has been described, KDR/Flk-1 (VEGFR-2), Flt4 (VEGFR-3), Tie, and Tek/Tie-2, they have the essential intrinsic tyrosine kinase activity of signal transduction.Found orthomutation deactivation Flt-1 in the mouse embryo, Flk-1, Tie, and Tek takes place blood vessel on molecular level and vasculogenesis play a part necessity with special.VEGFR-1 and VEGFR-2 with high-affinity (kd is respectively 16pM and 760pM) in conjunction with VEGF VEGFR-1 also in conjunction with relevant placenta growth factor (PLGF; Kd is about 200pM).In the open WO96/11269 of PCT application, reported the part of Tek.

The invention provides a part that is called the Tyrosylprotein kinase Flt4 acceptor (VEGF-3) of VEGF-C.Therefore, the invention provides a purification and the isolating polypeptide that can be incorporated into the Flt4 receptor tyrosine kinase.Preferably, Flt4 part of the present invention can and be expressed the Flt4 receptor tyrosine kinase at the tyrosine phosphorylation of host cell internal stimulus Flt4 receptor tyrosine kinase.The preferred part of the present invention is the Mammals polypeptide.Highly preferred aglucon is a human polypeptides.Such as hereinafter detailed description, will contain link each other or and the dimer and the polymer of the polypeptide of the present invention that links of other polypeptide be considered as part of the present invention especially.

In one embodiment, the FlT4 ligand polypeptide is that the molecular weight of measuring by at reduction SDS-PAGE that is approximately 23KD is arranged.For example, the present invention includes the part of forming by one or more polypeptide that are approximately 23KD, and this polypeptide can be in conditioned medium from the PC-3 prostate cancer cell line purifying, this clone has ATCC preserving number No.CRL 1435.The amino acid sequencing of the cell-derived ligand polypeptide of this PC-3 shows that this ligand polypeptide comprises the amino terminal amino acid sequence shown in the sequence 13.The conditioned medium itself that contains the Flt4 part is one aspect of the present invention.The present invention also provides the new purposes of PC-3 prostate cancer cell line, promptly produces the Flt4 part.In a preferred embodiment, this part can directly purify from the PC-3 cell culture medium and separate.

In a highly preferred embodiment, ligand polypeptide comprises the aminoacid sequence fragment shown in the sequence 33, and it can be specifically and the combination of people Flt4 receptor tyrosine kinase.Typical fragment comprises: the polypeptide from about 112 residues to the aminoacid sequence of about 213 residues that contains sequence 33; Contain sequence 33 from about 104 polypeptide to the aminoacid sequence of about 227 residues; And contain the polypeptide from the aminoacid sequence of about 112 to 227 residues of sequence 33.Other typical segments comprises the polypeptide across the aminoacid sequence of about following residue of sequence 33 of sequence 33: 31-213,31-227,32-227,103-217,103-225,104-213,113-213,103-227,113-227,131-211,161-211,103-225,227-419,228-419,31-419, and the 1-419 position, such as hereinafter detailed description.

The present invention also provides one or more polypeptide precursors of Flt4 part, and one of them such precursor (being called " preceding-VEGF-C ") comprises the whole aminoacid sequences shown in the sequence 33 (amino-acid residue 1-419).Therefore, the present invention includes the aminoacid sequence 1-419 position residue that has shown in sequence 33 purifying and isolated polypeptide.When expressing in proper host cell, ligand precursor according to the present invention produces specific combination in the polypeptide of Flt4 receptor tyrosine kinase by cracking.102 amino acid leading (preceding) peptide of inferring is identical with the aminoacid sequence shown in the sequence 33.Therefore, at a related aspect, the present invention includes a purifying and isolating polypeptide with aminoacid sequence of the 103-419 position residue shown in sequence 33.

In one embodiment, the Flt4 ligand polypeptide precursor of an expression is cut into about 23KD Flt4 ligand polypeptide by proteolytic enzyme when expressing.Therefore, provide a Flt4 ligand polypeptide, it is the split product of the precursor polypeptide shown in sequence 33 and has at the molecular weight of going back the about 23KD under the ortho states.

Infer VEGF-C precursor or splice variant also as one aspect of the present invention by what molecular weight about 29 and 32KD polypeptide were formed for one.

In another embodiment, the Flt4 part of an expression is cut into about 21KD VEGF-C polypeptide by proteolytic enzyme when expressing.Sequential analysis shows that the 21KD type of being surveyed has about 9 the amino acid whose N-terminals in N-terminal downstream of 23KD type, points out the existence of variable cleavage site.

From preamble as can be known an aspect of of the present present invention comprise the 1-419 position residue that has shown in sequence 33 aminoacid sequence purification with the isolated polypeptide fragment, this fragment can specific combination in the Flt4 receptor tyrosine kinase.Embodiment preferred is included in goes back the fragment that the apparent molecular weight of measuring by SDS-PAGE under the ortho states is about 21/23 KD and 29/32 KD.

The Notes of Key Data: keep the aminoacid sequence that the necessary amino acid of Flt4 ligand activity is included in about 103/112-226/227 position of sequence 33, and C-terminal protein enzyme is cut to produce sophisticated natural Flt4 part and betided about 226-227 amino acids site of sequence 33.Correspondingly, preferred Flt4 part comprises about 103-227 amino acids of sequence 33.

VEGF-C mutation analysis as herein described shows by the natural process that limits the C-end shears the VEGF-C polypeptide existence of the natural 103-227 amino acids across sequence 33 that produces and just like the activity of Flt4 part.Found to have kept the biological activity of VEGF-C by the polypeptide fragment that the 104-213 position residue of sequence 33 is formed.In addition, mutation analysis only shows that the polypeptide across the 113-213 amino acids of sequence 33 just keeps the Flt4 ligand activity.Correspondingly, preferred polypeptide comprises about 103-227 across sequence 33,104-213, the perhaps sequence of 113-213 position residue.

In addition, the contrast of the member's of VEGF family peptide sequence shows that littler fragment also can keep biologic activity, and these littler fragments also will be as aspect of the present invention.Especially, the cysteine residues of eight of polypeptide VEGF family high conservatives has defined the residue zone, 131-211 position (seeing Figure 10 and 31) of sequence 33; Therefore, prediction can keep the VEGF-C biologic activity across the polypeptide of about 131-211 position residue.In fact, contain about 161-211 position residue and kept the polypeptide of going up conservative RCXXCC motif of evolving and be assumed that and kept the VEGF-C activity, therefore also as one aspect of the present invention.Some conserved cysteine residue of VEGF-C have participated in interchain disulfide bond to generate the homology and the heterodimer of various natural VEGF-C polypeptide.Except previous consideration, the VEGF-C polypeptide that lacks interchain disulfide bond has in addition kept the evidence of VEGF-C biologic activity.Correspondingly, material of the present invention and method comprise all a kind of biologic activity VEGF-C fragments that has kept VEGF-C at least, no matter its existence or do not have interchain disulfide bond.The present invention also comprises and contains this segmental polymer (comprising dimer) that is connected to each other or is connected in other polypeptide.Fragment connect can be by polypeptide chain covalently bound (as: disulfide linkage) or non-covalent connection (as hydrogen bond, by key stable or the inductive dipole-dipole interaction, by hydrophobic or hydrophilic interactional key, the combination of the mechanism of these keys, and similar effect).

At another related aspect, the present invention includes aforementioned variant polypeptides and analogue, comprise VEGF-C, VEGF-C precursor, and VEGF-C fragment.The variant that the present invention considered comprises having the VEGF-C of being different from, the purifying of VEGF-C precursor and the segmental aminoacid sequence of VEGF-C and isolated polypeptide, it is by the conservative replacement known to the person skilled in the art, perhaps by forming with corresponding to adding of the amino-acid residue of a kind of biologic activity that keeps VEGF-C at least or deletion.

The analogue that the present invention considers comprises having the VEGF-C of being different from, the VEGF-C precursor, perhaps seen in the VEGF-C fragment to one or more amino-acid residues modify but with keep VEGF-C, VEGF-C precursor, the perhaps corresponding to polypeptide of the segmental at least a biologic activity of VEGF-C.For example, the analogue in the scope of the invention comprises glycosylation variant and conjugate (aforementioned polypeptide is attached to as marker, on the compounds such as toxin).

The present invention also provide the polypeptide of the present invention that is used to encode purifying with isolating polynucleotide (being nucleic acid), for example cDNA or respective coding VEGF-C precursor, VEGF-C, the perhaps genomic dna of bioactive fragment or its variant.The preferred nucleic acid of the present invention comprises 1-419 amino acids residue or a kind of aforementioned segmental DNA of encoding sequence 33.Because the degeneracy of genetic code has many such encoding sequences, each all has the structure of the amino alcohol sequence shown in common encoding sequence 33 or other fragments.The present invention also comprises the analogue of these polynucleotide, and perhaps any coding has kept the derivative of these polynucleotide of a kind of biologic activity of VEGF-C at least.The DNA polynucleotide comprise genomic dna s according to the present invention, and cDNAs, and the oligonucleotide that contains the segmental encoding sequence of VEGF-C have perhaps kept the segmental analogue of a kind of biological activity VEGF-C of VEGF-C at least.Based on the degeneracy of genetic code, encode the different polynucleotide that reach of the present invention all within the scope of the invention more.In one embodiment, the present invention has designed the polynucleotide with the sequence that is different from the segmental polynucleotide of coding VEGF-C in some sense, thereby as those skilled in the art understand, caused the difference of conserved amino acid between encoded polypeptide.

A preferred polypeptide according to the present invention comprises the people VEGF-C cDNA sequence of sequence 32 described 352-1611 position Nucleotide.Other derives from by polynucleotide encoding of the present invention, as the Mammals except that the mankind, and birds (as the quail bird), and other VEGF-C polypeptide.Other polypeptide of the present invention also comprises the segmental encoding sequence of VEGF-C, and the allelic variant of those encoding parts of DNAs or whole VEGF-C.

The present invention also comprises the polynucleotide that those energy and aforesaid polynucleotide are hybridized under the stringent condition of standard.Typical stringent hybridization condition is as follows: at 50% methane amide, and 5 * SSC, 20mMNa.PO4, pH6.8 is hybridized down and is washed down in 55 ℃ at 0.2 * SSC in 42 ℃.Those skilled in the art are accessible to be that the change of these conditions can be based on treating hybridization sequences length and GC nucleotide content.The normalized form of this area is suitable for detecting suitable hybridization conditions.See people such as Sambrook, molecular cloning: laboratory manual (second edition, press of cold spring harbor laboratory 1989) § § 9.47-9.51.These VEGF-C that can and encode, the VEGF-C fragment, perhaps the polynucleotide of VEGF-C analogue hybridization, are purified and the polynucleotide that separate other (non-human) Mammals VEGF-C type of encoding to identify as nucleotide probe.In addition, these polynucleotide are used for the present invention's screening method as mentioned below.

The preferred nucleic acid probe of the present invention comprises the nucleotide sequence of about at least 16 continuous nucleotides of sequence 32.More preferably, these nucleic acid probes have about 20 Nucleotide of the subsequence of sequence 32 at least.When using these nucleic acid probes, preferably, this probe hybridizes to the part of sequence shown in the sequence 32 specifically.The specific hybridization here is defined as the hybridization under the stringent hybridization condition of standard.In order to identify specifically and to separate other Mammals VEGF-C gene, nucleic acid probe be preferably those can not with (as the unsaturated people VEGF or the people VEGF-B gene recombination) of VEGF-C genes involved hybridization.

Therefore, the present invention includes the polynucleotide that contain about 16 Nucleotide at least, polynucleotide energy wherein and gene (as the people's gene) specific hybridization of coding VEGF-C.The specificity of this hybridization has guaranteed that polynucleotide of the present invention can hybridize in the nucleic acid of coding VEGF-C under certain hybridization conditions, and this condition is not supported the nucleic acid of this multi-nucleotide hybrid in coding such as VEGF or VEGF-B.In one embodiment, the polynucleotide of about at least 16 Nucleotide and preferred about at least 20 nucleoside nucleotides are elected to be the continuous nucleotide sequence of sequence 32 or the complementary sequence of sequence 32 described nucleotide sequences.

Other aspect of the present invention comprises the carrier that contains nucleic acid of the present invention; And transform or the host cell of transfection with nucleic acid of the present invention or carrier.The preferred carrier of the present invention is such expression vector, and nucleic acid wherein of the present invention is operatively connected to suitable promotor and other control sequence, thereby can express the Flt4 part with the proper host cell of this carrier conversion or transfection.Preferred carrier of the present invention is plasmid pFlT4-L, and it has ATCC registration number the 97231st.This carrier and host cell are used for recombinant production VEGF-C polypeptide.

The present invention also comprises the method for preparing polypeptide of the present invention.In a preferable methods, nucleic acid of the present invention or carrier are expressed in host cell, and polypeptide of the present invention is purified from host cell or host cell growth medium.

In a relevant embodiment, the present invention includes the polypeptide that preparation can be incorporated into the Flt4 receptor tyrosine kinase specifically, comprise step: (a) transform or transfection host cell with nucleic acid of the present invention; (b) cultivate this host cell to express this nucleic acid; And (c) from host cell or this host cell growth medium, purify and to be incorporated into the polypeptide of Flt4 receptor tyrosine kinase specifically.

The present invention also comprises purifying and the polypeptide ligand of producing with method of the present invention isolating Flt4.In a preferred embodiment, the present invention includes people VEGF-C polypeptide or its bioactive fragment that does not in fact have other people source polypeptide.

On the other hand, the present invention includes can be specifically and polypeptide of the present invention, perhaps with the antibody of polypeptide interpolymer specific reaction of the present invention.Mono-clonal and polyclonal antibody all can be according to ordinary skill in the art preparation with anti-polypeptide of the present invention.The purposes that this antibody can be used for diagnosing is with the monitoring vasculogenesis, vascularization, and lymphatic vessel and morbid state thereof, wound healing, perhaps some tumour cell, hematopoiesis, or the leukemia cell.This antibody can be used for sealing the part of activatory Flt4 acceptor.

Part can and be used for identifying in position its corresponding acceptor with detectable marker mark according to the present invention.The Flt4 part of mark and anti--Flt4 ligand antibody can be used as contrast medium and are used to detect lymphatic vessel, high-grade endothelium venule and morbid state thereof, and the Flt4 acceptor of expressing in histological chemistry's tissue slice.This aglucon or antibody can be covalently or non-covalently are coupled to suitable super magnetic, paramagnetism, electronics is dense, echogenicity, or on radioactive reagent with radiography.Other non-radioactive marker such as vitamin H and avidin also can use.

A related aspect of the present invention is the method that detects specific cells such as endotheliocyte.These cells be found in the body or the biological tissue specimens of ex vivo in.This detection method may further comprise the steps: will contain and can be incorporated under the condition on the cell contact such as the biological tissue of endotheliocyte at polypeptide of the present invention this can be incorporated into the polypeptide of Flt4 receptor tyrosine kinase, this biological tissue of optionally washing, and be bonded to the polypeptide of the cell of this biological tissue, thereby detect this cell in detection.

The present invention also provides the diagnosis and the clinical application of desired part.In an embodiment preferred, Flt4 part or precursor are used for quickening vascularization (as in wound healing) or promote vasculolymphatic endothelial function.Also suggestion utilizes VEGF-C to be used for tissue transplantation as the vasculogenesis inducer, and illness in eye is around the stricture of artery after the infraction and the formation that enters the collateral line pipe of wound tissue.Can be with acceptable vehicle of the suitable pharmacy of any use such as pharmacy acceptable diluent, assistant agent, the suitable manner administration of vehicle or carrier according to polypeptide of the present invention.The VEGF-C polypeptide is also available.In conjunction with detecting or using the existence that detects active acceptor in the biopsy material or part in the test kit of VEGF-C of detectable mark and measure following transfer danger.Flt4 part according to the present invention also can be used for promoting vasculolymphatic reconstruction or the perviousness such as the tissue transplantation patient.In addition, the Flt4 part alleviates auxiliary vasculolymphatic loss after also can be used for after the surgical operation in cancer (as the mammary cancer) treatment.Also can be used for treatment or preventing inflammation according to part of the present invention, edema, lymphatic vessel underdevelopment, lymph blocks, elephantiasis and Milroy ' s disease.Last Flt4 part can be used for stimulating lymphocyte to produce and is ripe, and promotes or suppress the white corpuscle transportation between tissue and lymphatic vessel or influence migration inside and outside the thymus gland.

The present invention includes a kind of screening and treated the method for the endotheliocyte disease of mammalian body.This method comprises in this person that treated the body gets the endotheliocyte sample, and the endotheliocyte sample is contacted with polypeptide according to claim 4, measures the growth rate of this cell, and sets up the relation of growth rate and disease.In a preferred embodiment, this to be treated Mammals be the mankind and endotheliocyte is people's cell.In another preferred embodiment, this disease is a vascular disorders, as Lymphangiopathy, such as because loss of operating lymphatic vessel or because the existing vasculolymphatic miopragia that obstruction causes.In another embodiment, this endotheliocyte contacts with this polypeptide external.The growth velocity of Ce Dinging is the cell fission speed of per time of per unit in the method, and it is by any mensuration of the known many technology in this area.The relation of growth velocity and disease can be that plus or minus is relevant, and for example, whether this polypeptide as mentioned below has Flt4 ligand activity or this active inhibitor.

The inhibitor of Flt4 part can be used for controlling endothelial cell proliferation, lymphangioma and cancer metastasis.For example, this inhibitor can be used for stoping metastatic carcinoma growth or diffusion, perhaps controls the others that endotheliocyte is expressed and grown.Inhibitor comprises antibody, the anti-oligonucleotide of anticipating, and the polypeptide of blocking this Flt4 acceptor, more than all will be one aspect of the present invention.

In another embodiment, the invention provides and regulate the method treated the mammalian body endothelial cell growth, may further comprise the steps: the Mammals endotheliocyte is exposed to polypeptide by significant quantity of the present invention to regulate the growth of this Mammals endotheliocyte.In one embodiment, the adjusting of this growth can and be expressed the Flt4 receptor tyrosine kinase and realize by using at the tyrosine phosphorylation of host cell moderate stimulation Flt4 receptor tyrosine kinase.In the growth of regulating endotheliocyte, the present invention considered to the adjusting of endotheliocyte diseases associated.The endotheliocyte disease that the present invention considers includes, but are not limited to, the mechanical loss of lymphatic vessel (as the adenoid surgical removal of armpit), and lymphatic vessel blocks (as elephantiasis), and lymphangioma.In a preferred embodiment, curee and endotheliocyte are human.This endotheliocyte can provide in external or in vivo test, and can be contained in the tissue transplantation.Here the significant quantity polypeptide being defined as the necessary polypeptide amount of the reproducible change that will reach cell growth rate determined by experience (shows and measures cell by micro-or visual inspection and increase a times time, perhaps nucleic acid is synthetic detects), as any one those of ordinary skill in the art understood.

The present invention also provides the method with desired nucleic acid (as polynucleotide) screening endotheliocyte disease.In a preferred embodiment, the invention provides the be put to the test method of endotheliocyte disease in the mammalian body of a screening, comprise step: from the experimenter, get endotheliocyte nucleic acid sample, this sample was contacted with of the present invention can hybridization in the polynucleotide of the gene of coding VEGF-C (and preferably can hybridize in VEGF-C mRNA), measure the hybridization level between this endotheliocyte nucleic acid and this polynucleotide, and the relation of determining this hybridization level and disease.Preferred mammalian subject and endotheliocyte nucleic acid source are human.The disease with the polynucleotide screening that present method is considered includes, but are not limited to all Lymphangiopathies as the aforementioned, and anoxybiotic vascular disease.

The polynucleotide with other (non-human) of separated coding VEGF-C type of purifying also are aspects of the present invention, by its encoded polypeptides and and the immunoreactive specifically antibody of this non-human VEGF-C variant also be aspect of the present invention.Preferred non-human VEGF-C type is to be derived from other vertebrates kind type of (comprising birds and mammal species).It is highly preferred that mammalian type.Therefore, the present invention includes purifying and isolating Mammals VEGF-C polypeptide, also comprise the polynucleotide of purifying and these polypeptide of separated coding.

In one embodiment, the polypeptide of that the present invention includes purifying and aminoacid sequence isolating 1-415 residue with sequence 41, and this aminoacid sequence is consistent with the mouse VEGF-C precursor of deduction.The mouse VEGF-C precursor that it is believed that this deduction by with add mode many and similar before the workman and be processed into sophisticated mouse VEGF-C.Therefore, at a related aspect, the present invention includes purifying with isolating can specific combination in the polypeptide of Flt4 receptor tyrosine kinase (as people or mouse Flt-4 receptor tyrosine kinase), this polypeptide comprises the purifying and the isolated polypeptide fragment of the aminoacid sequence of the 1-415 position residue with sequence 41, and this fragment energy specific combination is in the Flt4 receptor tyrosine kinase.The present invention also comprises aforementioned polypeptide and the purifying of the aforementioned polypeptide of coding and the polymer of isolating nucleic acid (as comprising all or part of nucleic acid of the sequence shown in the sequence 40).

In another embodiment, the present invention includes purifying and isolating quail VEGF-C polypeptide, bioactive fragment and polymer thereof, and the polynucleotide of the aforementioned polypeptide of encoding.

In another embodiment, the present invention includes the DNA that contains the VEGF-C promotor, it can promote the expression of gene of VEGF-C gene or another coded protein that operatively connects under the condition that VEGF-C can express in these cells in the natural host cell.

Brief description of drawings

Fig. 1 shows main endothelial cell receptor Tyrosylprotein kinase and the somatomedin that is relevant to blood vessel generation and vasculogenesis.Illustrated primary structure territory comprises immunoglobulin-like zone (IGH), Urogastron homology zone (EGFH), Fiberonectin III type zone (FNIII), stride film (TM) and nearly film (JM) zone, Tyrosylprotein kinase (TK1, TK2) zone, kinases inserts segment area (KI), and C-stub area (CT).

Fig. 2 shows the structure of PLTRFLt4L expression vector.

Fig. 3 shows the structure of baculovirus vector in the Flt4 extracellular region territory (Flt4Ec) of coding excretory solubility.

Fig. 4 shows by the result of conditioned medium from PC-3 cell culture moderate stimulation Flt4 autophosphorylation.

Fig. 5 A, 5B and 5C show that the main tyrosyl phosphorylation polypeptide of the Flt4 cells transfected that stimulates with the PC-3 conditioned medium is a 125KD Flt4 polypeptide (VEGFR-3), and this Flt4 stimulating activity is not adsorbed on the heparin-agarose gel.

Fig. 6 shows that separation detects from the Western immunoblotting of the Flt4 of PC-3 conditioned medium ligand activity.

Fig. 7 shows the gel electrophoresis result of the chromatographic component that is derived from Flt4 part (VEGF-C) affinity purification that is located away from spissated PC-3 conditioned medium.

Fig. 8 shows that the alignment arrangement is to show the people of its similarity, mouse and quail VEGF-C amino acid sequence of polypeptide.Conserved residues in whole three species is discharged with black matrix.

Fig. 9 shows the Flt4 part, the clone of VEGF-C and structure.This VEGF homologous region (shaded boxes) and amino and C-terminal propetide (being respectively shallow shaded boxes and shadow-free box) and the signal sequence (SS) of inferring be illustrated in 5 ' and 3 ' untranslated (μ t) nucleic acid district between.The cleavage site of signal sequence and amino and C-terminal propetide is represented with triangle.

Figure 10 shows the PDGF-A that infers ,-B, PLGF-1, VEGF-B167, VEGF165, and the contrast of the aminoacid sequence of Flt4 part (VEGF-C).

The let others have a look at exon-intron structure of VEGF-C gene of Figure 11.Seven exons are illustrated as open box, and the exon size is represented with base pair.Intron is illustrated as line, and intron size (base pair) is shown on the line.5 of the ripe mRNA of the 2.4kb that infers ' and 3 ' non-translated sequence are expressed as shaded boxes.The location map that is used to describe the genomic clone of VEGF-C gene is shown under the gene mapping.

Figure 12 is shown in the VEGF that encodes in two human tumor cell lines and the cerebral tissue, and the Northern trace of the gene of VEGF-B and VEGF-C (being called " FLT4-L ") detects.

Figure 13 A shows behind the pulse chase experiment isolating and by in the radioautograph of going back the electrophoretic reorganization of SDS-PAGE VEGF-C under the ortho states.

Figure 13 B shows that reorganization VEGF-C type is the polyacrylamide gel photo that disulfide linkage connects under non-reduced attitude.

Figure 14 A and 14B show the autophosphorylation that proves VEGF-C stimulation VEGFR-2 (KDR) but the Western trace that does not influence PDGFR-β phosphorylation.

Figure 15 A shows that VEGF-C detects the moderate stimulation endothelial cell migration at three-dimensional collagen gel.

The let others have a look at expression of VEGF-C mRNA in the mature tissue of Figure 16 A.

Figure 16 B shows VEGF in the selected human fetal tissue, the expression of VEGF-B and VEGF-C.

The let others have a look at genome structure of class and mouse VEGF-C gene of Figure 17.Exon-intron catenation sequence is represented jointly with exon and intron length.Intron sequences is represented with descender.The Nucleotide that continuous frame is read in the opening of being measured among the VEGF-C cDNAs (is equivalent to the codon at the joint coding) shown in up triplet letter.

Figure 18 shows VEGF-C processing, comprises main VEGF-C type.

Figure 19 shows the radioautograph of pulse-chase immunoprecipitation test, and wherein using VEGF-C expression vector (VEGF-C) cells transfected and simulating transfectional cell (M) is to follow the trail of with radioactivity amino acid pulse labelling and when the different time spans.

Figure 20 shows the figure of K14-VEGF-C vector construction.

Figure 21 A-C shows the electrophoretic separation of all kinds reorganization VEGF-C that 293 EBNA cells of transfection produce.Figure 21 B is shown in electrophoretic separation simulation (M) rail transfect cell under the non-reduced attitude, with wild-type (wt) VEGF-A cDNA cells transfected, and with the cDNA variant cells transfected of the VEGF-C-R102S that encodes.Each band excision that Figure 21 B is identified is also being gone back under the ortho states electrophoretic separation in an isolating swimming lane.The fractional separation that is equivalent to the band of VEGF-C weight is illustrated in Figure 21 A; The band fractional separation that is equivalent to the R102S variant is illustrated in Figure 21 C.

Figure 22 A-B shows the type and size by the wild-type of non-reduced attitude detected through gel electrophoresis and mutant reorganization VEGF-Cs.Figure 22 A shows the VEGF-C type that is secreted into substratum; Figure 22 B shows the VEGF-C type that is kept by cell.Simulation (M) cells transfected in contrast.

Antiserum(antisera) 882 and antiserum(antisera) 905 immunoprecipitations are used in Figure 23 A-B representative, the pattern contrast of the VEGF-C type of mark.Adjacent swimming lane contains process (mark+swimming lane) or does not pass through (be labeled as one swimming lane) reduction and alkylating immunoprecipitate.

Figure 24 A-B representative separates from the Northern trace that grows in or do not have total RNA of fixed time in interleukin-(IL-1) and/or the dexamethasone (DEX).The Northern trace of Figure 24 B is the VEGF 581 bp cDNA that contain base pair 57-638 (Gene bank registration number X15997) to derive from, with people VEGF-B167 cDNA fragment (Nucleotide 1/382, Gene bank, registration number U 48800) radio-labeled DNA survey.The Northern trace of Figure 24 A is to survey with the radio-labeled DNA that derives from people's total length VEGF-C cDNA (Genebank registration number X94216).18S and 28S-rRNA are as marker.

Figure 25 shows the transfection with VEGF-C cDNA, uses Pichia pastoris (P.Pastoris) culture of carrier transfection separately, and perhaps simulation (M) transfection is being expressed in the VEGF-C of each shown in bringing out after the period with methyl alcohol.Get about 10 μ l substratum detected through gel electrophoresis, detect by the Western trace and with anti-VEGF-C antiserum(antisera) subsequently.

Figure 26 shows-Western trace result, the NIH 3T3 cell of VEGF expression R-3 (Flt4) wherein, and the PAE cell of VEGF expression R-2 (KDR) is with the 5 * spissated substratum that comes from the pichia that contains VEGF-C cDNA carrier (+) transfection, stimulate with the carrier that lack to insert fragment (-), perhaps stimulate with the positive control alum salts.Precipitate with this stimulated cells cracking and with the specific antibody mediated immunity of VEGFR, and survey with this immunoprecipitate trace and with anti-phosphotyrosine antibody.

Figure 27 A-B let others have a look at VEGF-C (wt) and host 293EBNA emiocytosis (Figure 27 A) or keep the VEGF-C variant of (Figure 27 B).Simulation (M) cells transfected in contrast.The molecular weight marker thing is used shown in the kilodalton (KD) as the left side.

Figure 28 A-B shows with wild-type (wt) VEGF-C, and three kinds of Western traces that the VEGF-C polypeptide variants stimulates into the VEGFRs of autophosphorylation.Cell lysate (the NIH 3T3 of VEGFR-3 and the PAG of VEGFR-2) through acceptor-specific antiserum(antisera) and this receptor by immunoprecipitation.Then, this immunoprecipitate of gel separation and trace detect to carry out Western.Survey this Western trace with anti-phosphorylated tyrosine antibody.

The Photomicrograph of the genetically modified and contrast mouse littermate tissue of the K14-VEGF-C of Figure 29 A-D hematoxylin-eosin staining.Demonstration is the zone from skin of back and rhynchodaenm, as shown.White arrow represents not have the boundary that the endothelium of erythrocytic lacuna is lined up.

The poly+RNA of tissue was used VEGF shown in Figure 30 representative derived from, VEGF-B167, and the Northern trace of the set storehouse of VEGF-C probe hybridization.The transcript size of estimating is marked in the right side with kilobase (kb).

The contrast of Figure 31 representative and mouse VEGF-C aminoacid sequence.The aminoacid sequence of mouse VEGF-C is listed in and is reached the standard grade and difference among the human sequence is marked in and rolls off the production line.This sequence of mark is to describe the zone shown in Fig. 9.Arrow shows the cleavage site of inferring of signal peptidase; BR3P motif and CR/SC motif are loaded in the box; And conserved cysteine residue indicates on the sequence with black matrix.Arginine residues 158 is also with the black matrix mark.Numeral refers to mouse VEGF-C residue.

Figure 32 show the isolating immunoprecipitation of SDS-PAGE in or affinity purification in various ³⁵The sample of the substratum of S-mark.In the swimming lane in left side, derive from the control medium of the cell of the Bosc 23 that only contains carrier, derive from the substratum of expressing human VEGF-C cell, and come from express mouse VEGF-C cell substratum respectively with the human VEGFR-3-3 extracellular domain precipitation that is coupled to agarose.At the right side swimming lane, similarly conditioned medium precipitates with anti-VEGF-C antibody.Mwm: molecular weight marker thing; The m-mouse; H-people; α-anti-.

Figure 33 shows the Western trace from the immunoprecipitate of the lysate of the NIH3T3 cell of VEGF expression R-3 or VEGFR-2 of coming from of gel separation, as shown, and this cell by with contain lysate (perhaps vehicle Control) and contact and stimulate, the mensuration of the receptor autophosphorylation phosphorylation of bringing out as VEGF-C-.(α-PTyr) or anti--acceptor antiserum(antisera) (anti-VEGFR-3 and anti-VEGFR-2) are surveyed this Western trace with anti-phosphorylated tyrosine.In contrast, handle (VO4) with alum salts and bring out the receptor autophosphorylation phosphorylation.The apparent molecular weight of arrow and digitized representation tyrosyl phosphorylation receptor polypeptides band.BVEGF: people baculovirus VEGF-C albumen; C-FGEVm comes from and has the lysate of cell that is cloned into the mouse VEGF-C cDNA of carrier with antisense orientation.

Figure 43 A-D is shown in the Photomicrograph that in situ hybridization in 12.5 days mouse embryos' the other sagittal plane section detects the expression of VEGF-C and VEGF-B mRNAs.Figure 34 A:VEGF-C probe; The i-jugular vein, mn-metanephros, m-mesostenium (arrow), VC-inter-spinal channel, lu-lung (arrow).Figure 34 B:VEGF-B probe; The h-heart, nasopharynx district (arrow).Figure 34 C:VEGF-C sense strand probe in contrast.The bright visual field Photomicrograph in the same zone shown in Figure 34 D:34C.

Figure 35 A-H shows provides VEGF-C and VEGFR-3 to cut into slices the correlated mouse embryo of jugular vein and the expression of mesentery zone.Figure 35 A and 35C show that the VEGF-C transcription is in the expression at jugular vein zone (arrow) of the metanephros of the big the same structure periphery of capsule.Figure 35 B and 35D show the expression of VEGFR-3 transcription at the jugular vein capsule.Figure 35 E and 35G show that P.C.15 days embryo's metanephros district and perienteric VEGFR-3 mRNA distribute.Figure 35 F and 35H show 14.5 days embryos' mesentery district, and the intestines district, the lymphatic vessel of growing, and the VEGFR-3 mRNA of vein.

Figure 36 A-D shows the Photomicrograph of the in situ hybridization of P.C.16 days the FLT4 of mouse embryo head and VEGF-C.The snout of growing, nose structure and eyes are shown in head section with Flt4 probe (Figure 36 A) hybridization.The hybridization with VEGF-C probe (Figure 36 B) is shown in the section of back position.What the circular configuration representative of both sides, top was being grown grinds one's teeth in sleep.(back of the body) portion on the center line both sides, the rear portion of the first of as seen growing.These structures also are shown in dark-field (Figure 36 C) and the bright visual field (Figure 36 D) microscope that high power is amplified.

Detailed description of the present invention

Described herein is the separation of new VEGF and from being prepared in people's prostate cancer The clone of the DNA of this new growth factor of the coding that the cDNA library of clone PC-3 carries out. Should The cDNA coding that separates is a kind of to enter the protein that cell is cultivated culture medium by proteolysis processing justacrine. This secretory protein that is called VEGF-C is incorporated into the extracellular domain of Flt4 and brings out Flt4 and VEGFR-2 tyrosine autophosphorylation. The also migration of stimulating endothelial cell in the collagen gel of VEGF-C.

Here the data of report shows that VEGF-C is with a bigger precursor expression, and then cutting Become this part. Coexpression district in some situation comes from other shearing of the RNA of this part gene. Should The coexpression district can change along with being used for obtaining the specific expression system of this part. Those skilled in the art are bright In the restructuring of protein was produced, additional sequence can be accompanied by the spy who depends on for expressing this albumen in vain Decide the functional polypeptide of recombinant precursor and express, and remove subsequently to obtain required part. Some situation Can make the restructuring part of some residue that lacks endogenous/native ligand down. In addition, known is at egg Can guard in the white matter and replace and do not change the function of this albumen. Correspondingly, can imagine that this variation is at this In the scope of invention. In addition, foreseeable is that one or more of VEGF-C precursors (infer by maximum Natural secreting type VEGF-C precursor have whole amino of from 32 to 419 residues of sequence 33 The acid sequence) can stimulate this Flt4 part under the condition of no any further processing, it is to be similar to VEGF stimulates the mode of its acceptor with undressed form and advances after signal secretion sequence and the release followed OK.

The result of this paper report shows that Llt4 (VEGFR-3) sends the VEGF-C signal. This conclusion is Based on VEGF-C to the special combination of restructuring Flt4 EC (Flt4 extracellular domain) albumen and come from VEGF The culture medium of-C transfectional cell draws inducing of VEGF-3 autophosphorylation. On the contrary, VEGF and PLGF all do not show the special VEGFR-3 of being incorporated into or bring out himself phosphorylation.

As described in hereinafter detailed, infer front-VEGF-C has the molecular weight of inferring 46,883; A kind of infer front-VEGF-C processing intermediate is the determining molecular weight with about 32KD; And by The VEGF-C of the maturation that conditioned medium separates has by the SDS-PAGE under the reduction-state to survey The molecular weight of fixed about 23KD. Purifying with the determining molecular weight of VEGF-C restructuring with by VEGF The main difference place of inferring molecular weight of the front VEGF-C of-C ORFs (ORF) coding be by Before protease cuts this-amino terminal of VEGF-C polypeptide and the sequence in carboxyl terminal zone. So And, because the molecular weight of inferring of the polypeptide that is made up of the acid of the 103-419 bit amino of sequence 33 is 35,881 KD is so think that the proteolytic cleavage of 102 amino acid whose targeting sequencings that this is inferred does not cause this to push away The whole difference of fixed molecular weight 46,883 and the about 23KD of molecular weight that measures. Evidence shows molecular weight A part of measuring difference is because the amino of this VEGF-C precursor and the amino acid residue of carboxyl terminal Proteolytic cleavage. From PDGF structural research (people such as Heldin, " growth factor " (Growth The key area of Factors), 8:245-52 (1993)) extrapolating prompting acceptor combination and being activated by VEGF-C Be included in the amino acid residue of 104-213, its VEGF-C albumen that is found in secreting type is (as lacking The type of weary targeting sequencing of inferring and some carboxyl terminal sequence). This is in conjunction with 23 KD of VEGFR-3 Polypeptide may represent VEGF homology zone. After the biosynthesis, this newborn VEGF-C polypeptide can Three glycosylation positions that the N-that infers connects of identifying in the VEGF-C amino acid sequence that is to infer Point is by glycosylation. Containing (such as the glycosylation of N-connection) polypeptide of modification, is one aspect of the present invention.

Compare the carboxyl terminal amino acid order that increases this VEGF-C polypeptide length with other part of this family Tabulation now make the people remember balbaini ring 3 albumen (BR3P) sequence (people such as Dignam, " gene " (Gene), 88:133-40 (1990); The people such as Paulsson, " molecular biology magazine " (J.Mol.Biol.), 211:133-40 (1990)) cysteine residue gap model. The terminal silk of this new C-of VEGF-C Albumen spline structure motif can be folded into isolated area, based on above-mentioned consideration, its be after biosynthesis at least By Partial Resection. What is interesting is at least also have the cysteine motif of a BR3P type to be found in this The carboxyl terminal of VEGF. In our experiment, infer precursor and cutting part at this cell culture medium In all detect the cutting of prompting by leukoprotease. The amino terminal of VEGF-C separator and The sequencing of carboxyl terminal is so that can identify proteolysis processing site. Before anti-being somebody's turn to do-VEGF-C The generation of the antibody of the different piece of molecule is so that can concern and ratio that it is thin by Accurate Measurement precursor product Born of the same parents distribute, and processing and secretion dynamics.

VEGF-C has the conservative mode of eight cysteine residues, and it can participate in interchain and the chain The formation of disulfide bond, thus the bioactive molecule of the antiparallel dimerization that is similar to PDGF produced. Have Mutation analysis about the cysteine residue of this interchain disulfide bond bridge shows that the VEGF dimer is different from PDGF, it need to combine to keep biologically active by these covalent interactions. This VEGF The disulfide bond of-C polypeptide chain is that the VEGF-C under the non-reduced attitude shows easily in analyzing to be seen, though Right recombinant protein also contains the VEGF-C type of disulfide bond between the no polypeptide of part activity.

The VEGFR-3 that VEGF and VEGF-C are distinguished structurally closely is relevant to VEGFR-1 and VEGFR-2. The people such as Finerty, " oncogene " (Oncogene), 8:2293-98 (1993); The people such as Galland, oncogene, 8:1233-40 (1993); The people such as Pajusola, " cancer Disease research " (Cancer Res.), 52:5738-43 (1992). Except VEGFR-3, VEGFR-2 EGFR-TKs also are activated with VEGF-C. The signal of VEGFR-2 mediation caused Scale reaches the morphologic marked change of the pig arterial endothelial cell of this receptor, that is, actin restructuring with And film ruffling. In these cells, VEGFR-2 also mediates chemotaxis that part brings out and short Fissility. The people such as Waltenberge, " journal of biological chemistry " (J.Biol.Chem.), 269:26988-95 (1994). Similarly, when this receptor chimera CSF-1R/VEGFR-3 at NIH 3T3 In the fibroblast during ectopic expression, it is short division, but in the pig arterial endothelial cell is not (people such as Pajusola, 1994). Come to the same thing with this, express VEGFR-2mRNA but do not express or Seldom expressing ox hair tubule endothelium (BCE) cell of VEGFR-1 or VEGFR-3mRNA is using VEGF-C shows the migration of enhancing when stimulating. The light microscope of BCE cell in the collagen gel Observation place prompting VEGF-C stimulates the propagation of these cells. Therefore, data shows this VEGF part Showing in its signal with acceptor may be the dependent big specificity of cellular type.

The expression pattern of VEGFR-3 (people such as Kaipainen, " institute of NAS periodical " (Proc.Natl.Acad.Sci.) (USA), 92:3566-70 (1995)) prompting VEGF-C may be the embryo During forming, vein in the generation and lymphatic vessel system work. VEGF-C shown in this article organizes in maturation Constitutive expression in knitting further pointed out this gene outcome also with wherein express VEGFR-3's Keeping of the differentiation function of lymphatic vessel and some venous endothelial is relevant. Lymphatic capillaries does not have ripe basic unit And kept an interesting possibility, namely this sample BR3P motif with can regulate in organizing The generation of the supramolecular structure of the validity of VEGF-C is relevant. Yet, as shown here, VEGF-C also activates VEGFR-2, and it is rich in the just propagation in the pipe of the vascular bud of embryonic tissue and branch In the endothelial cell of, but be not rich in equally in adult's tissue. The people such as Millauer, " nature " (Nature, 367:576-78 (1993). These data promptings VEGF-2 is that blood vessel takes place and blood vessel is given birth to A kind of main regulatory factor that becomes. Therefore, VEGF-C may have unique effect to the lymph endothelium And and VEGF together in angiogenic growth and may be in the permeability of the endothelium of regulating several types tool More function is arranged. Because VEGF-C stimulates VEGFR-2 and promotes endothelium migration, VEGF-C can be in wound healing, tissue transplantation, illness in eye, and the infraction artery narrow around and enter injured Be used as blood vessel and vasculolymphatic generation inducing agent in the formation of the collateral line pipe of tissue.

In a word, these results demonstrate the complexity of the enhancing of blood vessel endothelium signal. It has strengthened this without exception Read, namely when tissue breaks up and begins to carry out their specific function, the phenotype heterogeneity of this endothelial cell Property increases in a few class functions pipe different with form. Yet, based on the thorn of suitable Angiogenesis stimulation Swash, the endothelial cell cell circulation of can reentrying, migration is withdrawn from the cell circulation and is divided into again subsequently new Functional adaptation is in the vascular of its organizational environment. This and tissue development is sent out with the simultaneous blood vessel of regeneration Living process depends on Human Umbilical Vein Endothelial Cells breeds, and migration is strictly controlled between the positive negative signal of differentiation and existence Balance.

The previous angiopoietic growth factor of promotion of identifying comprises fibroblast growth factor, liver cell Growth factor/dispersion factor, PDGF and TGF-α. (see such as Folkman " natural medical science " (Nature Med.) 1:27-31 (1995); The people such as Friesel, FASEB magazine, 9:919-25 (1995); The people such as Mustonen, cell biology magazine, 129:895-98 (1995). Yet VEGF is only The growth factor of one Human Umbilical Vein Endothelial Cells relative specificity. Thereby, the new factor VEGF-that identifies The people such as B[Olofsson, institute of NAS periodical, 93:2578-81 (1996)] and VEGF-C The relevant blood vessel that has increased our Human Umbilical Vein Endothelial Cells takes place, Angiogenesis, and permeability, and perhaps also have The understanding of the specificity of other endothelium function and the complexity of the positive signal that enriches. Use the Northern seal The expression study of mark shows that VEGF-C abundant in heart and skeletal muscle expresses; Other tissue, as Placenta, ovary, small intestine, thyroid gland, kidney, prostate, spleen is also expressed this gene in testis and the large intestine. And PLGF mainly expresses with in coiling at tire, VEGF, the expression mould of VEGF-B and VEGF-C Formula is overlapping in many tissues, and the member of prompting VEGF family can form heterodimer and interact To finish its physiological function.

The direct mutagenesis that causes the inactivation of vegf receptor locus in the musculus cdna group shows VEGFR-1 Be that to form the inherent structure of endothelial cell of blood vessel endothelium necessary, and VEGF-2 is endothelium and make The generation of haemocyte is necessary. Four genes of this prompting VEGF family can be cause vascular malformation and The target of the sudden change of angiocardiopathy.

The following example is illustrated the preferred embodiments of the invention, has wherein described the separation according to the nucleic acid of Flt4 part of the present invention and coding part, identify, and function.

Embodiment 1

The pLTRFlt4l preparation of expression vectors

The structure of the LTR-Flt4l carrier of coding elongated Flt4 receptor tyrosine kinase as shown in Figure 2.The Flt4s of total length (the short type of Flt4) cDNA (Genbank registration number X68203, sequence 36) be that the S2.5 fragment of the 56-2534 base pair by at first will containing Flt4s (sees with the reference form and incorporates people such as Pajusola of the present invention into, cancer research, 52:5738-5743 (1992)) subclone is gone into pSP73 carrier (Promega, Madison, EcoRI site WI) and assembling.

Since be used to screen the cDNA library of Flt4 cDNA do not contain coding protein sequence extreme 5 ', so antisense PCR is used for the Flt4 5 ' end that amplification is equivalent to 12 amino-acid residues (MQRGAALCLRLW).Separation is to use Amersham cDNA synthesis system Plus test kit (Amersham company from the Poly of people HEL erythroleukemia cell and double-stranded cDNA (A)+RNA, Buckinghamshire, U.K.) and gene-Auele Specific Primer: 5 '-TGTCCTCGCTGTCCTTGTCT-3 ' (sequence 1) (it is positioned to clone the 195bp place, downstream of 5 of S2.5 ' end) synthetic.Handling double-stranded cDNA with the T4DNA polysaccharase makes terminal flush endization and uses Centricon100 filter (Amicon company, Beverly, MA) filtration purifying cDNA.Carry out the cyclisation of flush end cDNA by in the cumulative volume that is 150 μ l, connecting.This reaction mixture contains a kind of standard and connects damping fluid.5%PEG-8000, and 1mM DTT and 8UT4 dna ligase (New England Biolabs, Beverly, MA).This ligation was carried out under 16 ℃ 16 hours.Get 15 μ l reaction solutions and be used to contain the conventional PCR reaction of the primer and the 1u Taq archaeal dna polymerase (Perkin Elmer Cetus) of 100ng Flt4-specific introducing Sac I and Pst I restriction site.Carry out PCR twice with each 33 circulations (72 ℃ prolong 4 minutes for 95 ℃ of sex change 1 minute, 55 ℃ of annealing 2 minutes).Successively handle this PCR mixture, and after using Magic PCR Preps (Promega) purifying, the dna fragmentation subclone is gone into to be used for pGEM 3zf (t) carrier of order-checking (Promega) with Sac I and Pst I Restriction Enzyme.Preserving in registration number corresponding to 5 ' terminal sequence of Flt4s cDNA clone is the gene library database of X68203.

With the sequence of coding 12 amino-acid residues by connecting being located away from the PCR fragment that poly (A)+RNA of hel cell produces with the reverse transcription PCR amplification and adding expression construct of Sph I-digestion.The forward primer apparatus has following sequence: 5 '-ACATGCATGC CACCATGCAGCGGGGCGCCG CGCTGTGCCT GCGACTGTGG CTCTGCCTGGGACTCCTGGA-3 ' (sequence 2) (SphI site underscore, translation initiation codon is represented with black matrix).This translation initiation codon just in time is the downstream of the Kozak consensus sequence of optimum.(Kozak, nucleic acids research, 15:8125-8148 ((1987)).Reverse primer 5 '-ACATGCATGCCCCGCCGGT CATCC-3 ' (sequence 3) (Sph I site underscore), this S2.5 fragment 5 ' end, thereby replaced unique Sph I fragment of S2.5 plasmid.Digest the carrier of this gained and be connected on the PCR fragment of 138bp with EcoRI and Cla I, and this PCR fragment amplification is in encoding as people such as Pajnsola, cancer research, the 0.6kb EcoRI fragment of 52:5738-5743 (1992) Flt4 3 ' shown in Figure 1 end (in the gene library X68263 sequence 3789-4416 bit base to), its usefulness oligonucleotide 5 '-CGGAATTCCC CATGACCCCA AC-3 ' (sequence 4) (forward primer, EcoR site underscore) and 5 '-CCATCGATGG ATCCTACCTG AAGCCGCTTT CTT-3 ' (sequence 5) (reverse primer, Cla I site underscore).This coding region is finished by 1.2kb EcoRI fragment (seeing the 2535-3789bps that the gene library registration number is the X68203 sequence) is connected to above-mentioned construct.This complete cDNA passes through its Hind TII-Acc I (flush endization) restriction site subclone λ PLTR poly expression vector as Hind III-Cla I (flush endization) fragment (this Cla I site also is included in the 3 ' primer that is used to make up 3 of this encoding sequence ' end), this carrier is reported in people such as Makela, gene, 118:293-294 (1992) (gene library registration number X60280, sequence 37), it incorporates the present invention into the reference form.

The Flt4 of elongated (Flt4l) is that 3 ' end by the short type of following displacement prepares: this Flt4l cDNA 3 ' zone be use respectively gene specific oligonucleotide (sequence 7, as follows) and pGEM 3Z carrier-specificity (SP6 promotor) oligonucleotide 5 '-ATTTAGGTGACACTATA-3 ' (sequence 6) carries out pcr amplification as reverse and forward primer.The template of PCR is to contain from gene library X68203 sequence (downstream sequence in this EcoRI site is with Flt4 elongated 3 ' sequence and with gene library registration number S66407) (sequence 38) preservation) the segmental Flt4l cDNA clone of 495bp EcoRI that extends downstream of the EcoRI site of 3789 Nucleotide.This gene-special oligonucleotide contains the Bam HI restriction site that just is positioned the coding region end and has following sequence: 5 '-CCATCGATGGATCCCGATGCTGCTTAGTAGCTGT-3 ' (sequence 7) (BamHI site underscore).The encoding sequence that digests this PCR product and be transformed into downstream, its EcoRI site 2535bp (seeing sequence X 68203) with frame with EcoRI and BamHI is in the LTRFlt4s carrier segments with EcoRI-BamHI digestion excision.The clone of gained is called pLTRTlt4l.This coding region is passed through again to connect the EcoRI fragment (the 2535-3789 base pair of sequence X 68203) of 1.2kb in the gained carrier.

Embodiment 2

The preparation of Flt4l transfectional cell and detection

NIH 3T3 cell (60% merges) uses the transfection reagent (Boehringer-Mannheim based on the DOTAP liposome, Mannheim, Germany) contain neomycin phosphotransferase gene (Southern etc. with 5 μ g pLTRFlt4l constructs and 0.25 μ g, (J.Mol.Appl.Genet), 1:327 (1982) is cotransfection together " to use the molecular genetics magazine ".After the transfection one day, this cell changed over to contain 0.5mg/ml Geneticin (GIBCO, Grand Island, the substratum of selection N.Y.).Separate the cell colony of Geneticin resistance and detect the proteic expression of this Flt4.Contain 3.3%SDS 125mM Tris, lysing cell in the lysis buffer of pH6.8 what boil.(Pierce, Rockford IL) measure the protein concn of this sample with the BCA method.About 50 μ g protein of each lysate detect the existence of Flt4 by the sero-fast immunoblotting of SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and the anti-Flt4 C-terminal of use.The signal of Western trace detects by ECL method (Amersham).

Anti-for producing-the Flt4 antiserum(antisera), coding is lacked the Flt4cDNA fragment of 40 amino-acid residues of carboxyl terminal of type: NH2-PMTPTTYKG SVDNQTDSGM VLASEEFEQIESRHRQESGFR-COOH (sequence 8) goes into the pGEX-1 λ T bacterial expression vector (Pharmacia-LKB that has the glutathione-S-transferase coding region in the frame with 657bp EcoRI-fragment cloning, company, Uppsala, Sweden).The GST-Flt4s fusion rotein of gained is produced in E.coli and by gsh-the remove affinitive layer purification of lipolysaccharide gel 4B post.Protein freeze-drying with purifying, be dissolved in phosphoric acid buffer saline solution (PBS), and Freund ' s adjuvant mixes and is used for passing through with two weekly intervals the ordinary method immunize rabbit (Harlow etc. of this area, " antibody: laboratory manual " (Antibodies:A laboratoryManual) (press of cold spring harbor laboratory, 1988)).Behind four reinforced immunologicals, antiserum(antisera) is used for from transfectional cell immunoprecipitation Flt4.The cell colony of expressing Flt4 also is used for ligand stimulation and detects.

Embodiment 3

The structure of Flt4 EC baculovirus vector and the expression and the purifying of product thereof

The design of graphics of Flt4 extracellular domain (EC) baculovirus vector is shown in Fig. 3.The cDNA of this coding Flt4 is with elongated and short type preparation, and each type is all mixed carrier under the control of Moloney murine leukemia virus LTR promotor.The nucleotide sequence of short type Flt4 acceptor is the gene library database of X68203 and 3 ' section of specific elongated cDNA obtains gene library registration number S66407 available from registration number.

Terminal following modification of the cDNA section of coding Flt4 EC: usefulness primer 1116 (5 '-CTGGAGTCGACTTGGCGGACT-3 ', sequence 9, SalI site underscore) and primer 1315 (5 '-CGCGGATCCCTAGTGATGGTGATGGTGATGTCTACCTTCGATCATGCTGCCCTTAT CCTC-3 '; The sequence of the extracellular region of (sequence 10, BamHI site underscore) this Flt4cDNA that increases (gene library registration number X68203) EC sequence 3 ' end.5 ' terminal sequence of primer 1315 is not to be complementary to the Flt4 coding region.The sequence that inspection is complementary to this district of primer 1315 finds from 5 ' to 3 ' direction a terminator codon is arranged, the His codon of six adjacency (subsequently use the Ni-NTA post; Qiagen, Hilden, Germany, this encoded polypeptides of chromatogram purification), and additional BamHI site.Digest the fragment of this amplification and be used for replacing the unique SalI-BamHI fragment of LTRFlt4 carrier shown in Figure 3 with SalI and BamHI.This substituted SalI-BamHI fragment coding Flt4 strides film and cytoplasmic region.Gained be a kind of LTRFlt4 carrier of modification.

5 of this no Flt4 signal sequence ' end coding region by use primer 1335 (5 '-CCCAAGCTTGGATCCAAGTGGCTACTCCATGACC-3 ' (sequence 11), this primer contains additional HindIII (AAGCTT) and BamHI (GGATCC) restriction site, and it has underscore) pcr amplification.The 2nd primer that is used for amplification coding Flt4 signal sequence district be primer 1,332 5 '-GTTGCCTGTGATGTGCACCA-3 ' (sequence 12), the fragment of this amplification is with HindIII and SphI digestion (in primer 1335 this HindIII site (AAGCTT) represent with underscore and in this SphI site amplification region at Flt4cDNA).The HindIII-SphI fragment of the LTRFlt4 carrier of the modification of just having described more than the HindIII-SphI fragment of gained is used to replace (this HindIII site is positioned at 5 ' connecting joint place that this Flt4 inserts the pLTR poly section of fragment and this carrier, and this SphI site is positioned at Flt4 cDNA).Then, the Flt4 EC of this gained inserts fragment and connects into the BamHI site of pVTBac plasmid as the BamHI fragment, as people such as Tessier, and gene, 98:177-183 (1991) is described, and it incorporates the present invention into the reference form.By part order-checking confirm this insert segmental relative direction in case the open reading frame of signal sequence-coding section that makes this carrier in frame adjacent to the Flt4 coding region sequence.This Flt4EC construct and baculovirus genomic dna are transfected into the SF-9 cell by the fat transfection together.Purifying, increase this recombinant virus and be used for by this area ordinary method infect the High-Five cell (Invitrogen, San Diego, CA).According to this Flt4EC of purifying in the substratum of manufacturer specification (Qiagen) infected Hign-Five cell with 6 * His mark of the carboxyl terminal coding of next combination of Ni-NTA affinity chromatography and wash-out recombinant chou Flt4EC.

Embodiment 4

From conditioned medium, separate the Flt4 part

People Flt4 part according to the present invention is located away from conditioned medium, and this substratum is that PC-3 prostate cancer cell line (ATCC CRL 1435) is incubated in the Ham ' s F-12 nutrition miscellany (GIBCO) that contains 7% foetal calf serum (FCS).This cell is pressed product description and is cultivated.For preparing this conditioned medium, merge the PC-3 cell and in Ham ' 3 F-12 nutritional blends (GIBCO), in the presence of no foetal calf serum (FCS), cultivated seven days.Then, made it clarification in 20 minutes in centrifugal this substratum of 1000g.Then, screen this substratum and be exposed to the ability of bringing out the Flt4 tyrosine phosphorylation with the cDNA of the coding Flt4 NIH 3T3 cell by the transfection of pLTRFlt4l carrier to detect it.For receptor for stimulating experiment, hunger is spent the night in the DMEM substratum (GIBCo) of NIH 3T3 cell serum-free containing 0.2%BSA that the Asia is merged.Stimulated this cell 5 minutes with conditioned medium, with the cold PBS washed twice that contains 100 μ mol alum salts, and be used for RIPA damping fluid (10mM Tris pH7.5,50mM NaCl, 0.5% Sodium desoxycholate that the acceptor immunoprecipitation detects, 0.5%Nonidet P40 (BDH, Poole, Britain), 0.1% sodium lauryl sulphate (SDS), 0.1 u/ml aprotinin (Aprotinin) is (BoehringerMannheim), the 1mM alum salts) middle cracking.Centrifugal this lysate is 20 minutes under 1,5000 * g.Supernatant liquor with 3 μ l (terminal antiserum(antisera) is in cultivating 2 hours on ice as embodiment 2 described anti-Flt4.Also see people such as Pajusola, oncogene, 8:293-2937 (1993), it incorporates the present invention into the reference form.

Have in the presence of anti--Flt4 antiserum(antisera) cultivate 2 hours after, add albumin A-sepharose (Pharmacia) and rotation and continue down to cultivate 45 minutes.Before SDS-PAGE detects, use immunoprecipitation damping fluid and 10mM Tris respectively, pH 7.5 washings three times and secondary.Polypeptide forwarded on the nitrocellulose filter and detect with Flt4-or Tyrosine O-phosphate-specific antisera and ECL method (Amersham company) Western trace.Anti-Tyrosine O-phosphate monoclonal antibody is (anti--PTyr; PY20) available from the Transduction laboratory (Lexington, Kentucky).In some cases, the filter after peeling off dyes again second antibody has been arranged.Peeling off of this filter is at the 100mM 2 mercapto ethanol, 2%SDS, and 62.5mMTris-HCl stirs once in a while under 50 ℃ among the pH 6.7 and continues and carried out in 30 minutes.

As shown in Figure 4, this PC-3 conditioned medium (PC-3CM), when the NIH 3T3 cell of expressing Flt4 is handled with described substratum preparation, stimulate the tyrosine phosphorylation of 125KD polypeptide, cracking, and this lysate behind SDS-PAGE with anti-Flt4 antiserum(antisera) immunoprecipitation, Western trace, and with anti--PTyr antibody staining.This gained band is on the basis that stimulates with unconcentrated PC-3 conditioned medium and by slight phosphorylation (swimming lane 2).This 125KD band and came from the tyrosine phosphorylation of the ripe Flt4 of cell that alum salts handles, ( swimming lane 2 and 7 of comparison diagram 4 also sees Fig. 5 A) of processed-type be migration altogether together.Migration is also confirmed by the anti--Flt4 antibody of being infected with again shown in Fig. 5 A (right figure) altogether.For show this 125KD polypeptide be not can with the non-specific component of the conditioned medium of anti--phosphotyrosine antibody reaction, the conditioned medium of 15 μ l is separated by SDS-PAGE, trace is in nitrocellulose filter, and with resisting-this trace of PTyr antibody staining.No signal draws (Fig. 5 B).Non-conditioned medium can not stimulate the Flt4 phosphorylation, as Fig. 4, shown in the swimming lane 1.

Fig. 5 C shows that PC-3CM stimulates (+) untransfected (swimming lane 4 and 5), the effect comparison of FGFR-4-transfection (swimming lane 8 and 9) and Flt4 transfection NIH 3T3 cell (swimming lane 1-3,6 and 7).These results show untransfected NIH 3T3 cell and all do not show the proteic tyrosine phosphorylation of about 125KD that stimulates based on this conditioned medium that comes from the PC-3 cell with the NIH 3T3 cell of FGFR-4 transfection.Stimulate analysis to show that the Flt4 part is not incorporated into heparin by the PC-3CM that uses heparin-agarose gel C L-6B (Pharmacia) pre-treatment 2 hours (swimming lane 2) under room temperature.

As Fig. 4, shown in the swimming lane 3, when this PC-3 conditioned medium concentrated 4 times with Centricon-10 thickener (Amicon), its stimulating activity did not significantly increase.Fig. 4, swimming lane 4 show and are coupled to CNBr-activatory sepharose CL-4B (Pharmcia with 50 μ l; About 1mg Flt4EC district/ml agar gel resin) the spissated PC-3 conditioned medium of Flt4EC pre-treatment has thoroughly been eliminated the Flt4 tyrosine phosphorylation.This conditioned medium of sepharose CL-4B pre-treatment that similarly is used for replacing does not influence stimulating activity, as Fig. 4, shown in the swimming lane 5.The circulation (it comprises that molecular weight is lower than 10,000 protein) that concentrates the back gained does not stimulate the Flt4 phosphorylation, as Fig. 4, shown in the swimming lane 6.

In another experiment, use non-conditioned medium respectively, be derived from the substratum of the PC-3 cell of expressing the Flt4 part, perhaps contain the FLt4 autophosphorylation contrast of the NIH 3T3 cell of the expression LTRFlt4l that the non-conditioned medium of 50ng/ml VEGF165 or 50ng/ml PLGF-1 transforms.With this lysis, detect with anti-phosphotyrosine antibody with anti-FLt4 antiserum(antisera) immunoprecipitation and by the Western trace.Have the PC-3 conditioned medium of expressing Flt4 part (swimming lane Flt-4L) only and stimulate the Flt4 autophosphorylation.

Aforesaid data shows that this PC-3 cell generation is incorporated into the part of Flt4 EC and activates this receptor.

Embodiment 5

The purifying of Flt4 part

By as the part of the embodiment 4 described people PC-3 cell expressings Flt4 EC purifying by in affinity chromatography, using recombinant production with separate.

Twice totally 8 liters serum-free condition substratum cutting be collected in contain that the PC-3 cell is paved with layer 500 be paved with diameter 15cm incubator.(Filtron, Northborough MA) hold back the Omega ultra-filtration membrane with 10KD and concentrate 80 times according to the method for specification sheets with this conditioned medium of 10,000 * g centrifugal clarification and with Ultrasette Tangential flow instrument.Reorganization Flt4 EC expresses in the recombinant baculovirus cell system and passes through Ni-agarose (the Ni-NTA affinity column is available from Qiagen) affinitive layer purification.The extracellular region of this purifying is coupled on the CNBr-activatory Sepharose CL-4B with the concentration of 5mg/ml and as the affinity matrix of part affinity chromatography.

Spissated conditioned medium was cultivated 3 hours under room temperature in rolling pipe with the Flt4 EC Sepharose affinity matrix of 2ml reorganization.All subsequently purification steps all carry out under+4 ℃.Then, this affinity matrix is changed in the post of internal diameter 15mm and with sodium phosphate buffer (pH 6.8) continuous washing of 100ml PBS and 50ml 10mM.Wash step by step with 100mM glycine-HCl and to take off this bond material, successive 6ml wash-out pH is respectively 4.0,2.4 and 1.9.In the pipe that contains 0.5ml 1M sodium phosphate (pH8.0), collect several parts of 2ml elutant components.Set up part immediately jointly and dialysis in 1mM Tris-HCl (pH 7.5).Detect the ability of stimulation Flt4 tyrosine phosphorylation of each equal portions of per 75 μ l.Also detected ultrafiltrated, the spissated conditioned medium of each equal portions of 100 μ l before and after the part affinity chromatography, and the stimulation Flt4 tyrosine phosphorylation of 15 times of spissated material compositions that in washing process, from Flt4 EC-Sepharose matrix, discharge.

As Fig. 6, shown in the swimming lane 3, spissated conditioned medium has brought out the significant tyrosine phosphorylation of Flt4 in the NIH 3T3 cell of transfection of overexpression Flt4.This activity is not found in takes from the conditioned medium that is exposed to the substratum behind above-mentioned (Fig. 6, swimming lane 4) Flt4 Sepharose affinity matrix.This specificity-using PBS in conjunction with the Flt4-stimulus material, 10mM sodium phosphate buffer (pH 6.8), and pH 4.0 (Fig. 6 still remaines on the affinity matrix after being respectively swimming lane 5-7 washing, and it is eluted in when pH2.4 in the 2ml equal portions, (swimming lane 8 and 9) stage casing wash-out.The further reduction of elution buffer pH does not cause the release of other Flt4-excitor substance (Fig. 6, swimming lane 11).Fig. 6, swimming lane 1 show the contrast that expression Flt4 cell is wherein handled with non-conditioned medium; Swimming lane 2 shows with the result who contains molecular weight is handled the cell of expression Flt4 less than the ultrafiltration component of the conditioned medium of the polypeptide of 10KD after.

(Savant, Farmingdale concentrate and reduce SDS-PAGE under the attitude in N.Y.), are that silver dyes this gel with the ordinary skill in the art subsequently at the SpeedVac concentrating instrument with the little five equilibrium of chromatographic component.Show that as Fig. 7 the main polypeptide that molecular weight is about 23KD (going back ortho states) is detected on to contain to stimulate in Flt4 activity (being equivalent to the swimming lane 8 and 9 among Fig. 6) component.This polypeptide is not found in other chromatographic component.On the other hand, except these bands and very weak band with 32KD mobility, whole other compositions that are detected on two active ingredients also are distributed in parent material and to be distributed on a small quantity in the washing and elution step after concentrated.Similarly the result also independently obtains in the affinity purification at three, is incorporated into Flt4 with showing this 23KD polypeptid specificity and brings out the tyrosine phosphorylation of Flt4.

The component that will contain the 23KD polypeptide is mixed, and is dry and carry out SDS-PAGE in 12.5% gel in Speed Vac concentrating instrument.Then, (Millipore, Marlborough MA) and by dyeing with Coomassie blue R-250 observe to Immobilon-P (PVDF) transfer film with the protein electroblotting in the gel.Downcut in the zone that will only contain painted 23KD band by trace and (Applied Biosystems, Foster City carry out the N-terminal amino acid sequence analysis in CA) in Prosite protein sequencing system.With 610A data analysis system (Applied Biosystems) analytical data.Analysis revealed has a single N-end sequence NH ₂-XEETIKFAAAHYNTEILK-COOH (sequence 13).

Embodiment 6

In carrier for expression of eukaryon, make up the PC-3 cell cdna library.

With few deoxythymidine (oligo (dT)) (III type, Collaborative Biomedical Products, Becton-Dickinson Labwane, Bedford, MA) Mierocrystalline cellulose affinity chromatography (Sambrook etc., 1989) is by single stage method separation of human poly (A) from the ware of 5 diameter 15cm that are paved with the PC-3 cell ⁺RNA.The receipts amount is 70 μ g.Get 6 μ g poly (A) ⁺RNA is used for preparing oligo (dT)-primer cDNA library at mammalian expression vector pcDNA I and Invitrogen Librarian test kit by the method for test kit specification sheets.Estimate that this library contains about 106 and independently and on average inserts the recombinant chou that clip size is about 1.8kb.

Embodiment 7

The amplification of the aminoterminal peculiar nucleotide sequence of coding Flt4 part.

Based on the oligonucleotide of the-terminal amino acid sequences Design degeneracy of isolating people Flt4 part and be used for polymerase chain reaction (PCR) as primer with amplification coding Flt part and be derived from the cDNA in this PC-3 cDNA library.Total policy map described in the embodiment 7 and 8 is shown in Fig. 9, wherein shows different primers with arrow.

Come from the DNA in PC-3cDNA library of amplification and the mixture of following primer with 1 μ g and carry out PCR, these two kinds of primers are: the 48 sense strand primers that same ratio exists (this primer sequence contain altogether sequence 5 '-(R wherein is A or G to GCAGARGARACNATHAA-3 ' (sequence 14), N is A, G, C or T and H is A, C or T), coded amino acid residue 2-6 (EETIK, sequence 15)) sequence and the 384 antisense strand primers that exist with same ratio (this antisense strand primer have altogether sequence 5 '-(Y wherein is C or T and D is A to GCAYTTNARDATYTCNGT-3 ' (sequence 16), G, or T), and corresponding to amino-acid residue 14-18 (TEILK, sequence 17)).Add three extra Nucleotide (GCA) to increase annealing stability at 5 of each primer ' end.The DynaZyme of every reaction usefulness 1U (F-500L, Finnzymes, Espoo, Finland) damping fluid (10mM Tris-HCl, 8.8,25 ℃ of pH, the 1.5mM MgCl that is provided by manufacturers is provided (a kind of thermostable DNA polymerases) ₂, 50mM KCl .01%Triton-X100) in and under 72 ℃ elongating temperature, carry out two successive PCR reaction.First PCR carries out 43 circulations.Three round-robin annealing temperatures at first are 33 ℃, and the time is 2 minutes, and remaining circulates in and carried out under 42 ℃ 1 minute.

Downcut gel district and the wash-out that contains the weak band of estimating size (57bp) from gel.Use above-mentioned same primer for 42 ℃ again, 30 circulations of this eluate of heavily increasing under 1 minute.Clone test kit (Invitrogen) with TA the fragment cloning of amplification is gone into (Invitrogen) and the order-checking of usefulness Sanger radioactivity dideoxy nucleotide sequencing in the PCRII carrier.Detected the sequence that six clones and whole six clone strains all contain coding purpose peptide (the 104-120 amino acids residue of Flt4 ligand precursor).It is identical being listed in whole six clone strains across the 3rd Nucleotide of codon 6 to the nucleotides sequence of the 3rd Nucleotide (extension area) of codon 13: 5 '-ATTCGCTGCAGCACACTACAAC-3 ' (sequence 18) and therefore representative come from the amplified production of peculiar sequence of the N-terminal part of coding Flt4 part.

Embodiment 8

5 of the cDNA of coding Flt4 part '-terminal amplification

Based on the nucleotide sequence of the isolating people Flt4 of distinctive coding part N-end, two pairs of nested primerss have been designed so that amplification comes from complete 5 ' end of corresponding cDNAs of the DNA in the above-mentioned PC-3 cDNA of 1 μ g library in two nested PCRs reactions.At first, with 4 common defined nucleotide sequences 5 '-(it is corresponding to amino-acid residue 9-15 (AAHYNTE for the primer of TCNGTGTTGTAGTGTGCTG-3 ' (sequence 19), sequence 20) antisense strand primer), and corresponding to the sense strand primer 5 of the T7 RNA promotor of the pcDNA I carrier that is used to make up the library '-the same miscellany of TAATACGACTCACTATAGGG-3 ' (sequence 21) increases.People such as used landing (" Touchdown ") PCR such as Don, nucleic acids research, 19:4008 (1991) is disclosed, and it incorporates the present invention into the reference form.Annealing temperature in two circulations be 62 ℃ and subsequently annealing temperature in each circulation decrescence 1 ℃ until reaching 53 ℃ of finishing temperatures, carry out other 16 circulations in this temperature.Annealing time is that 1 minute and each round-robin extend in and carried out under 72 ℃ 1 minute.The dna fragmentation that in first reaction, is repeatedly increased.For the first time amplified production (1ul carries out 1: 100 diluent with water) is used for amplified reaction for the second time, and the latter use amino-acid residue 6-13 (KFAAAHYN, sequence 23) the antisense strand primer contain coding Flt4 part (5 '-GTTGTAGTGTGCTGCAGCGAATTT-3 '; Sequence 22), and corresponding to the sense strand primer of the 2179-2199 position Nucleotide of pcDNAI carrier (5 '-TCACTATAGGGAGACCCAAGC-3 ', sequence 24) a pair of nested primers.This has justice and antisense primer sequence to be overlapped in 3 of the used corresponding primer of PCR for the first time ' hold." landing " (" Touchdown ") PCR is by reducing to 66 ℃ and carry out other 18 circulations continuously and carry out under 66 ℃ with annealing temperature from 72 ℃.Annealing time is 1 minute and each round-robin extends in 72 ℃ carried out 2 minutes.150bp, and three secondary products of 100bp have been obtained being about the primary product of 220bp and being about 270bp.

The amplified fragments of about 220bp is downcut from sepharose, clone test kit (Invitrogen) with TA it is cloned into PCR II carrier and order-checking.Detected three recombinant clone strains and contain sequence 5 '-TCACTATAGGGAGACCCAAGCTTGGTACCGAGCT CGGATCCACTAGTAACGGCCGCCAGTGTGGTGGAATTCGACGAACTCATGACTGTA CTCTACCCAGAATATTGGAAAATGTACAAGTGTCAGCTAAGGCAAGGAGGCTGGCA ACATAACAGAGAACAGGCCAACCTCAACTCAAGGACAGAAGAGACTATAAAATTCG CTGCAGCACACTACAAC-3 ' (sequence 25).On behalf of cDNA, the initial pc of the representative DNAI carrier of sequence and the sequence of ruling insert the amplified production of fragment 5 ' end.

Embodiment 9

The amplification of cDNA 3 ends of coding Flt4 part

Based on aminoterminal clone's the 5 ' sequence of the coding 23KD people Flt4 part of amplification, the 3 ' parts of two pairs of non-overlapped nested primerss have been designed with amplification Flt-4-part-code cDNA clone.Corresponding to the sense strand primer 5 of the 152-169 position Nucleotide of the 5 ' sequence (sequence 25) of the Flt4 part that is increased '-ACAGAGAACAGGCCAACC-3 ' (sequence 26), and corresponding to the antisense strand primer 5 of the 2311-2329 position Nucleotide of pc DNAI carrier '-TCTAGCATTTAGGTGACAC-3 ' (sequence 27) is used for first " landing " PCR.The annealing temperature of per two these reactions of circulation reduces by 1 ℃, from 72 ℃ to 52 ℃, carries out 15 circulations again under 52 ℃.Annealing time is that 1 minute and every round-robin extend is to carry out under 72 ℃ 3 minutes.In first amplification, obtained the dna fragmentation of several sizes.Water was with 1: 200 dilution products therefrom and using second pair of primer: 5 '-PCR of AAGAGACTATAAAATTCGCTGCAGC-3 ' (sequence 28) and 5 '-CCCTCTAGATGCATGCTCGA-3 ' (sequence 29) (corresponding to the antisense strand primer of the 2279-2298 position Nucleotide of pc DNAl carrier) increases again.Two dna fragmentations of 1350bp and 570bp size have been obtained.These fragment clonings are gone into PCR II carrier and check order this clone's insertion fragment.Find that these two fragments all encode with coming from the sequence of the aminoacid sequence of VEGF sequence.

Embodiment 10

5 ' PCR fragment screening PC-3 cell cdna library with the Flt4 Ligand cDNA

By use above-mentioned 5 ' PCR fragment and primer 5 '-pcr amplification people Flt4 Ligand cDNA 219bp 5 ' tailpiece section of GTTGTAGTGTGCTGCAGCGAATTT-3 ' (antisense strand primer, sequence 30) and 5 ' TCACTATAGGGAGACCCAAGC-3 ' (sequence 31) (corresponding to the sense strand of the 2179-2199 position Nucleotide of pc DNAI carrier).With EcoRI (Boehringer Mannheim) digest this amplified production with remove increase in the dna sequence dna of pc DNAI carrier part and with Ecoli dna polymerase i (Boehringer Mannheim) with [ ³²P]-the 153bp fragment of the coding Flt4 part 5 ' end of dCTP mark gained.This fragment is as the PC-3 cell cdna library of probe with the screening by hybridization amplification.

The filter membrane photomechanical printing in this library is being contained 50% methane amide, 5 * sodium-chlor sodium phosphate buffer (SSPE), 5 * Denhardt ' s solution was hybridized 20 hours at 42 ℃ with radiolabeled probe in the solution of 0.1%SDS and 0.1mg/ml sex change salmon sperm DNA.At 1 * sodium-chlor citrate buffer solution (SSC), under room temperature, this filter membrane twice of washing in 30 minutes then, spends the night in 65 ℃ of washed twice in following 30 minutes and exposure among the 0.1%SDS.

Based on radioautograph, from this library, filter out two male recombinant bacteria clone strains with probe hybridization.Plasmid DNA purification and digest and agarose electrophoresis is analyzed with ethidium bromide staining subsequently from these clone strains with EcoRI and NotI.Based on exist respectively about 1.7,1.9 and the insertion fragment of 2.1kb size these ten plasmid clone strains are divided into three groups.Use T ₇Oligonucleotide is as primer and the check order insertion fragment of every group of plasmid of the step primer of sequencing reaction subsequently.

Sequential analysis shows that whole clone strains all contain the NH of this 23KD people Flt4 part of encoding ₂The open reading frame of-end sequence.Move primer with the step and continue dideoxy sequencing at downstream direction.Complete human cDNA sequence and the aminoacid sequence of inferring that comes from 2kb clone are respectively shown in sequence 32 and 33." preceding " led of sequence and inferred cleavage site between 102 and 103 residues of sequence 33.When with the database of gene library in during the sequence contrast, find the predetermined protein product of this reading frame and the predicted amino acid sequence homology of PDGF/VEGF family somatomedin shown in Figure 10.

The plasmid pFLT4-L that contains the 2.1kb people cDNA clone of pc DNAI carrier has been preserved in ATCC, 12301 Parklawn Drive, and Rockville, MD 20852, registration number 97231.

Embodiment 11

Protein product by the Flt4 ligand carrier stimulates the Flt4 autophosphorylation

The people cDNA of plasmid pFlt4-1L of 2.1kb that will contain the open reading frame of the sequence of coding shown in sequence 32 and 33 inserts fragment (people VEGF-C, as hereinafter) cut out from the pcDNAI carrier with Hind III and NotI Restriction Enzyme, be located away from preparation type sepharose, and be connected to the corresponding site of pREP7 expression vector (Invitrogen).With this contain pFlt4-L insert segmental pREP7 carrier with the calcium phosphate transfection method transfection to 293-EBNA cell (Invitrogen) people such as (, 1989) Samnbrook.After the transfection about 48 hours, the substratum of institute's transfectional cell is forwarded in the DMEM substratum of no foetal calf serum and cultivated 36 hours.Then, centrifugal 20 minutes of 5000 * g to be collecting this conditioned medium, with Centriprep10 (Amicon) with 5 times of supernatant concentration and be used for stimulating and express LTRFlt4l (the NIH3T3 cell of Flt4 acceptor is shown in embodiment 4.With this lysis, detect by the Western trace with anti-Flt4 antiserum(antisera) immunoprecipitation and with anti-phosphotyrosine antibody.

Compare with the substratum that comes from the simulation transfectional cell of the Flt4 receptor phosphorylation that only provides background level, the conditioned medium that comes from two different plates of transfectional cell stimulates the Flt4 autophosphorylation.When this spissated conditioned medium with 20 μ l be coupled to the Flt4EC district suspension preabsorption of Sepharose the time (seeing embodiment 4), do not reach phosphorylation, thereby show the active part of Flt4 really that causes the Flt4 autophosphorylation.Therefore, these results prove that the expression vector that has the insertion fragment of about 2.1kb and contain just like the open reading frame shown in the sequence 32 can be expressed as a kind of bioactive Flt4 part (VEGF-C) in institute's transfectional cell.By this open reading.The sequence of frame coding is shown in sequence 33.

The molecular weight of inferring of the polypeptide of being made up of whole aminoacid sequences (residue 1-419) of sequence 33 is 46,883.The molecular weight of inferring of the polypeptide of being made up of the 103-419 amino acids residue of sequence 33 is 35,881.The purifying of measuring with the SDS-PAGE that goes back ortho states is about 23KD in the molecular weight of the Flt4 of PC-3 culture part.Therefore, obviously be that this Flt4 ligand mRNA has been translated into polypeptide precursor, and can precursor-derivedly go out sophisticated part from this by proteolytic cleavage.This Flt4 part also can connect the glycosylation site glycosylations at three N-of inferring, this site with can be identical at the consensus sequence of the Flt4 part aminoacid sequence of inferring (the N-residue of ruling among Figure 10).

Compare with other part of this family, the C-terminal aminoacid sequence performance that can increase the predetermined molecular weight of the Flt4 part subunit people that sends as an envoy to remembers that Balbiani encircles the interval mode of the cysteine residues of 3 albumen (BR3P) sequence (people such as Dignam, gene, 88:133-140 (1990)), as shown in Figure 9.This sequence can encode be present in the Flt4 ligand precursor one independently folding region and can with such as the secretion of regulating the Flt4 part, solvability, stability, cell surface location or active relevant.What is interesting is, in VEGF C-terminal aminoacid sequence, also found at least one halfcystine motif of this BR3P type.

Therefore, as if this Flt4 ligand mRNA is at first translated into and is come from the precursor that inserts the mRNA of fragment correspondence with plasmid Flt4-1 cDNA, therefrom can derive this sophisticated part by proteolytic cleavage.Be this sophisticated Flt4 ligand polypeptide of definition, have the people at first in such as the cell of COS cell, to express this cDNA clone (being deposited on pc DNAI expression vector).The anti-encoded polypeptides of human is arranged, and fragment, perhaps bacterium Flt4 fusion rotein produces the amino of anti-VEGF-homologous region and Flt4 part-and the antibody of carboxyl-terminal polypeptide as the antibody of GST-fusion rotein.Then, after the Flt4 part biosynthesizing of people in institute's transfectional cell being arranged and processing, with this cell of radioactivity halfcystine mark, pulse-chase analysis is carried out in immunoprecipitation and gel electrophoresis.Insert the antibody in three districts of the product of fragment coding with anti-cDNA, isolate the material of the N-terminal sequential analysis that is used for radioactivity or non-radioactive line by plasmid FLT4-L.The mensuration of the N-terminal sequence of this sophisticated VEGF-C polypeptide can be used to identify this N-terminal proteolytic enzyme processing site.The aminoterminal mensuration of this C-terminal propetide will provide C-terminal processing site.This can be by stoping confirming at the adjacent amino acid residue place of cleavage site site-directed mutagenesis that enzyme cuts.

This Flt4 part also can be described by the gradual 3 ' disappearance in 3 ' encoding sequence of this Flt4 ligand precursor clone, and it has introduced a terminator that causes that its protein product C-terminal blocks.This year disconnected type active following mensuration: for example, when the cell culture that is applied to such as the NIH3T3 cell of expressing LTRFlt4, study this and block the protein induced Flt4 autophosphorylation of type.Structural research extrapolation by relevant Thr6 PDGF BB, someone thinks that the key area by the receptor activation of Flt4 part is contained in proteic about 180 the amino-acid residue (sequences 33 of the secretor type VEGF-C that lacks 102 amino acid leader sequences of inferring, the 103-282 residue, and obviously be contained in about 120 amino-acid residues (sequence 33,103-223 residue).

On the other hand, the different amounts between the molecular weight of the part determining molecular weight of this purifying and the open reading frame derivation of cloning from this Flt4 part are because this solvable part results from the alternatively spliced mRNA that can present the PC-3 of this isolating ligands of deriving cell.For separating this variable cDNA clone, have human the clone of preservation the cDNA fragment with according to the PCR primer of the sequence preparation that provides and the ordinary skill in the art is separated from the PC-3 cell cdna library or the variable cDNAs that increases.The primer amplification that can also use (RT)-PCR directly from this PC-3mRNA, to provide in the cDNA insertion fragments sequence with plasmid FLT4-L.From the cDNA clone of gained, measure variable cDNA sequence.Can also from the human gene group DNA library, separate corresponding to the genomic clone of Flt4 ligand mRNA transcription and check order this clone or its subclone fragment to detect corresponding exon with the ordinary method of this area.Then, variable exon can be identified with many this areas ordinary method (as the cDNA that describes subsequently and the heteroduple analysis of genomic dna).

Embodiment 12

The expression of coding VEGF-C gene in human tumor cell line

Corresponding to the expression of the transcription of Flt4 part (VEGF-C) can by contain come from HT-1080 and PC-3 human tumor cell line separate poly (A) ⁺The Northern blot hybridization and detect.Probe is radiolabeled 2.1kb cDNA clone's insertion fragment (pFlt4-L/VEGF-C, a specific activity 10 ⁸-10 ⁹Cpm/mg DNA).Use 50% methane amide, 5 * SSPE damping fluid, 2%SDS, 10 * Denhardt ' s liquid, 100ng/ml salmon sperm DNA and 1 * 10 ⁶Cpm label probe/ml is hybridized this trace down at 42 ℃ and is spent the night.Successively respectively with the 2 * SSC that contains 0.05%SDS and 0.1 * SSC of containing 0.1%SDS at room temperature and 52 ℃ this trace of washing 2 * 30 minutes and 2 * 20 minutes down.Then, usefulness intensifying screen and Kodak XAR film descended these traces of exposure three days at-70 ℃.Two clones are all expressed Flt4 ligand mRNA (about 2.4kb) and VEGF and VEGF-B mRNAs (Figure 12).

Embodiment 13

The VEGF-C chain is closed by proteolytic cleavage processing and disulfide linkage after biosynthesizing

As what infer from the VEGF-C open reading frame, the predicted molecular weight of secretor type people VEGF-C polypeptide is 46,883KD points out this VEGF-C mRNA can at first translate into a precursor, and can generate the part of 21/23KD and 29/32KD by proteolytic cleavage from this precursor.

This possibility can be by metabolic marker the 293EBNA cell of VEGF expression-C study.At first, with VEGF-C construct transfection 293EBNA cell.By adding 100 μ Ci/mlPro-mix ^TML-[ ³⁵S] cell in vitro mark miscellany ((contains ³⁵S-Met and ³⁵S-Cys) Amersham, Backinghamslior is England) in the substratum of no Cys and Met and this expression product of mark.After two hours, wash this cellular layer twice, replace this substratum with DMEM-0.2%BSA then with PBS.Cultivate 1 subsequently, 3, after 6,12 and 24 hours, collect this substratum, centrifugal clarification also concentrates, and people VEGF-C is attached to the Flt4EC-Sepharose suspension of 30 μ l and spends the night under+4 °, and it is inferior to give a baby a bath on the third day after its birth in PBS subsequently, at 20mM Tris-HCl (pH7.5) washing secondary, alkanisation, SDS-PAGE and radioautograph.Alkanisation is by with 10mM 1, and (Boehringer-Mannheim, Mannheim Germany) handled 1 hour down at 25 ℃ the 4-dithiothreitol (DTT), and (Fluka, Buchs Switzerland) handle and carry out to use the 30mM iodo-acid amide subsequently.

The precursor polypeptide of the 32KD apparent molecular weight that these experiment confirms are inferred is incorporated into from the generation of personnel selection VEGF-C expression vector (Figure 13 A) transfection and penetrates on the Flt4 EC affinity matrix of conditioned medium of labeled cell, and debond comes self simulation (M) cells transfected in those.The increasing amount of a 23KD receptors bind polypeptide was accumulated in the substratum of VEGF-C transfectional cell in three hours tracking phases subsequently, but after this then there is not (swimming lane 2-4, produce data not), point out this 23KD type to produce, and this processing is incomplete in the transient transfection cell at least by proteolytic cleavage processing.The arrow of Figure 13 A is indicated the secretor type VEGF-C polypeptide of this 32KD and 23KD.Experiment subsequently shows that this 32KDVEGF-C type contains just like 29 and two compositions (Figure 21-23) that move of 32KD polypeptide under no alkylation.

In a relevant experiment, will detect (Figure 13 B) by the PAGE under non-reduced attitude at the isolating people VEGF-C of the Flt4 EC-Sepharose behind 4 hours the continuous metabolic marker.Under non-reduced attitude, determine bigger molecular weight, point out this VEGF-C polypeptide can form disulfide linkage and close dimer and/or polymer (Figure 13 B arrow).

Embodiment 14

VEGF-C stimulates the VEGFR-2 autophosphorylation

The conditioned medium that comes from the 293EBNA cell (CM) of personnel selection VEGF-C carrier transfection also is used to stimulate VEGF expression R-2 (Kdr) pig arterial endothelium (PAE) cell.People such as Pajusola, journal of biological chemistry, 269:26988-26995 (1994).With this lysis and with VEGFR-2 specific antisera immunoprecipitation people such as (, 1994) Waltenberger.

With PAE-KDR cell people such as (, 1994) Waltenberger growth in Ham ' s F12 substratum-10% foetal calf serum (FCS).With the NIH 3T3-Flt4 cell that is paved with or PAE-KDR cell hungry overnight incubation in DMEM that is supplemented with 0.2%BSA or Hams F12 substratum respectively, then, with detecting culture medium culturing 5 minutes.Recombinant human VEGF (P﹠amp as stimulant; D system) and PDGF-BB with comparing.Wash this cell twice and containing the 1mM phenylmethylsulfonyl fluoride, cracking in the RIPA damping fluid of 0.1U/ml aprotinin and the positive sodium vanadate of 1mM with the ice-cold Tris buffering salt (TBS) that contains the positive sodium vanadate of 100mM.With this lysate sonication, centrifugal 20 minutes of 16,000 * g clarification and with 3-5 μ l Flt4 (Pajusola etc., 1993), VEGFR-2 or PDGFR-β (people such as Claesson-Welsh, journal of biological chemistry, 264: 1742-1747 (1989); People such as Waltenberger, 1994) specific antisera was cultivated on ice 3-6 hour.This immunoprecipitate is incorporated into albumin A-Sepharose, and with containing 1mM PMSF, the RIPA damping fluid washing of the positive sodium vanadate of 1mM three times is used 10mM Tris-HCl (pH 7.4) washed twice, and is carried out SDS-PAGE with 7% gel.Forward to polypeptide on the nitrocellulose filter and use PY by the Western trace ₂₀Tyrosine O-phosphate-monoclonal antibody specific (Tranduction Laboratories) or acceptor-specific antisera and ECL detection method (Amersham company) detect.

This experimental result is shown in Figure 14 A and 14B.Shown in Figure 14 A, the PAE cell of VEGF expression R-2 is with 10-or 2 times of spissated substratum that come from the 293-EBNA cell (swimming lane 1 and 2) of simulation-transfection, or with 2,5-or 10 times of spissated express recombinant VEGF-C swimming lane 3-6 that come from) the 293-EBNA cytositimulation.Detect with this VEGFR-2 of specific antibody immunoprecipitation and by SDS-PAGE and Western trace (use phosphotyrosine antibody).For the purpose of contrast, stimulate with the reorganization VEGF that contains the 50ng/ml purifying (the swimming lane 7 and 8) substratum of non-reduced attitude.Swimming lane 6 and 7 shows with VEGF-C or contains the stimulation with Flt4EC pretreated substratum of VEGF.As shown in Figure 14B, with non-reduced substratum (swimming lane 1), 5 times spissated is derived from the CM of the cell of simulation transfection (swimming lane 2) or VEGF-C transfection (swimming lane 3 and 4), or with the NIH 3T3 cell of the non-condition attitude substratum stimulation PDGF-B expression R-β that contains 50ng/ml recombinant human PDGF-BB (swimming lane 5).Also contain the substratum of VEGF-C with reorganization Flt4 EC (swimming lane 4) pre-treatment.With specific antibody immunoprecipitation PDGFR-β and the Western trace by SDS-PAGE and antibody with Tyrosine O-phosphate and peel off subsequently and heavily survey detection with PDGFR-β specific antibody.

Be referenced to Figure 14 A again, in by the CM stimulated cells that comes from the simulation cells transfected, detect the tyrosine phosphorylation of the VEGFR-2 of basal level.Further concentrate the slight increase that this substratum only causes VEGFR-2 phosphorylation ( swimming lane 1 and 2).The CM that contains the VEGF-C that recombinates stimulates the tyrosine phosphorylation of VEGF-2 and the intensity of autophosphorylation polypeptid belt also concentrates along with VEGF-CCM and increase (swimming lane 3-5).In addition, after with Flt4 EC affinity matrix (relatively swimming lane 1,5 and 6) this substratum of pre-treatment, it has lost effect of stimulation.VEGF-C maximum effect in this test can be equivalent to join with the concentration of 50ng/ml the reorganization VEGF effect (swimming lane 8) of non-conditioned medium.The substratum that contains VEGF with Flt4 EC pre-treatment is not removed its effect that stimulates VEGFR-2 (relatively swimming lane 7 and 8).This VEGF-C expression vector of these results suggest Flt4 (VEGFR-3) part VEGFR-2 (Kdr) part of also encoding of not only encoding.

For further confirming that VEGF-C is an acceptor-specific to the stimulatory effect of the tyrosine phosphorylation of VEGFR-3 and VEGFR-2, our inspection then VEGF-C to the effect of great expression in the tyrosine phosphorylation of fibroblastic pdgf receptor β (PDGFR-β).By Figure 14 B as seen, detect based on the weak tyrosine phosphorylation (relatively swimming lane 1 and 2) of the CM that comes from the simulation transfectional cell the PDGFR-β of the stimulation of the NIH 3T3 cell of expressing Flt4.When be derived from through or when the CM of the pretreated VEGF-C cells transfected of Flt4 EC cultivates this cell, can observe similar low-level PDGFR-β phosphorylation ( swimming lane 3 and 4).On the contrary, the significant tyrosine phosphorylation of PDGFR-β (swimming lane 5) has been brought out in the adding of 50ng/ml PDGF-BB.

Embodiment 15

The VEGF-C stimulating endothelial cell moves in collagen gel

Be placed in the hole made in the collagen gel and be used for the migration of stimulation capillary endothelial as mentioned below (BCE) cell in three-dimensional collencyte being derived from conditioned medium (CM) with the carrier cells transfected culture of VEGF expression-C.

BCE cell (people such as Folkman, institute of NAS periodical, 76:5217-5221 (1979)) as people such as Pertovaara, cultivate described in the 269:6271-74 (1994) by journal of biological chemistry.This collagen gel is to mix by the MEM that type i collagen stock solution (5mg/ml is in 1mMHCl) and same volume 2 * MEM and 2 times of volumes are contained 10% new-born calf serum to prepare to reach collagen final concentration 1.25mg/ml.Make to cover to carry out with about 1mm thick-layer and cover this tissue culture plate at 37 ℃ of these solution of following polymeric.At the top of this layer inoculation BCE cell.Detect about migration, can allow this cell attachment in the inwall of the plastic hoop (diameter 1cm) on the top that places this first collagen layer.After 30 minutes, remove decyclization and rinsing and remove the cell that do not adhere to.Add second layer collagen and one deck by 0.75% low melting point agar (FMC biological product, Rockland, ME) solidified growth medium (5% new-born calf serum (NCS)).Pass all layers in the both sides of this cell spot with the distance of 4mm and make a call to a hole (diameter 3mm), move into sample or control medium every day in this hole.After six days, with the Photomicrograph that Olympus CK 2 inverted microscopes that differ the light microscopic sheet take the cell that shifts out spot edge is housed.(1mg/ml, Hoechst 33258, Sigma) behind the dyeing nucleic acid, count this migrating cell with fluorescence dye dibenzo imide.

Figure 15 is shown in and adds substratum after six days, from the initial zone of adhering to containing (simulating by non-transfection (contrast) or transfection; VEGF-C; VEGF) the quantity contrast of the cell of the different distance migration in the hole of the substratum of cell adjusting.Fluorescent microscope with Optics in Microscope lens grid and 10 * amplification is counted the cell number of moving out from initial attachment band in 5 adjacent 0.5mm * 0.5mm squares.By count the cell that migration surpasses 0.5mm in a similar manner with these grid of every moved further of 0.5mm.Carry out this experiment twice and obtain similar result, and the intermediate value of an experiment is represented with the standard deviation histogram.From this histogram as seen, contain the CM on cell migration hormesis of VEGF-C above the substratum of regulating by non-transfection or simulation transfectional cell but not as coming from substratum with vegf expression carrier cells transfected.Stimulate with the CM that comes from the VEGF cells transfected and to compare, add the migration that 1ng FGF2 has caused the cell of about two quantity in this hole every day.

Embodiment 16

VEGF expression-C in a plurality of tissues

Contain the poly (A) that 2 μ g are located away from a plurality of human tissues ⁺(trace of company of clontech laboratories, Palo Alto CA) insert fragment with radiolabeled 2.1kb VEGF-CcDNA and survey the Northern trace of RNA.Northern trace and hybridization analysis show this 2.4kb RNA and a small amount of 2.0kb mRNA in a plurality of human tissues, and especially significantly at heart, placenta is expressed in the muscle, ovary and small intestine (Figure 16 A).VEGF-C RNA seldom sees brain, in liver or the thymus gland, and is negative in peripheral blood leucocyte (PBL).The RNA of analyst fetal tissue (Figure 16 B) shows that VEGF-C then is lower level at kidney and the expression of lung camber at liver similarly, and detects not expression basically in brain.Be enjoyably, it is relevant that vegf expression organizes neutralize VEGF-C to express at these, and VEGF-B expresses at the camber of organizing of all detections.

Embodiment 17

The VEGF-C assignment of genes gene mapping is in karyomit(e) 4q34

The DNA series that has kept somatic hybridization body between 24 kinds of one or two human chromosome is used for this VEGF-C gene (Bios Laboratories, Inc., New Haven, chromosomal localization CT).The design primer comes from about 250bp VEGF-C gene fragment of somatic hybridization body DNA with amplification.For VEGF-C, PCR primer and condition 5 '-TGAGTGATTTGTAGCTGCTGTG-3 ' (forward) [sequence 34] and 5 '-TATTGCAGCAACCCCCACATCT-3 ' (oppositely) [sequence 35] (94 ℃, 60s/62 ℃, 45s/72 ℃, 60s).The PCR product is by 1% agarose gel electrophoresis and ethidium bromide staining and observe under ultraviolet lamp.[α- ³²P]-cDNA of the plasmid of the complete VEGF-C coding region of the representative of dCTP mark inserts fragment as the probe (Bios Laboratories) in the hybridization analysis of Sonthern trace shown in specification sheets and somatic hybridization body DNAs.

(Rockville, MD) the Southern trace by the EcoRI dna digestion confirms purifying P with VEGF-C cDNA hybridization to the clone that is used for fluorescence in situ hybridization (FISH) subsequently available from ATCC ₁(St.Louis MO) is male to clone strain 7660 and 7661 (VEGF-C) for Genome Systems, Inc..Then, use vitamin H-11-dUTP according to conventional methods, vitamin H-14-ATP (Sigma ChemicalCo., St.Louis, MO) or ground high rate aglucon 11-dUTP (Boehringer Mannheim GmbH, Mannheim is Germany) by this P of nick translation mark ₁The clone.With 5-bromouracil deoxyribose (BrdU) in early days duplicate stage handle peripheral blood lymphocyte culture that PHA-stimulates to induce the G band.See people such as Takahashi, " human genetics " (Human Genet), 86:14-16 (1995); People such as Lemieux, Cytogenet.Cell genet., 59:311-12 (1992).Be dissolved in 50% methane amide of 2 * SSC, carrying out this FISH step with known method in 10% dextran sulfate.See as people such as Rytk nnen, Cytogenet Cell Genet., 68:61-63 (1995); People such as Lichter, institute of NAS periodical, 85:9664-68 (1988).(BRL, Gaithersburg MD) suppress this tumor-necrosis factor glycoproteins compared with the Cet-1DNA that crosses 50 times with the probe with mark.By in the anti-ground of mark high rate aglucon antibody, cultivating the slide glass of this hybridization, use 0.1mmol/L 4 subsequently, 6-diamino-2-phenylindone is redyed and is detected special and hybridization signal.The probe in detecting of double-colored experiment is by at fluorescein isothiocyanate (FITC)-anti--ground high rate aglucon antibody (Sigma Chemical Co.) and texas Red-avidin (Vector Laboratories, BurlingaMe, CA) or rhodamine-cultivate this slide glass in anti--ground high rate aglucon and the FITC-avidin and carry out.

The analysis of polychrome digital imagery is used to obtain, and shows the hybridization signal with quantitative Metaphase Chromosome.This system comprise the PXL camera that is connected in PowerMac 7100/AV workstation (Photometrics Inc., Tucson, AZ).This camera operation of IPLab software control, image are obtained and Ludl filter wheel.At least 50 nuclears have been counted.Overlap kernel and cell mass have been ignored.Comprise that in each experiment a slide glass that contains diffusion in mid-term of normal lymphocyte and energic nucleus is with validity and specific contrast as this hybridization.

In order to measure the location of people VEGF-C gene on karyomit(e), measure the DNAs of the somatic hybridization body of the people of the human chromosome that contains certain tricks and rodents with Southern trace and VEGF-C cDNA probe hybridization.In 24 DNA samples of the human chromosomal that the representative on this crossbred series is different, only in the crossbred that contains human chromosomal 4, observed the human specific signal.PCR in order to the somatic hybridization body DNAs of VEGF-C Auele Specific Primer has confirmed this result, and wherein amplified band only comes the DNAs of self-contained human chromosomal 4.

The genome P of VEGF-C ₁Plasmid separates with PCR by Auele Specific Primer and by the Southern trace with the hybridization of VEGF-C specificity cDNA probe confirmation.FISH further studies the chromosomal localization of VEGF-C with mid-term.In FISH, use the P of VEGF-C ₁Probe, can 44 medium cells 40 in detect specific hybrid to the 4q34 chromosome band.Show that with two fluorescence dyes hybridization of the specificity clay nuclear probe of aspartoyl glucosamine enzyme (AGA) gene VEGF-C just is positioned to be marked in the past the ortho position of the AGA gene of 4q34-35 chromosome band.

With biotin labeled VEGF-C P ₁AGA clay probe while and Metaphase Chromosome hybridization with the digoxigenin mark.This AGA gene of this experiment confirm is more located on telomere ground than VEGF-C gene.Previous embodiment confirm polypeptide of the present invention as the application of chromosomal marker thing and the application that in normal or disease cell, has or do not have the VEGF-C gene regions.The site of this VEGF-C on 4q34 also is candidate's target of the sudden change of energy hyperamization pipe deformity or cardiovascular diseases.

Embodiment 18

Glucose concn and hypoxemia be to VEGF in the C6 glioblastoma cell, the influence of VEGF-B and VEGF-C mRNA level.

In the tissue culturing plate of the diameter 10cm that contains 2.5ml DMEM and 5%FCS added with antibiotic, cultivate C6 cell (the ATCC CCL 107) culture that is paved with.This culture is exposed to contains 5%CO ₂The normal oxygen level of normal cell incubator in or by with sealing substratum in the sealed glass pipe and the wood that burns therein until it because in low oxygen content that anoxic is extinguished 16 hours.Separate poly+RNA (as other embodiment), and 8 μ g RNA electrophoresis are also used VEGF, VEGF-B and VEGF-C probe miscellany (seeing Figure 12) blot hybridization.The result shows that hypoxemia is can both bring out VEGF-mRNA consumingly to express in low and high glucose, but VEGF-B mRNA level is not had obvious influence.Be located away from fast slightly and fast slightly additionally being common under the mRNA band of upper end of moving of VEGF-C mRNA swimming in gel electrophoresis of hypoxic cell.This result shows that hypoxemia influences VEGF-C RNA processing.Someone is thereby that VEGF-C mRNA montage is changed and influences the VEGF-C open reading frame and cause hypoxic cell to produce variable VEGF-C albumen to the explanation of this observations.The changeable type of these VEGF-C and coding VEGF-C polynucleotide are also as one aspect of the present invention.This result has shown the screening and the diagnostic use of polynucleotide of the present invention and polypeptide, as the hypoxemia of screening VEGF-C and/or VEGF-C mRNA from a biological sample-bring out type method.The result also points out the antibody that the hypoxemia of VEGF-C brings out type or normal type and/or the treatment index of other inhibitor.

Embodiment 19

Be derived from the pulse-tracking mark and the immunoprecipitation of the VEGF-C polypeptide of the 293 EBNA cells of using the transfection of VEGF-C expression vector

The VEGF-C branch N-terminal peptide of the synthetic following PAM of being called 126 is in order to prepare anti-VEGF-C antiserum(antisera):

NH ₂-E-E-T-I-K-F-A-A-A-H-Y-N-T-E-I-L-K-COOH (sequence 39).

Especially, synthetic PAM 126 is as many Methionin of the branch structure K3PA4 with four peptide acid (PA) chain that is connected to two effective Methionins (K) residue.(RAPP Polymere GmbH, Tubingen Germany) carry out this and synthesize on 433A peptide synthesizer (Applied Biosystems), obtain can cutting and resin-binding peptide with Fmoc-chemistry and TentaGel S MAPRAM 10 resin compounds.By the reversed-phase HPLC purifying this can cut peptide and and resin-binding peptide one be used from immunity.The exactness of this synthetic product confirms with mass spectrum (Lasermatt).

These PAM 126 peptides are dissolved in phosphate buffered saline buffer (PBS), and and the agent of Freund ' s peptide be mixed for ordinary method by this area with two weekly interval immunize rabbits (Harlow and Lane, antibody, laboratory manual, press of cold spring harbor laboratory (1988).The antiserum(antisera) of gained is used for immunoprecipitation VEGF-C behind four booster immunizations in following pulse chase experiment.

Detect for pulse-chase, with the 293EBNA cell of VEGF-C expression vector (being that FLT4-L cDNA is inserted in above-mentioned pREP 7 expression vectors) institute's transfection at no Met, no Cys, in the serum-free DMEM substratum in 37 ℃ times cultivations 30 minutes.Then, change this substratum, and add the Pro-mix of 200 μ Ci ^TM(Amersham).This cellular layer was cultivated two hours in this mark substratum,, and in serum-free DMEM (tracking), cultivated 0,15,30,60,90,120 with the PBS washing, or 180 minutes.After each tracking time, collect substratum, this cell twice of washing in PBS, and cracking in the immunoprecipitation damping fluid again.With the NH that causes anti-23KD VEGF-C type ₂The VEGF-C specific antisera of-end peptide (PAM 126) detects the VEGF-C polypeptide in substratum and cell lysate.Follow the polypeptide that radioautograph detects immunoprecipitation by SDS-PAGE.

With reference to Figure 19, the radioautograph of gained shows that this VEGF-C carrier cell transformed contains the 55KD polypeptid belt of a radioactivity behind 2 hour-symbols (tracking time 0) just, and it does not see in the simulation transfectional cell (M).Along with the increase of the time of tracking, the intensity of this 55KD polypeptid belt weakens gradually, and does not detect in the cell of following the trail of in 180 minutes.In the VEGF-C cells transfected, also observed a 32KD polypeptid belt (and not seeing the simulation transfectional cell).This 32KD band is to disappear with similar kinetics with 55KD.Simultaneously, 32KD of increasing amount (arrow) and 23KD subsequently (arrow) and 14KD polypeptide come across in this substratum.

In a word, the result of pulse chase experiment show in these 55KD born of the same parents polypeptide represent the acellular excretory before-the VEGF-C polypeptide, it at first is cut into the 32KD type by proteolytic enzyme.This 32KD type is secreted and simultaneously further proteolytic enzyme is processed into 23KD and 14KD type.Be not to be intended to be confined to a certain specific theory, the processing that it is believed that this VEGF-C precursor is to remove signal sequence, remove this COOH-end region (BR3P), and the form appearance of removing the N-terminal polypeptide, TEE had with aminoterminal VEGF-C polypeptide thereby produce.

Under high-resolution situation, this 23KD polypeptid belt exists with closely spaced polypeptide doublet form, the heterogeneity in prompting cutting or the glycosylation.

Embodiment 20

The mouse of coding VEGF-C and quail cDNA clone separate

In order to clone VEGF-C mouse variant, about 1 * 10 of 12 days mouse embryo cDNA libraries (λ EXlox library, Novagen, classification number 69632-1) that can buy with the radiolabeled people VEGF-C cDNA fragment screening that contains the 495-1661 position Nucleotide of sequence 32 ⁶Lambda particles phage λ clone strain.Isolate a positive clone strain.

Isolating mouse cDNA clone's the segmental 1323bp EcoRI/HindIII fragment subclone of insertion is also checked order to the corresponding site of pBluescript SK+ carrier (Stratagene).5 ' terminal sequence of about 710bp that this clone's cDNA sequence exists in nobody clone in mouse clone, other and people VEGF-C sequence homology.

Be further screening mouse cDNA library, with come from mouse cDNA clone the coding region 881bp Hind III-BstXI (being derived from the Hind III site of pBluescript SK+ polylinker) fragment radio-labeled and screen two other mouse cDNA library as probe.Evaluation comes from two other cDNA clone in adult rats heart ZAP II cDNA library (Stratagene, classification number 936306).Also from rat heart 5 '-extend-+three other clone strains are separated in the cDNA library in λ gt11 (Clontech laboratory company, coding 936306).In three clones afterwards, find to have an insertion fragment that contains the 1.9kb that has an appointment.To the CcoRI site of pBluescript SK+ carrier and two chains of this clone are all checked order fully, the Nucleotide that obtains and the aminoacid sequence of promotion are shown in sequence 40 and 41 with this cDNA clone's insertion fragment subclone.

Can consider and to be assembled in the adult rats VEGF-C albumen with the processing mode that is similar to people VEGF-C precursor peptide corresponding to the polypeptide of sequence 41.Identify that with the method for the cleavage site of above-mentioned identifier VEGF-C polypeptide the proteic deduction of this mouse cuts the site.

Aforementioned result proves that polynucleotide of the present invention are used to identify and the purposes of separating other non-human mammal of coding VEGF-C variant.That identifies can be expressed (with being similar to the described method of front embodiment) again to produce the recombinant polypeptide corresponding to non-human mammal VEGF-C variant with isolating polynucleotide itself.

Mouse is used for designing the probe that separates quail VEGF-C cDNA from quail cDNA library with people VEGF-C sequence.The people VEGF-C cDNA fragment by specification method of the 495-1670 position Nucleotide that contains sequence 32 of pcr amplification gained is cloned into pCRII carrier (Invitrogen), and amplification.Gel electrophoresis separates this insertions fragment also again with radioactivity dCTP with cause mark at random with the preparation type with EcoRI digestion.Then, with the cDNA library that comes from E-4 stage quail embryo in this probe screening pcDNA-1 carrier.Hybridize replica filter with about 200,000 clone's bed boards and with radioactive probe.Nine positive colonies are identified also bed board for the second time.There are two in programmed screening, to hybridize among nine clones.The clone of this purifying (clone 1 and 14) has about 2.7kb EcoRI and inserts fragment.Two clones are increased and use T7 and SP6 primer (to this carrier annealing) order-checking subsequently.In addition, identify the T7 primer side about 1.9kb of the SphI restriction site of an inside apart from this carrier, use it for subclone 5 '-and 3 '-Sph I fragment, subsequently from the Sph I end order-checking of this subclone.The sequence that obtains is identical in two clones and shows similarity with people VEGF-C coding region tool height.Subsequently, to move primer and finish double-stranded sequence be to contain the long full 1743bp of open reading frame the preparation step aspect two.

The cDNA sequence of gained contains a long open reading frame and 5 ' non-translational region.This DNA and infer the aminoacid sequence of quail cDNA respectively shown in sequence 52 and 53.As shown in Figure 8, the people, mouse, and birds (quail) VEGF-C precursor aminoacid sequence shows significantly conservative degree.The homology of this height allows with polynucleotide of the present invention as probe and conventional Protocols in Molecular Biology as herein described from other species, vertebrates kind particularly, and the sequence of more particularly separating the VEGF-C that encodes in Mammals and the birds species.

Embodiment 21

The N-terminal peptide sequential analysis of reorganization VEGF-C

Reorganization VEGF-C (Figure 21 A, swimming lane IP) with VEGF-C cDNA (seeing embodiment 13) cells transfected (293 EBNA) secretion several types.When no alkylation, three kinds of main VEGF-C proteolytic enzyme processed-types are 32/29KD (diad) as the performance molecular weight in SDS-PAGE, the albumen of 21KD and 15KD and moving.Two kinds of accessory polypeptide show about 63 and the molecular weight of 52DK respectively.One of these polypeptide is assumed that glycosylated and non-processed-type; And other polypeptide is assumed that glycosylated and part processing.

For measuring the protease cutting site of this VEGF-C precursor, with immune affinity column purifying VEGF-C polypeptide from the conditioned medium of the 293EBNA cell of usefulness VEGF-C cDNA transfection.For preparing this immune affinity column, use the 104-120 amino acids corresponding to sequence 33: H ₂N-EETIKFAAAHYNTEILK (seeing the PAM 126 among the embodiment 19) synthesizes the peptide immunize rabbit.From the serum of this immunize rabbit, separate the IgG fragment with albumin A Sepharose (Pharnacia).Will this isolating IgG fragment be attached to CNBr-activatory Sepharose CL-4B (Pharmacia) with routine techniques with the concentration of 5mg IgG/ml Sepharose.This immunity affinity matrix is used for separating from 1.2 liters of conditioned mediums (CM) VEGF-C of processing.

Should be with gel electrophoresis and Western engram analysis by the purifying thing of post wash-out.The component of mixture VEGF-C polypeptide, to 10mM Tris HCl dialysis, vacuum-drying, electrotransfer to Immobilon-p (polyvinylidene difluoride (PVDF) or PVDF) transfer film (Millipore, Marlborough, MA) and carry out the-terminal amino acid sequential analysis.

The polypeptid belt of 32KD produces two different sequences: NH ₂-FESGLDLSDA ... and NH ₂-AVVMTQTPAS ... (sequence 51), VEGF-CN terminal portions behind the former corresponding this signal peptide of excision, originate in 32 amino acids (sequence 33), and the latter is corresponding to the Kappa chain of IgG, it is owing to the seepage of affinity matrix in elution process is present in the material of purifying.

In order to obtain the N-terminal peptide sequence of 29KD VEGF-C, produced the construct (VEGF-C NHis) of coding VEGF-C variant.Especially, VEGF-C variant that 6 * His marker is fused to this excretory precursor (being between 31 and 33 amino acid of sequence 33) of this construct coding.The Phe that removes 32 sites excises in secretion of VEGF-C process to prevent this possible flag sequence.VEGF-C NHis construct is cloned into pREP7 as carrier; This construct is described in greater detail among hereinafter the embodiment 28.

With the coprecipitation of calcium phosphate technology with VEGF-C NHis transfection to 293 EBNA cells.In the 15cm Tissue Culture Dish, (totally 25 flat boards) use culturing cell among the DMEM/10%FCS.Next day, with this cell renewed vaccination to the new culture dish that contains same substratum (75 flat boards) and cultivated 48 hours.Then, the DMEM substratum that once also adds no FCS with the PBS washing.Cell cultivated 48 hours and collected this substratum in this substratum, with 5000 * g centrifugal clarification, (Filtron, Northborough MA) concentrate 500 times, as described in above-mentioned embodiment 5 with Ultrasette Tangential FlowDevice.Use TALON ^TMThe affine resin of metal (Clontech Laboratories, Inc.) and the usefulness of manufacturers contain the described method of the proteic specification sheets of damping fluid purifying natural of indoles, purifying VEGF-CNHis from spissated conditioned medium.With containing 20mM Tris-HCl (pH 8.0), this albumen of eluant solution of 100mM NaCl and 200mM indoles.By detect the elution fraction of the VEGF-CNHis that contains purifying with the immunoblotting of antiserum(antisera) 882 (coming from antiserum(antisera)) with the rabbit 882 of PAM-126 polypeptide immune.The mixed component that contains VEGF-C NHis, dialysis and vacuum-drying.As shown in figure 27, because the existence of 6 * His marker of the N-terminal of such VEGF-C, the upper layer group proportion by subtraction 32KD type wild-type VEGF-C of the main diad of this VEGF-C NHis moves slowly slightly, therefore with having improved the separation of this VEGF-C NHis 32KD variant from the 29KD band among the SDS-PAGE.The purifying VEGF-C of about 15 μ g is gone back SDS-PAGE under the ortho states, and (Marlborough MA) and with the band of 29KD carries out the N-terminal amino acid sequence analysis to electrotransfer for Millipore, Inc. to Immobilon-P (PVDF) transfer film.This sequential analysis shows N-terminal sequence H ₂N-SLPAT ..., corresponding to the 228-232 amino acids of VEGF-C (sequence 33).

Sequence H has taken place in the polypeptid belt of this 21KD ₂N-AHYNTEILKS ..., corresponding to 112 amino acid whose N-terminals that originate in sequence 33.Therefore, the VEGF-C proteolytic enzyme machining position that causes the 293EBNA cell that passes through transfection of 21KD type to produce is put obvious real estate and is born in nine amino acid by the downstream of the cleavage site of the VEGF-C of PC-3 emiocytosis that cause the 23KD type.

Identical (the NH of the N-terminal of this 15KD type and 32KD type ₂-FESGLDLSDA ...).When producing reorganization VEGF-C, do not detect the 15KD type by the COS cell.This generation of pointing out this kind of is that cell lineage is specific.

Embodiment 22

The dimerization of VEGF-C and haplotype

The following analysis of VEGF-C polymer composition.Use Pro-mix L-[with pREP7 VEGF-C carrier cells transfected (293 EBNA cell) as embodiment 11 ³⁵S] metabolic marker mixture (Amersham company) metabolic marker is to the final concentration of 100uci/ml.

Abreast, also prepare and analyzed the VEGF-C mutant that is called " R102S ".Be the DNA of preparation coding VEGF-C-R102S, the Arg codon in 102 sites is replaced by the Ser codon in the sequence 33.With this VEGF-C-R102S-coding DNA transfection in the pREP7 carrier in the 293 EBNA cells and as above-mentioned expression.With antiserum(antisera) 882 (obtaining (seeing former enforcement)) and antiserum(antisera) 905 by using polypeptide immune rabbit corresponding to the 104-120 position residue of sequence 33 (by using the polypeptide corresponding to precursor VEGF-C leading part: H ₂N-ESGLDLSDAEPDAGEATAYASK (the 33-54 position residue of sequence 33) immunize rabbit and obtain) immunoprecipitation VEGF-C polypeptide.

The immunoprecipitate of each cell culture is carried out the SDS-DAGE (Figure 21 B) of non-sex change attitude.Cut out 1-6 band from this gel, in the damping fluid of the 1 * gel that contains the 200mM beta-mercaptoethanol-load, soaked 30 minutes, and carry out SDS-PAGE (21A and 12C, swimming lane 1-6) under the sex change attitude respectively.

Shown in Figure 21 A-C, the VEGF-C of each high molecular type (Figure 21 B, band 1-4) is by two monomers that pass through disulfide-bonded at least) comparison diagram 21A and 21C, swimming lane 1-4 is in the reduction gel).The main component of this 1-3 band is the dimer of 32/29KD, and two mol ratios such as 4 protein 22 wherein exist.This main 21KD type component is with monomer or by removing the homodimer form secretion (swimming lane 6 of Figure 21 A and 21C) that disulfide linkage connects.

This R102S sudden change produces one at the Asp residue of the 100th site of sequence 33 and is used for N-and connects glycosylated attachment site.Increased the apparent molecular weight of the polypeptide that contains this site in the glycosylation of this additional glycosylation site, confirmed as Figure 21 A-C and Figure 22 A-B.The polypeptide that is similar to VEGF-C with primary structure is compared, and this additional glycosylation has reduced the mobility that contains this additional glycosylation site VEGF-C-R102S type.Figure 21 A-C and Figure 22 A-B have represented to have increased apparent molecular weight corresponding to the VEGF-C-R102S polypeptide of 32KD and 15KD type wt VEGF-C, and each that shows these polypeptide all contains the glycosylation site of new introducing.Especially, corresponding to VEGF-C-R102S and 21KD type wild-type (wt) VEGF-C migration altogether on gel of the 15KD polypeptide that is derived from VEGF-C, being reflected on the gel is that it moves to the position (swimming lane 4 among comparison diagram 21A and the 21C) corresponding to bigger apparent molecular weight.

In relevant experiment, prepare and analyzed the VEGF-C mutant that another is called " R226,227S ".Be preparation coding VEGF-C-R226, the DNA of 227S is by the Arg codon of site-directed mutagenesis with 226 and 227 positions of Ser codon alternative sequence 33.With the DNA of gained be transformed into as mentioned above 293 EBNA cells and as to VEGF-C and the described similarity condition of VEGF-C-R102S under express and analyze.Be derived from VEGF expression-C-R226, in the conditioned medium of the cell of 227S, do not detecting the VEGF-C of 32KD type.The C-terminal cleavage site of these results suggest wt VEGF-C is adjacent to the residue 226 and 227 of sequence 33, and destroys to the sudden change of Ser by Arg.The mobility of the 29KD component of this diad there is not change (Figure 22 A-B) yet.

In a word, the VEGF-C type of this main processing of these Notes of Key Datas is one and is connected to the heterodimer that the 32KD polypeptide of preceding-VEGF-C (the 32-227 amino acid of sequence 33) of polypeptide of the 29KD of 228 amino acids that start from sequence 33 is formed by containing by disulfide linkage.These data also can be supported by the immunoprecipitation pattern of the VEGF-C type of antiserum(antisera) 882 and antiserum(antisera) 905 marks relatively.

When carrying out the VEGF-C immunoprecipitation with conditioned medium, two kinds of serum (882 and 905) can both be discerned part or all of three kinds in the main VEGF-C processed-type (32/29KD, 21KD and 15KD).When this conditioned medium by in the presence of the 10mM dithiothreitol (DTT) in cultivate under the room temperature reduce in two hours and subsequently by with the 25mM iodo-acid amide under room temperature when other cultivation 20 minutes and alkanisation, two kinds of antibody do not precipitate the 29KD component, though antibody 882 can also be discerned 32KD, 21KD and 15KD polypeptide.These results and this oligonucleotide be antigenic to be used for bringing out of being contained in antiserum(antisera) 882 to contain the character of antibody of oligonucleotide of 104-120 bit amino phenol residue of sequence 33 consistent.On the other hand, 905 of antibody identification 32KD and 15KD polypeptide, it comprises and is used for immunity to obtain the oligonucleotide sequence (the 35-54 amino acids of sequence 33) of antiserum(antisera) 905.Considering the mobility of 32KD and 15KD type, is similarly (Figure 23 A-B) with the immunoprecipitation result of the wide variant of R102S.The specificity of antibody 905 can not be discerned VEGF-C Δ N variant (the N-terminal polypeptide of the 32-102 position residue of striding undressed polypeptide wherein is deleted) by it and confirm.

These result of experiment prove that also this 21KD polypeptide also is found in the heterodimer of (1) and other molecule-type (seeing Figure 21 A-C and Figure 22 A-B), and (2) secrete (Figure 21 A and 21B, swimming lane 6) with monomer or by the homodimer form that non-disulfide linkage closes.

The disclosed existence that experimental results show that several types VEGF-C in the present embodiment.Can observe the monomeric variant of VEGF-C and these monomers can be based on level of glycosylation and pattern and change.In addition, detecting VEGF-C is polymer, as homology dimerization or heterodimer.The processing of VEGF-C briefly is described in Figure 18 (not showing disulfide linkage).All VEGF-C types all within the scope of the invention.

Embodiment 23

Mouse embryo's in situ hybridization

In order to analyze the distribution of VEGF-CmRNA in various cells and tissue, preparation P.C.12.5 and 14.5 mouse embryo section also detect by the in situ hybridization with the VEGF-C probe of mark.People such as the in situ hybridization of tissue slice such as V  strik, the cytobiology magazine, 128:1197-1208 (1995) is described to carry out.Mouse VEGF-C antisense RNA probes result from the segmental linearizing pBluescript of the cDNA II SK+ plasmid that contains corresponding to the 499-979 position Nucleotide of mouse VEGF-CcDNA (sequence 40) (Seratagene Inc., La Jolla, CA).Use T ₇Polysaccharase and [ ³⁵S]-RNA of UTP (Amersham) synthesizing radioactive mark.Mouse VEGF-B antisense and adopted rna probe is arranged in a similar manner from containing just like people such as Olofsson, institute of NAS periodical, mouse VEGF-B cDNA described in the 93:2576-2581 (1996) insert in the segmental linearizing pCR III plasmid synthetic.Highly strict washing 45 minutes under 65 ℃ in the solution that contains 30mMDTT and 4 * SSC.This slide glass of exposure 28 days develops and uses brazilwood extract dyeing.Be contrast, with the similar section of VEGFR-3 probe hybridization and also detected P.C.12.5 days embryos' VEGF-B mRNA.

Figure 34 A-D shows with antisense (Figure 34 A) and the dark-field (Figure 34 A-C) and the bright visual field (Figure 34 D) Photomicrograph of embryos' section in P.C.12.5 days that justice (Figure 34 C-D) VEGF-C probe surveys is arranged.Figure 34 A shows sagittal plane section on one side, VEGF-C mRNA wherein near the blood vessel that surrounds the metanephros (mn) of growing between especially outstanding in the matter.In addition, hybridization signal is also observed between the vertebra of growing (vc), and the lung of growing (lu) is in neck and the volume.Compare with the VEGF-B expression in contiguous slices (Figure 34 B), the specificity of these signals is significantly, and wherein cardiac muscle provides extremely strong signal and also detect low-level VEGF-B mRNA in other several tissues.As if two genes express among the lu and in the volume all between vc.It is no specific expressed that this VEGF-C has the hybridization of adopted probe to be presented in these structures (Figure 34 C).

Figure 35 A-D shows the contrast of VEGF-C and VEGFR-3 expression pattern in P.C.12.5 days mouse embryos' neck (wherein being positioned with the ridge artery and the cardiac vein of growing).Here it is according to long-standing Sabin, Am.J.Anat., and first lymphatic vessel of 9:43-91 (1909) theory is from the position of vein capsule spline structure germination.Shown in Figure 35 A-D, the vein capsule (Figure 35 A and 35C) that the VEGFR-3 positive (Figure 35 B and 35D) is being grown on every side between detect intensive VEGF-C signal in the matter.

Mesentery provides the intestines that have blood of growing and contains the lymphatic vessel of growing.The P.C.14.5 that is growing days mesentery is a male to VEGF-C mRNA, and it is especially expressed at some pipe (arrow among Figure 35 E-H) reticular tissue camber on every side.This signal of Figure 35 E can be in blood vessel be distinguished the false positive signal of the luminous reflectance of red blood cell.Adjacent mesenteric mesaraic VEGF-3 signal shown in Figure 35 F originates from the little kapillary of mesentery (arrow).Therefore, as if paracrine relation is arranged between the mRNA of VEGF-C generation and acceptor thereof.This data shows that VEGF-C expresses in various tissues.In addition, this expression pattern and VEGF-C have consistence at vein and the developmental effect of lymphatic vessel.And data shows that VEGF-C expresses in the non-human animal.

Embodiment 24

VEGF in fetus and adult's tissue, VEGF-B, and the detection of VEGF-C mRNA expression.

Contain 2 μ g and come from brain, lung, the Northem trace of the human fetal tissue of the poly+RNA s of liver and kidney (Clontech company) is hybridized with the mixed solution of following probe: people's total length VEGF-CcDNA inserts fragment (gene library accession number * 94216), people VEGF-B167cDNA fragment (Nucleotide 1-382, gene library accession number U148800) available from pcr amplification; And the 581bp cDNA fragment (gene library registration number X15997) that contains the people VEGF of base pair 57-638.Under stringent condition, wash trace with this area routine techniques.

Contain 2 μ g with mouse VEGF-C cDNA fragment (base pair 499-656) hybridization and come from P.C.7, the multiple Northem trace (Clontech company) of organizing of the mouse embryo of the RNAs of 11,15 and 17 days embryos' polyadenylation.Personnel selection VEGF, VEGF-B167, the probe of VEGF-C and VEGFR-3 cDNA fragment (Nucleotide 1-595; Gene library registration number X68203) the hybridization mouse Northem of mature tissue trace.

In the adult rats tissue, use the VEGF-C probe, with about 4: 1 ratio, detect the mRNA signal of 2.4kb and 2.0kb.The most tangible signal is available from lung and heart RNA, and kidney, liver, level is lower in brain and the skeletal muscle, and in spleen and the testis visible horizon is only arranged.As in human tissue, the VEGF mRNA in adult rats is expressed in fullest among lung and the heart RNA, and other sample shows the less regular movements of expressing with VFGF-C and regulates.The skeletal muscle of adult rats and heart tissue produce the highest VEGF-B mRNA level, people such as Olofsson as previously mentioned, and institute of NAS periodical, 93:2576-2581 (1996) is described.Compare with the VEGFR-3 expression, demonstrate the mRNA that also contains its homoreceptor Tyrosylprotein kinase that organizes of VEGF expression-C, though the VEGFR-3 mRNA in ripe liver is abundant unworthily.

For the VEGF-C mRNA that detects better in the embryo development procedure regulates, be located away from (P.C.7,11,15,17 days poly+RNA mouse VEGF-C probe hybridization of the various Gestation periods.These were analyzed and show that 2.4kb VEGF-C mRNA amount is that relative stability is arranged in the Gestation periods.

Embodiment 25

In people or fibrocyte substratum, regulate the VEGF member's of family mRNA by serum, il-1 and dexamethasone.

People IMR-90 or fibroblast growth are in containing 10%FCS and antibiotic DMEM substratum.This cell grows into 8% when being paved with, contain 0.5%FCS DMEM in hungry 48 hours.Then, growth medium is contained instead or do not contain 10ng/ml il-1 (IL-1) and contain or do not contain the 1mM dexamethasone and DMEM that contain 5%FCS, shown in Figure 24 A-B.Cultivate the specified time of these culture plates with these additives, and total cell RNA TRIZOL test kit (GIBCO-BRL) purifying.Total RNA that about 20 μ g are derived from each sample in 1.5% formaldehyde-sepharose as people such as Sambrook, electrophoresis in the same (1989).This gel is used for the Northern trace and clones (the 581bp cDNA that contains base pair 57-638 with the radiolabeled people of being derived from VEGF, gene library registration number 15997) insertion sheet segment DNA and people VEGF-B167 cDNA fragment (nucleosides nuclear 1-382, gene library accession number U48800) hybridization (Figure 25 B).Subsequently, survey with the radiolabeled insertion fragment that comes from VEGF-C cDNA plasmid (Figure 24 A).Use routine techniques labeled primer, as the ordinary skill of this area is understood relevant for the enzyme extension of random primer.Before transfer based on the take a picture mobility of visible 18S and 28S rRNA of the UV of the RNA of ethidium bromide staining.

Shown in Figure 24 A-B, IMR-90 cell that can be by hunger and stimulate extremely low-level VEGF-C of cell expressing and VEGF after a hour.On the contrary, visible under these conditions abundant VEGF-B mRNA signal.After stimulating in 4 hours, VEGF-C and VEGF mRNAs there are the intensive fall out effect, and in the sample that IL-1 handles, further reinforcement are arranged.As if acting on when dexamethasone exists of IL-1 be eliminated.Kept similar enhancement mode at 8 hours in the sample, but the downward modulation gradually of whole signals has all taken place in two kinds of RNA in 24 hours and 48 little up-to-date styles.On the contrary, VEGF-B mRNA level was kept constant and therefore express tangible stability in the whole time period.This result is used for instructing use VEGF-C and fragment thereof, its antagonist, and the trial of anti-VEGF-multiple disease method of C Antybody therapy.

Embodiment 26

Expression and the detection of reorganization mouse VEGF-C

The receptor-binding characteristic that this mouse VEGF-C cDNA is expressed as recombinant protein and has detected this secretory protein.Study the combination of mouse VEGF-C by the Bosc23 cell culture medium that is used in the VEGF-C cDNA transfection in the retroviral vector to human VEGFR-3-3 extracellular region.

1.8kb mouse VEGF-C cDNA express to carry among the pBabe-puro [people such as Morgenstern as the EcoRI fragment cloning to the retrovirus that contains SV 40 early promoter districts, nucleic acids research, 18:3587-3595 (1990)], and by the transfection of calcium phosphate precipitation method to the Bosc23 package cell line (people such as Pearet, the periodical 90:8392-8396 (1994) of institute of NAS].Be contrast, Bosc 23 cells are also used aforesaid people VEGF-C construct transfection in the pREP7 expression vector.This transfectional cell was cultivated before metabolic marker 48 hours.Change cell the DMEM substratum of no Cys and Met over to, and after cultivation and substratum are changed 45 minutes in advance, in same substratum, be about to Pro-mix ^TML-[ ³⁵S] mixture (Amersham company) of cell in vitro mark is added to the about 120 μ Ci/mlo of final concentration and cultivates after 6 hours, collects substratum and centrifugal clarification.

For carrying out immunoprecipitation, 1ml recombinated each equal portions of bouillon-like of metabolic marker Bosc23 cell of VEGF-C transfection with terminal 17 the amino acid oligopeptides (H of the anti-adult of 2 μ l VEGF-CN-with empty carrier or mouse or people respectively ₂N-EETIKFAAAHYNTEILK) the rabbit polyclonal antiserum(antisera) of (sequence 33,104-120 residue) is in overnight incubation on ice.Then, under 4 ℃, gently stirred this sample of cultivation 40 minutes with albumin A Sepharose.Be taken up in order of priority with immunoprecipitation damping fluid and 20mM Tris-HCl twice and four times of pH 7.4 these Sepharose grain of washing.In the Laemmli damping fluid, boil this sample and pass through 12.5% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis.

The VEGF-C immunoprecipitation of the substratum of transfection and metabolic marker cell has shown about 30-32 * 10 ³Mr (diad) and 22-23 * 10 ³The band of Mr in 12.5%SDS-PAGE.Simulate in non-transfection or as Figure 32 in transfection (promptly indicating the swimming lane of " carrier ") the cell sample and do not detect these bands.These results show that the antibody capable of anti-people VEGF-C discerns corresponding mouse part.

Corresponding receptors bind experiment, with covalent coupling to the VEGFR-3 extracellular region (seeing example 3) of Sepharose under 4 ℃ slightly mixed culture 1ml be derived from the equal portions 4 hours of the substratum of metabolic marker Bosc23 cell.Wash this Sepharose grain four times with ice-cold PBS, and by people such as gel electrophoresis such as Joukov, " European molecular biology federation magazine " (EMBOJ), analyzed shown in the 15:290-298 (1996).

As seen from Figure 32, compare with immunoprecipitation experiment, in the receptors bind experiment, obtained similar 30-32 * 10 ³Mr diad and 22-23 * 10 ³The Mr polypeptid belt.Therefore, mouse VEGF-C is incorporated into human VEGFR-3-3.(residue H88-E91 Figure 31) may cause the fast slightly mobility of mouse VEGF-C polypeptide to the difference of four amino-acid residues that sequential analysis obtains.

Also studied the ability that mouse reorganization VEGF-C brings out the VEGFR-3 autophosphorylation.As for the experiment of VEGFR-3 receptor for stimulating, hunger is spent the night in the substratum of the NIH 3T3-Flt4 cell that the Asia is paved with (Pajusola etc., oncogene, 9:3545-3555 (1994)) serum-free containing 0.2%BSA.Usually, this cell stimulated 5 minutes with the conditioned medium that comes from VEGF-C carrier cells transfected, with the ice PBS washing that contains 200 μ m alum salts three times, and cracking in the RIPA of immunoprecipitation analysis damping fluid.Cultivate with centrifugal this lysate of 16000 * g 25 minutes and with specific antisera this gained supernatant liquor was cultivated on ice 2 hours, again with albumin A-Sepharose immunoprecipitation and in 7%SDS-PAGE, analyze.This polypeptide forwarded on the nitrocellulose filter and with anti-Tyrosine O-phosphate (Transduction laboratory) and antireceptor antibody immunoblotting assay, as Pajusola etc., oncogene, 9:3545-3555 (1994) is described.100mM 2 mercapto ethanol under 50 ℃, 2%SDS, 62.5mM Tris-HCl carries out filter membrane and peels off by stirring once in a while among the pH 6.7.Experimental result as shown in figure 33.The substratum that result's proof contains mouse VEGF-C stimulates the autophosphorylation of VEGFR-3 to cross the degree of alum salts to being equivalent to people baculovirus VEGF-C or tyrosyl inhibitors of phosphatases.

VEGFR-2 stimulates the [people such as Walten berger of research in expressing K dr (VEGF-2) pig arterial endothelium (PAE) cell (PAE-VEGFR-2) that the Asia is paved with, journal of biological chemistry, 269:26988-26995 (1994)], it is that hunger is spent the night in containing the serum free medium of 0.2%BSA.Stimulate and prepare lysate as above-mentioned,, used the specific antisera [people such as Waltenberger, journal of biological chemistry, 269:26988-26995 (1994)] of VEGFR-2 for carrying out in the acceptor immunoprecipitation.In 7%SDS-PAEG, detect this immunoprecipitate as above-mentioned at VEGFR-3, carry out the Western trace with anti-phosphotyrosine antibody subsequently, peel off this filter membrane, and survey again with anti-VEGFR-2 antibody (Santa Cruz).

Mouse VEGF-C is the strong inductor of VEGFR-3 autophosphorylation seemingly, has 195 * 10 ³125 * 10 of the proteolytic cleavage of Mr precursor and this receptor (Pajusola etc., oncogene, 19:3545-3555 (1994)) ³Mr tyrosine-kinase enzyme polypeptide is by the phosphorus phenolate.At first carrying out VEGFR-2 with the unconcentrated substratum that comes from express recombinant VEGF-C cell stimulates, but immunoblotting assay does not show any receptor autophosphorylation phosphorylation.

Whether also can as people VEGF-C surveys, induce the VEGFR-2 autophosphorylation in order further to measure mouse reorganization VEGF-C, spissatedly be derived from the PAE cell of the substratum stimulation VEGF expression R-2 of the culture of mouse VEGF-C expression vector transfection and detect himself phosphorylation with 10 times.In order to contrast, VEGF-C (the Joukov etc. that recombinate have been used with ten times of spissated people of containing, (1996)) substratum, the concentrated substratum that comes from the insect cell of people VEGF-C baculovirus infection is perhaps crossed the cell that alum salts (tyrosyl inhibitors of phosphatases) is handled.As shown in figure 33, corresponding to the people baculovirus VEGF-C and the processing of crossing alum salts, significantly phosphorylation VEGF-2, and people and mouse reorganization VEGF-C have caused the enhancing of autophosphorylation weak and that only can survey respectively.With empty carrier or do not bring out the autophosphorylation of VEGFR-2 with the substratum of antisense orientation clone's VEGF-C cells transfected culture.Therefore, mouse VEGF-C is incorporated into VEGFR-3 and activates this receptor to activate required lower concentration than VEGF-2.Yet, the present invention includes those with material use VEGF-C of the present invention and VEGFR-2, and the interactional method of VEGF-C and VEGFR-3.

Embodiment 27

The VEGF-C E104-S213 fragment of expressing in the Pichia yeast stimulates the autophosphorylation of Flt4 (VEGFR-3) and KDR (VEGFR-2)

Made up a truncated-type human VEGF-C cDNA, wherein (1) ripe VEGF-C N-terminal H that coding is inferred ₂N-E (104) ETIK (sequence 33, residue 104 et seq.) sequence meets frame and is fused to yeast PH 01 signal sequence (Invitrogen Pichia expresses test kit, and (2) introduce (H after 213 amino acids with a terminator codon numbering #K1710-01), ₂N-... RCMS; After being 213 bit codons of sequence 32).Truncation type cDNA construct with gained is inserted into PichiaPastoris expression vector pHIL-S1 (Invitrogen) then.Be the clone, the BglII site, inside of the coding VEGF-C sequence of having suddenlyd change and do not change the sequence of this coded polypeptide.

Then, this VEGF-C expression vector transfection is identified positive colony to the Pichia cell and by screening the proteic expression of VEGF-C with the Western trace in the substratum of this culture.Make a positive colony grow in the 50ml culture, and with from 0 to 60 hour different time of methanol induction.About 10ul substratum is passed through gel electrophoresis analysis, and the Western trace also detects with anti-VEGF-C antiserum(antisera) subsequently, as above-mentioned.As in Figure 25 as seen, about 24KD polypeptide (indicating this band owing to glycosylation spreads) is accumulated in the substratum with the VEGF-C construct cells transfected of recombinating, but is simulating transfectional cell or only then do not having in the substratum with the carrier cells transfected.

Contain the proteic substratum of reorganization VEGF-C by (ultrafiltration and concentration that Centricon 30KD blocks also is used for stimulating the NIH 3T3 cell of expression Flt4 (VEGFR-3) and pig arterial endothelium (PAE) cell of expressing K DR (VEGFR-2).VEGFR-specific antisera immunoprecipitation is also used in institute's stimulated cells cracking, and by using anti-phosphotyrosine antibody, the Western trace of chemoluminescence and fluorography detects this immunoprecipitate.As the positive control of the maximum autophosphorylation of this VEGFRs, with vanadic acid root (VO ₄) handled this cell 10 minutes.Result as shown in figure 26, the substratum that comes from the Pichia culture of this reorganization of secretion VEGF-C polypeptide is induced the autophosphorylation of 195KD and 125KD Flt4l polypeptide and about 200KD KDR polypeptide.On the other hand, the alum acid group induce this receptor band and other may with the intensive tyrosyl phosphorylation of the band of this receptor co-precipitation.

The VEGF homologous region of the VEGF-C that these results proof is made up of 104E-213S (sequence 33,104-213 residue) amino-acid residue can be in yeast the recombinant production and the autophosphorylation that can stimulate Flt4 (VEGFR-3) and KDR (VEGFR-2).The reorganization VEGF-C fragment that can stimulate Flt4 or KDR autophosphorylation as described herein is also as aspect of the present invention; Use these segmental methods also within the scope of the invention.

Embodiment 28

The feature of the different processed-types of VEGF-C

Following oligonucleotide is used to produce a series of VEGF-C variants:

5 '-TCTCTTCTGTGCTTGAGTTGAG-3 ' (sequence 42), be used to produce VEGF-C R102S (Arg in 102 sites sports Ser (sequence 33));

5 '-TCTCTTCTGTCCCTGAGTTGAG-3 ' (sequence 43), be used to produce VEGF-C R102G (Arg in 102 sites sports Gly (sequence 33));

5 '-TGTGCTGCAGCAAATTTTATAGTCTCTTCTGTGGCGGCGGCGGCGGCGGGCGCCTC GCGAGGACC-3 ' (sequence 44), be used to produce VEGF-C Δ N (deletion is corresponding to the N-terminal propetide of 32-102 amino acid (sequence 33));

5 '-CTGGCAGGGAACTGCTAATAATGGAATGAA-3 ' (sequence 45), be used to produce VEGF-C R226, the Arg codon mutation in 227S (sequence 33) site is Ser;

5 '-GGCCTCCGCGTCCGAGAGGTCGAGTCCGGACTCGTGATGGTGATGGTGATGGGCGG CGGCGGCGGCGGGCGCCTCGCGAGGACC-3 ' (sequence 46), be used to produce VEGF-C NHis (this construct coding has the polypeptide of the 6 * His marker that is fused to this excretory precursor (32 amino acids of sequence 33) N-terminal).

Further some aforesaid VEGF-C variant construct is modified into other construct.For example, VEGF-2 R102G among the pALTER (Promega) and oligonucleotide 5 '-GTATTATAATGTCCTCCAAATTTTATAG-3 ' (sequence 47) is used to produce VEGF-C4G, its coding has the polypeptide of four point mutation: R102G, A110G, A111G, and A112G (Ala is mutated into Gly in the 110-112 site).These four rite-directed mutagenesis sites are adjacent to expressing in PC-3 and the predetermined cracking site of recombinant expressed VEGF-C in 293 EBNA.

With VEGF-C Δ N and oligonucleotide 5 '-GTTCGCTGCCTGACACTG TGGTAGTGTTGCTGCTGGCGGCCGCTAGTGATGGTGATGGTGATGAATAATGGAAT GAACTTGTCTGTAAACATCCAG-3 ' (sequence 48) prepares another construct and produces VEGF-C Δ NHis.This construct coding has the N-terminal propetide (32-102 amino acids) of deletion; The C-terminal propetide (the 226-419 amino acids of sequence 33) of deletion; And the polypeptide of the additional 6 * His marker of C-terminal.

Further digest all constructs with Hind III and Not I, the pREP7 carrier that subclone digests to Hind III/Not I, and be used for transfection 293 EBNA cells.After the transfection about 48 hours, this cell or as the above-mentioned Pro-mix that uses ^TMMetabolic marker, perhaps in serum free medium hungry 2 hours.Then, receive substratum and be used for subsequently experiment.As Figure 27 A-B finding, wt VEGF-C, VEGF-C NHis and VEGF-C Δ N Δ C His express similar level in 293 EBNA cells.Simultaneously, VEGF-C 4G polypeptide expression is quite low, may be because the conformational change of translation product and stability reduce.Yet above-mentioned whole VEGF-C variants are all secreted in this cell (comparison diagram 27A and 27B).The conditioned medium that comes from transfection and hungry cell is concentrated five times and be used to measure the Flt4 (VEGFR-3) that its stimulation is expressed in NIH 3T3 cell and the ability of the tyrosine phosphorylation of the KDR (VEGFR2) that is expressed in the PAE cell.

Figure 28 A-B shows wt VEGF-C and three tyrosine phosphorylations that mutant polypeptide stimulates VEGFR-3.The most significant stimulation is finished by short sophisticated VEGF-C Δ N Δ C CHis.This mutant, and VEGF-C NHis also stimulates the tyrosine phosphorylation of VEGFR-2.Therefore, though the major ingredient of excretory reorganization VEGF-C is the dimer of 32/29KD, cause that active part that VEGF-C is incorporated into VEGFR-3 and VEGFR-2 is positioned between the 102-226 amino acids of VEGF-C precursor (sequence 33).Use such as detection method analysis as herein described and will provide the data of the importance of relevant main 32/29KD that surveys and 21-23KD VEGF-C processed-type with binding characteristic that contrasts these VEGF-C albumen and variant and biological activity.Data shows that the construct of 103-225 amino acids residue of this VEGF-C precursor of coding (sequence 33) produces the reorganization part that can be simultaneously VEGFR-3 and VEGF-2 be worked.

The data of present embodiment and previous embodiment proves that many VEGF-C polypeptide fragments have kept biological activity.Found to determine that by the natural process cutting VEGF-C polypeptide of the natural 103-226 that strides sequence 33 (or 103-227) amino acids that C-terminal is produced has activity.The fragment that embodiment 27 confirmations have the 104-213 position residue of sequence 33 has kept biological activity.

In addition, the result of embodiment 21 proves the aminoterminal VEGF-C polypeptide retentive activity of 112 site with sequence 33.Other experiment shows that the fragment of the 1-112 position residue that lacks sequence 33 has kept biological activity.

In a relevant experiment, 214 Lys of sequence 33 (sequence 32,991-993 position Nucleotide) is replaced by terminator.The recombinant polypeptide of gained can also be induced the Flt4 autophosphorylation, and the polypeptide that the 113-213 amino acids residue of sequence 33 is striden in prompting is bioactive.

Even relatively showing such as the littler fragment of the polypeptide shown in the sequence 33, the member's of VEGF family peptide sequence also also has biological activity.Especially, the Cys residue of 8 high conservatives of this VEGF family polypeptide has determined to have the zone by 131 to 211 residues of sequence 33 (seeing Figure 31) of evolution meaning.Therefore, estimate to stride about 131 and remain with the VEGF-C biological activity to about 211 polypeptide.In fact, infer those polypeptide (polypeptide that promptly contains about 211 residues of about 161-of sequence 33) that keep conservative motif RCXXCC and remain with the VEGF-C biological activity.For keeping these segmental native conformations, preferably keep about 1-2 extra amino acid and the aminoterminal 1-2 or the more amino acid of C-terminal.

Exceed above-mentioned consideration, evidence shows that the less fragment and/or the fragment variant that lack conservative Cys are still keeping the VEGF-C biological activity.Correspondingly, material of the present invention and method comprise the VEGF-C fragment and the variant of whole a kind of biologic activity that has kept VEGF-C at least, no matter and it has or do not have the member of this conservative Cys residue series.

Embodiment 29

The induced expression of the people VEGF-C under people K14 Keratin sulfate promotor control in transgenic mice the raised growth of lymphatic vessel in its skin.

Express on Flt4 receptor tyrosine kinase relative specificity ground in lymphatic endothelial.People such as Kaipainen, institute of NAS periodical, 92:3566-3570 (1995).In addition, this VEGF-C factors stimulated growth Flt4 acceptor, and to the activity of the KDR acceptor of blood vessel lower (people such as Joukov, " European molecular biology federation magazine " (EMBO J.), 15:290-298 (1996); See embodiment 26).

In transgenic mice, experimentize to analyze the specific response of VEGF-C overexpression in tissue.The keratic promotor of people K14 has activity (Vassoar etc., institute of NAS periodical, 86:1563-1567 (1989)) and be used as the expression controlling elements in reorganization VEGF-C transgenosis in the basilar cell of stratified squamous endothelium.The carrier that contains K14 Keratin sulfate promotor is described in Vassar etc., GenesDev., 5:714-727 (1991) and Nelson etc., cytobiology magazine, 97:244-251 (1983).

Personnel selection total length VEGF-C cDNA (gene library registration number X94216) makes up reorganization VEGF-C transgenosis.This sequence is to downcut from pCI-neo carrier (Promega) with XhoI/NotI, and isolates the 2027 bp fragments that contain open reading frame and terminator (the 352-1611 position Nucleotide of sequence 32) of gained.Then, this isolating fragment is carried out the end-filling reaction with the Klenon fragment of archaeal dna polymerase.Then blunt-ended fragment is connected to the Bam HI restriction site of the similar opening in the K14 carrier.The construct of gained contains the EcoRI site of the polylinker that is derived from the pCI-neo carrier.This EcoRI site is removed with routine techniques (partly digesting the filling-in of the Klenow mediation behind the intermediate of this reorganization with EcoRI) so that the excision of the dna fragmentation of the mouse ovocyte of going into to be fertilized to be injected that can be subsequently.The institute's DCRP that is called K14-VEGF-C is illustrated in Figure 20.

From containing the K14 promotor, VEGF-C cDNA and separates EcoRI-Hind III fragment among the clone K14 VEGF-C of K14 polyadenylation signal and is injected in the ovocyte of FVB-NIH mouse strain fertilization.With through the injection zygote be transplanted to false pregnancy C57 BL/6 * DBAJ2] hybridization mouse uterine tube.By using primer: 5 '-the genetically modified existence of the tail DNA PCR mouse that reaction detection is built of CATGTACGAACCGCCAG-3 ' (sequence 49) and 5 '-AATGACCAGAGAGAGGCGAG-3 ' (sequence 50).In addition, tail DNAs is carried out EcoRV digestion and also carry out the Southern analysis with the EcoRI-Hind III fragment that is injected into this mouse subsequently.In 8 young babies' the analysis in three ages in week, found 2 positives, had this genetically modified about 40-50 in its genome respectively and copy and 4-6 copy.

It is little having the genetically modified mouse of high copy number, than its littermate grow slowlyer and the feed (as sucking the breast) have any problem.Further check and find nose swelling and red and fur is not good.Though feed and to raise food with special liquid, it the upper respiratory tract and digestive tube oedema occur and expiratory dyspnea is arranged behind feeding.Histology, the processing of immunohistochemistry and in situ hybridization were also carried out in death at once after this mouse was born eight days.

The histological examination discovery is compared with littermate, and the skin at the back of this K14-VEGF-C transgenic mice is that atrophy and reticular tissue are replaced by lacking erythrocytic big lacuna, but is lined with thin endodermis (the white arrow among Figure 29 A-D).The pipe spline structure of these expansions is similar to those seen in people's lymphangioma.Skin accessory organ and hair follicle have been reduced.At nose, be also shown in the increase of the number of pipe.Therefore, the raised growth that comprises the tubular construction of big lacuna in the skin below the overexpression of VEGF-C in the base portion epidermis can promote.The endotheliocyte that surrounds these lacunas contains abundant Flt4 mRNA (method is seen embodiment 23 and 30) in hybridizing in position.Pipe morphology shows that VEGF-C stimulates the growth of the pipe with lymphatic vessel feature.Other K14-VEGF-C transgenic mouse has similar histopathology of skin.

Experimental data shows that (i) has bioactive VEGF-C polypeptide of VEGF-C and polypeptide variants in the aforementioned body, and the purposes of the VEGF-C antagonist of (ii) anti-VEGF-C antibody and inhibition VEGF-C activity (as passing through in conjunction with VEGF-C or interference VEGF-C/ acceptor interaction).For example, data shows that the VEGF-C polypeptide is used the patient's that needs Lymphoid tissue growth treatment and (as: has removed Lymphoid tissue and lymphatic drainage again therefore and the impaired patient who causes swelling after those mammary cancer surgeries or other surgical operation; Perhaps those suffer from elephantiasic patient).Data shows that anti-VEGF-C antibody materials and VEGF-C antagonist may need to suppress the treatment of diseases application (as: treatment lymphangioma) of Lymphoid tissue growth to those.Correspondingly, the method for administration VEGF-C and VEGF-C variant and antagonist is also as method of the present invention and material.

Embodiment 30

VEGF expression-C and Flt4 in the mouse that is growing

Prepare the embryo of P.C.16 days conceived mouse and be fixed in 4% Paraformaldehyde 96 (PFA), paraffin embedding, and it is thick to be cut into 6 μ m.Section is placed on the silanization microslide and handle with dimethylbenzene, rehydration is fixed 20 minutes in 4%PFA, with Proteinase K (7mg/ml; Merck, Darmstadt, Germany) under room temperature, handled 5 minutes, be fixed in 4%PFA again and handle with acetic anhydride, in the solution that increases alcohol concn, dewater, dryly also be used in situ hybridization.

As V  strik etc., cytobiology magazine, the in situ hybridization of cutting into slices described in the 128:1197-1208 (1995).From linearizing pBluescript II SK+ plasmid (Stratagene company), produce mouse VEGF-C antisense RNA probes, it contains the fragment corresponding to mouse VEGF-C cDNA499-979 position Nucleotide, and non-coding region wherein and BR3P repeat to cut by exonuclease III processing.This fragment has been cloned EcoRI and the Hind III site of λ pBluescript II SK+.With the T7 RNA polymerase and [ ³⁵S]-UTP (Amersham, Little Chalfont, UK) RNA of synthesizing radioactive mark.Each slide glass should about 2,000,000 cpm the VEGF-C probe.After hybridization was spent the night, this slide glass at first washed 1 hour down in 50 ℃ in 2 * SSC and 20-30mM DDT.Continue to handle, strict washing, 4 * SSC and 20mM DTT and 50% deionization methane amide, 65 ℃ following 30 minutes, handled (20 μ g/ml) 30 minutes with RNase A down at 37 ℃ subsequently.Repeat this highly strict washing 45 minutes.At last, with this slide glass dehydration also at room temperature dry 30 minutes.Immerse this slide glass in photographic emulsion and exposed for 4 weeks.With Kodak D-16 photographic developer colour developing, dye and count with Permount (Fisher Chemical) with the phenodin lining.

In the in situ hybridization of Flt4 sequence, used the mouse Flt4 cDNA fragment of the 1-192bp that comprises open sequence (Finnerty etc., oncogene, 8:2293-2298 (1993)), and except following, according to aforesaid method.Each slide glass has been used the Flt4 probe of about 1,000,000 CPM.Strictness washing after the hybridization was carried out 105 minutes in 1 * SSC and 30mM DTT.

Illustrate the Photomicrograph of section under dark-field microscope (Figure 36 A-C) and bright-field microscope (Figure 36 D) of this hybridization.The magnification of photo is 4 * (Figure 36 A-B) and 10 * (Figure 36 C-D).Shown transverse section be derived from head and shown in VEGF-C and the FLT4 district be that Flt4 is positioned this embryo's head more in about 14 divided portion.In Figure 36 A (Flt4 probe), the cavum nasopharyngeum of growing is positioned at top center line, rear portion; The front portion of Figure 36 A be have the fibrous capsule that is producing nose and, on center line, the nasal cavity of formation.On both sides, the retinene dyestuff produces a false positive signal under dark-field microscope.The most significant Flt4-hybrid structure is seemingly corresponding to lymph of growing and venous endothelial.Indicating has clump sample interior cutaneous vessel structure to surround the mucous membrane of nasopharynx of growing.In Figure 36 B, the most significant signal is available from the rear portion of the concha of growing, and it shows the epithelium that surrounds loose reticular tissue/formation cartilage with higher magnification (Figure 36 C-D).During hybridizing in position, this structure provides intensive VEGF-C signal.Also having found among Figure 36 B has more weak hybridization region around the nose, though that this signal seems is uniformly many.Therefore, VEGF-C be expressed in the concha of growing shockingly high.

This first is surrounded by abundant venous plexus, mucous membrane source that produces as epidermic cell and warm suction air and be important in nose physiology.Pointing out this VEGF-C is important in the formation of the first venous plexus of mucous membrane, and its also required perviousness of adjustable nose mucous membrane secretion.The diameter that VEGF-C and derivative thereof and antagonist also may be used to regulate the full of first tissue and mucous membrane and therefore regulate the upper respiratory tract, and the quality and quantity of mucus production.These factors have great clinical meaning in upper respiratory tract infection (comprising allergy) and communicable disease.Correspondingly, the present invention has considered that material of the present invention is comprising VEGF-C Flt4, and derivative influences the inflammation of the upper respiratory tract (comprising the nose structure) and the application in the communicable disease method in diagnosis and treatment.

Embodiment 31

The evaluation of the exon-intron structure of people VEGF-C gene

Two genomic dna clonings that from the human gene group DNA library, separate 1,2 and 3 exons that contain people VEGF-C gene with VEGF-C cDNA fragment as probe.Especially, the people's gene library (Clontech) of nucleotide fragments screening in going into phage E MBL-3 λ, 629-746 position that produces with PCR corresponding to people VEGF-C cDNA (sequence 32).Identify one and be called the positive clone strain of " λ 3 ", and should insert fragment as 14kb XhoI fragment subclone to pBSK II carrier (Stratagene).(Not I site is the polylinker of cloning vector from 5 of VEGF-C cDNA '-non-coding region screening-gene library also to use the 130bp Not I-Sac I fragment of mark; Sac I site is corresponding to the 92-97 position Nucleotide of sequence 32).Two positive colonies of " λ 5 " and " λ 8 " have been obtained being called.Restriction map analysis revealed λ 3 clones contain exon 2 and 3, and the promoter region that λ 5 clones contain exons 1 and infer.

From genome VEGF-C P ₁Subclone contains exon 4,5, three genomic fragments of 6 and 7 among the matter nuclear clone.Especially, used from genome P ₁Plasmid clone 7660 (people such as Paavonen, separated DNA among the Circulation, 93:1079-1082 (1996).With P ₁The EcoRI fragment of inserting the sheet segment DNA is connected to pBSK II carrier.Use total length VEGF-C cDNA to identify the clone's 7660 who contains people VEGF-C cDNA homologous sequence subclone by colony hybridization as probe.Identify and isolate three different gene fragments that contain the exon 4-7 that withs a hook at the end.

For measuring genome structure, cut this clone's mapping with restriction enzyme.The coding region shows with exon-Nei has also carried out partly order-checking sub the connection.This analytical results is illustrated in Figure 11 and 17.All introns-exon border sequence (Figure 17, sequence 57-68) consistent with the consensus sequence splicing signal (Mount, nucleic acids research, 10:459-472 (1982)).Exon 5 and 6 s' intron length directly measures and is found to be 301bp by nucleotide sequencing.Exon 2 and 3 s' intron length is by restriction map and Southern hybridization assays and be found to be about 1.6kb.The length of each other intron is all above 10kb.

Similarly analyze for one and be used for musculus cdna group VEGF-C gene.Mouse VEGF-C intron-exon border sequence is illustrated in Figure 17 and sequence 69-80.

Restriction map and order-checking data show first residue by exons 1 coded signal sequence and N-CICP.The C-terminal part of second exons coding N-terminal propetide and the N-terminal of VEGF homologous region.The conserved sequence of VEGF homologous region is distributed in outer being shown 3 (containing 6 conservative Cys residues) and 4 (containing the Cys residue).Five times of the motif that is rich in Cys of remaining exons coding C-6X-C-10X-CRC (exon 5 and 7) type and C-6X-B-3X-C-C-C type are repeated motif, and it is the feature of silk-protein.

For further identifying the VEGF-C gene promoter, λ 5 clones have further been analyzed.With the combination of list and double digestion and Southern hybridization this clone being carried out restriction enzyme digestion makes graph discovery it comprises: (1) zone that is positioned at about 5kb of presumable initiator codon ATG codon upstream, (2) exons 1, and the intron I part of (3) VEGF-C gene.

To contain exons 1 and 5 ' and 3.7kb Xba I fragment subclone of the clone λ 5 of 3 ' flanking sequence and further analyzing.As described above, a main VEGF-C mRNA moves with the position in about 2.4kb.Count from the poly A sequence that coding VEGF-C sequence and the 391 bp3 ' non-coding sequence of 1257 bp adds about 50-200bp, this mRNA initiation site should be positioned at about 550-700bp place of translation initiation codon upstream.

For the promotor of further identifier VEGF-C gene, separated the gene clone of the about 1.4kb that comprises the translation initiation site upstream, and the promoter region that has checked order 5 ' non-coded cDNA sequence and inferred.The sequence of gained is shown in sequence 54.Be similar to the VEGF gene observed like that, this VEGF-C promotor is rich in G and C residue and lacks total TATA and CCAAT sequence.And it has many SP1 that infer (a kind of general nucleic acid-protein) binding site can start no TATA gene transcription.See Pugh and Tjian, gene and growth, 5:105-119 (1991).In addition, find that the sequence of VEGF-C translation starting point upstream contains the common consensus sequence of AP-2 factor binding site.This prompting is as the cAMP deopendent protein kinase and the protein kinase C mediation VEGF-C transcriptional regulatory of AP-2 transcription factor [Curran and Franza, cell, 55:395-397 (1988)].

This VEGF-C gene is organized after one's own heart dirty the adult, placenta, and overexpression in ovary and the small intestine, and induced by the various factor.In fact, the regulatory factor that several tissue-specific genes are expressed is positioned at the tip part of VEGF-C promotor really as the potential binding site of NFKB and GATA.For example, known NFKB regulates the expression of tissue factor in the endotheliocyte.Also consider the transcription factor adjusting cellular type expression of specific gene of GATA family.

Unlike VEGF, but the VEGF-C gene does not contain the binding site (people such as Levy, journal of biological chemistry, 270:13333-13340 (1995)) of hypoxemia amount one inducible factor HIF-1.This finds prompting if regulate VEGF-C mRNA by the hypoxemia amount, and its mechanism will mainly be based on the adjusting of mRNA stability.In this respect, manyly studies show that it is the steady-state level of regulating mRNA that the hypoxemia amount is induced the major control point of VEGF gene.See Levy etc., journal of biological chemistry, 271:2746-2753 (1996).This VEGF mRNA relative proportion stable and decay has been considered to determine (Chen and Shgn by the existence at the distinguished sequence motif that proves regulating mRNA stability of its non-translational region (UTR), molecular cytobiology, 14:8471-8482 (1994)).3 of this VEGF-C gene '-UTR also contains and infers motif (TTATTE) in this type in the 1873-1878 site of sequence 32.

Embodiment 32

The evaluation of a VEGF-C splice variant

As described in embodiment 16, main 2.4kb VEGF-C mRNA and a spot of 2.0kb mRNA are detectable.For understanding fully the origin of these RNAs, separate and identified other several VEGF-CcDNA.Shown in embodiment 10, screen the human fibrosarcoma cDNA library that comes from the HT1080 cell in λ gt11 carrier (Clontech, production code member #HL1048b) with 153bp people VEGF-C cDNA fragment as probe.Also see Joukov etc., EMBO J., 15:290-298 (1996).Choose nine positive colonies and by with oligonucleotide 5 '-pcr analysis of CACGGCTTATGCAAGCAAAG-3 ' (sequence 55) and 5 '-AACACAGTTTTCCATAATAG-3 ' (sequence 56).Select the VEGF-C cDNA part of these oligonucleotide amplifications corresponding to the 495-1661 position Nucleotide of sequence 32.Carry out PCR with 55 ℃ annealing temperatures and 25 circulations.

The PCR product of this gained of electrophoresis on sepharose.Produced five PCR fragments among nine clones that analyzed, and one short slightly with 1147bp length of expection.Will be than one in the fragment of short fragment and desired length clone's λ pCRTMII carrier (Invitorgen) and sequential analysis.Order-checking shows that short PCR fragment has the disappearance corresponding to the 153bp of the 904-1055 position Nucleotide of sequence 32.These disappearance bases are illustrated among Figure 17 corresponding to the exon 4 of people and mouse VEGF-C gene.What the disappearance of exon 4 had caused a C-terminal brachymemma that causes total length VEGF-C precursor again itself reads the sign indicating number displacement, and it has 15 amino-acid residues to translate in exon 5 to be different from the frame that is used to express full-length proteins.Therefore, the C-terminal aminoacid sequence of the brachymemma polypeptide of gained is ... Leu (181)-Ser-Lys-Thr-Val-Ser-Gly-Ser-Glu-Gln-Asp-Leu-Pro-His-Glu-Leu-His-Val-Glu (199) (sequence 181).The terminal cleavage site of C-that does not contain the VEGF-C precursor by the VEGF-C variant of this splice variant coding.Therefore, the alternative splicing RNA type of the conservative exon 4 of nothing of inferring is identified in the HT-1080 fibrosarcoma cell and is estimated the protein of 199 the amino acid whose VEGF-C of can be used as antagonists of this type coding.

Embodiment 33

In different cells in vitro cultures, process VEGF-C similarly

Whether process similarly in dissimilar cells in order to study VEGF-C, with wt people VEGF-C cDNA transfection 293 EBNA cells, COS-1 cell and HT-1080 cell are also used Pro-Mix ^TMAs mark as described in the embodiment 22.Collection comes from this culture condition substratum and carries out immunoprecipitation with antiserum(antisera) 882 (be described in embodiment 21, identification is corresponding to the peptide of the 104-120 amino acids of sequence 33).Separate the polypeptide of this immunoprecipitation by SDS-PAGE, and detect by radioautograph.The main type of the secretion reorganization VEGF-C that detects from all experimental cell systems is the 29/32KD diad.These two polypeptide are bonded to each other as described in embodiment 22 by disulfide linkage.In this substratum, also detect the lower band of significance of about 21KD.In addition, detected the VEGF-C precursor of the 63KDa of non-processing.This type is more remarkable in the COS-1 cell, and the proteolytic cleavage processing of VEGF-C does not have in the 293 EBNA cells effective in the prompting COS cell.In the HT-1080 cell, under these experiment conditions, do not detect endogenous VEGF-C (in non-transfected cell), but in the conditioned medium of PC-3 cell, be easy to detect.This subunit's polypeptide size and ratio have shown very similarly result in analysis PC-3 cell and the 293 EBNA cells: the most remarkable type is that diad and the inferior remarkable type of 29/32KDa is the 21KD polypeptide.The 21KD type that is produced by 293 EBNA cells can not be discerned by Weste enrages in the trace 882 antibody, is identified though be used for immunoprecipitation (seeing precedent) Shi Qineng at antibody equally.As described in embodiment 21, the shearing of 32KD type betides amino-acid residue 111 and 112 (sequence 33) in the 293 EBNA cells, the downstream of cleavage site in the PC-3 cell (between 102 and 103 residues).Therefore, the 21KD type of 293 EBNA cells generation does not contain the complete N-terminal peptide that is used to produce antiserum(antisera) 882.

In relevant experiment, the PC-3 cell is cultivated different time (1-8 days) before the separation condition substratum in serum free medium.(Amicon, Beverly USA) concentrate this conditioned medium and also carry out the Western engram analysis with antiserum(antisera) 882 with Centricon device.Cultivate after one day, detect a significant 32KD band.In cultivating the conditioned medium of 4 days and 8 days, detect the 21-23KD type of increasing amount.The diffustivity maximum possible that is called this polypeptid belt of 23KD polypeptide in embodiment 5 and several embodiment subsequently simply is because glycosylated heterology and different amounts.These results show 32KD polypeptide of the initial secretion of this cell, and it further processes or cut into the 21-23KD type in substratum.Then because different degree of glycosylation and, the small unhomogeneity of processing cleavage site as the N-terminal available from PC-3 and 293 EBNA cell culture mediums, has caused the microheterogeneity of this polypeptid belt.This C-terminal cleavage site also may change, and the example of possible cleavage site is positioned at 225-226, between 226-227 and 227-228 position residue and between the residue of 216-217 position.Generally speaking, these results suggest excretory leukoproteases may cause this 21-23KD type VEGF-C to be produced by the 32KD polypeptide.This proteolytic enzyme also can be used for experiment in vitro with in the VEGF-C production process in solution cutting VEGF-C precursor protein, or be used in cell cultures and the body experiment with the VEGF-C of delivery of biologically active.

Embodiment 34

The different combinations of the VEGF-C type by VEGFR-3 and VEGFR-2 extracellular region

In two parallel tests,, use Pro-Mix with the construct transfection 293 EBNA cells of the wt VEGF-C of a coding reorganization or coding VEGF-DNDCHis (embodiment 28) and after transfection about 48 hours ^TMPenetrate mark as precedent as stating generation.Collect the substratum of simulation transfection and transfectional cell and be used for receptors bind and detect.

Receptors bind contain about 0.2 one of μ g (a) comprise the fusion rotein of the VEGFR-3 extracellular region that is fused to immunoglobulin sequences (VEGFR-3-Ig) or (b) one comprise and be fused to alkaline phosphatase enzyme sequence (VEGFR-2-AP; People such as Cao, journal of biological chemistry, 271:3154-62 (1996)) binding buffer liquid (PBS, 0.5%BSA, 0.02 %Tween 20,1 μ g/ml heparin) in carry out.In contrast, 293 EBNA conditioned mediums and the anti-VEGF-C antiserum(antisera)s of 2 μ l (VEGF-CIP) with identical equal portions mix.

Cultivate after two hours under the room temperature, anti-VEGF-C antibody and VEGFR-3-Ig protein adsorption arrive albumin A-Sepharose (PAS) also with anti-AP monoclonal antibody (Medix Biotech, GenzymeDiagnostics, San Carlos, CA, USA) and Protein G-Sepharose immunoprecipitation VEGFR-2-AP.In binding buffer liquid and 20mM Tirs-HCl (pH 7.4) successively respectively washing contain the mixture three times that is incorporated into the VEGF-C on VEGFR-3-Ig or the VEGFR-2-AP and twice and with VEGF-C immunoprecipitate successively washing three times and twice among RIPA damping fluid and 20mM Tris-HCl (pH7.4) respectively, pass through again reduce and non-reduced attitude under the SDS-PAGE detection.In contrast, precipitate this same substratum to control possible non-specific adsorption with anti-AP and PGS or with PAS.

These experiments show that VEGFR-3 is incorporated into 32/29KD and 21-23KD type reorganization VEGF-C, and the VEGF-R-2 preferred combination is in the 21-23KD of this conditioned medium component.In addition, observe a spot of 63KD and 52KD VEGF-C type is incorporated into VEGFR-3.The 21-23KD VEGF-C that further analysis revealed major part under non-reduced attitude is incorporated into arbitrary acceptor does not contain interchain disulfide bond.These discoveries have supported VEGF-C to be incorporated into the conclusion of VEGFR-2.The prompting of this data only has activity to VEGFR-3 or to VEGFR-3 and the VEGFR-2 application of activated recombinant type VEGF-C simultaneously.On the other hand, the result of these results and embodiment 28 does not get rid of the 32/29KD dimer and is incorporated into VEGFR-3 and does not but activate its possibility.The conditioned medium that this 32/29KD dimer can not activate the soluble N-His VEGF-C of VEGFR-3 cells transfected induces time remarkable VEGFR-3 tyrosine phosphorylation than VEGF-C DNDCHis transfectional cell, even previous polypeptide expression higher (seeing Figure 27 and 28).The stable VEGF-C polypeptide that is incorporated into the VEGF-C acceptor but can not activates this receptor changes body and function and makes the VEGF-C antagonist.

The biomaterial preservation: plasmid FLT4-L is preserved in American type culture collection (ATCC) by budapest treaty, 12301 Parklawn Dr., Rockville MD 20952 (USA), and obtained July 24 nineteen ninety-five preservation day and ATCC accession number 97231.

Though described the present invention by specific embodiment, be understandable that those skilled in the art can change and revise.Correspondingly, the present invention only adds those restrictions that comes across additional claims.

Sequence table (1) physical data:

(i) applicant: Helsinki University Licensing Lts Oy

(ii) invention exercise question: receptor ligand VEGF-C

(iii) sequence number: 81

(iv) mailing address:

(A) address: Oy Jalo Ant-Wuorinen Ab

(B) street: Iso Roobertinkatu 4-6A

(C) city: Helsinki

(E) country: Finland

(F) postcode: 00120

(v) computer-reader form:

(A) media types: floppy disk

(B) computer: IBM PC compatibility

(C) operating system: PC-DOS/MS-DOS

(D) software: Patent In Release#1.0, Version#1.30

(vi) current application materials:

(A) application number:

(B) applying date:

(C) classification:

(vii) application materials formerly:

(A) application number: 08/671,573

(B) applying date: on June 28th, 1996

(vii) application materials formerly:

(A) application number: 08/601,132

(B) applying date: on February 14th, 1996

(vii) application materials formerly:

(A) application number: 08/585,895

(B) applying date: on January 12nd, 1996 (vii) application materials formerly:

(A) application number: 08/510,133

(B) applying date: August 1 nineteen ninety-five

(viii) lawyer/proxy's data:

(A) name Karvinen, Leena

(B) registration number: 28999

(ix) telecommunications data:

(A) phone :+358 0 648 606

(B) fax :+358 0 640 575

(C) telegram: 123505 JALO FI (2) sequences, 1 data:

(i) sequence signature:

(A) length: 20 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 1:TGTCCTCGCT GTCCTTGTCT 20 (2) sequences 2 data:

(i) sequence signature:

(A) length: 70 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 2:ACATGCATGC CACCATGCAG CGGGGCGCCG CGCTGTGCCT GCGACTGTGG CTCTGCCTGG 60 GACTCCTGGA 70 (2) sequences 3 data:

(i) sequence signature:

(A) length: 24 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 3:

ACATGCATGC CCCGCCGGTC ATCC 24 (2) sequences 4 data:

(i) sequence signature:

(A) length: 22 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 4:

CGGAATTCCC CATGACCCCA AC 22 (2) sequences 5 data:

(i) sequence signature:

(A) length: 33 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 5:

CCATCGATGG ATCCTACCTG AAGCCGCTTT CTT 33 (2) sequences 6 data:

(i) sequence signature:

(A) length: 17 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 6:

ATTTAGGTGA CACTATA 17 (2) sequences 7 data:

(i) sequence signature:

(A) length: 34 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 7:CCATCGATGG ATCCCGATGC TGCTTAGTAG CTGT 34 (2) sequences 8 data:

(i) sequence signature:

(A) length: 40 amino acid

(B) type: amino acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: peptide

(xi) sequence description: sequence 8:Pro Met Thr Pro Thr Thr Tyr Lys Gly Ser Val Asp Asn Gln Thr Asp1 5 10 15Ser Gly Met Val Leu Ala Ser Glu Glu Phe Glu Gln Ile Glu Ser Arg

20 25 30His?Arg?Gln?Glu?Ser?Gly?Phe?Arg

35 40 (2) sequences, 9 data:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 9:CTGGAGTCGA CTTGGCGGAC T 21 (2) sequences 10 data:

(i) sequence signature:

(A) length: 60 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 10:CGCGGATCCC TAGTGATGGT GATGGTGATG TCTACCTTCG ATCATGCTGC CCTTATCCTC 60 (2) sequences 11 data:

(i) sequence signature:

(A) length: 34 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 11:CCCAAGCTTG GATCCAAGTG GCTACTCCAT GACC 34 (2) sequences 12 data:

(i) sequence signature:

(A) length: 20 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 12:GTTGCCTGTG ATGTGCACCA 20 (2) sequences 13 data:

(i) sequence signature:

(A) length: 18 amino acid

(B) type: amino acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: peptide

(xi) sequence description: sequence 13:Xaa Glu Glu Thr Ile Lys phe Ala Ala Ala His Tyr Asn Thr Glu Ile1 5 10 15Leu Lys (2) sequences 14 data:

(i) sequence signature:

(A) length: 17 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 14:GCAGARGARA CNATHAA 17 (2) sequences 15 data:

(i) sequence signature:

(A) length: 5 amino acid

(B) type: amino acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: peptide

(xi) sequence description: sequence 15:Glu Glu Thr Ile Lys1 5 (2) sequences 16 data:

(i) sequence signature:

(A) length: 18 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 16:GCAYTTNARD ATYTCNGT 18 (2) sequences 17 data:

(i) sequence signature:

(A) length: 5 amino acid

(B) type: amino acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: peptide

(xi) sequence description: sequence 17:Thr Glu Ile Leu Lys1 5 (2) sequences 18 data:

(i) sequence signature:

(A) length: 22 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 18:ATTCGCTGCA GCACACTACA AC 22 (2) sequences 19 data:

(i) sequence signature:

(A) length: 19 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 19:TCNGTGTTGT AGTGTGCTG 19 (2) sequences 20 data:

(i) sequence signature:

(A) length: 7 amino acid

(B) type: amino acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: peptide

(xi) sequence description: sequence 20:

Ala?Ala?His?Tyr?Asn?Thr?Glu

15 (2) sequences, 21 data:

(i) sequence signature:

(A) length: 20 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 21:TAATACGACT CACTATAGGG 20 (2) sequences 22 data:

(i) sequence signature:

(A) length: 24 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 22:GTTGTAGTGT GCTGCAGCGA ATTT 24 (2) sequences 23 data:

(i) sequence signature:

(A) length: 8 amino acid

(B) type: amino acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: peptide

(xi) sequence description: sequence 23:Lys Phe Ala Ala Ala His Tyr Asn1 5 (2) sequence 24 data:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 24: TCACTATAGG GAGACCCAAG C 24 (2) sequences 25 data:

(i) sequence signature:

(A) length: 219 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 25:TCACTATAGG GAGACCCAAG CTTGGTACCG AGCTCGGATC CACTAGTAAC GGCCGCCAGT 60GTGGTGGAAT TCGACGAACT CATGACTGTA CTCTACCCAG AATATTGGAA AATGTACAAG 120TGTCAGCTAA GGCAAGGAGG CTGGCAACAT AACAGAGAAC AGGCCAACCT CAACTCAAGG 180ACAGAAGAGA CTATAAAATT CGCTGCAGCA CACTACAAC 219, (2) sequence 26 data:

(i) sequence signature:

(A) length: 18 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 26:ACAGAGAACA GGCCAACC 18 (2) sequences 27 data:

(i) sequence signature:

(A) length: 19 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 27:TCTAGCATTT AGGTGACAC 19 (2) sequences 28 data:

(i) sequence signature:

(A) length: 25 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 28:AAGAGACTAT AAAATTCGCT GCAGC 25 (2) sequences 29 data:

(i) sequence signature:

(A) length: 20 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 29:CCCTCTAGAT GCATGCTCGA 20 (2) sequences 30 data:

(i) sequence signature:

(A) length: 24 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 30:GTTGTAGTGT GCTGCAGCGA ATTT 24 (2) sequences 31 data:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 31:TCACTATAGG GAGACCCAAG C 21 (2) sequences 32 data:

(i) sequence signature:

(A) length: 1997 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(ix) feature:

(A) title/index: CDS

(B) position: 352..1608 (x) sequence description: sequence 32:CCCGCCCCGC CTCTCCAAAA AGCTACACCG ACGCGGACCG CGGCGGCGTC CTCCCTCGCC 60CTCGCTTCAC CTCGCGGGCT CCGAATGCGG GGAGCTCGGA TGTCCGGTTT CCTGTGAGGC 120TTTTACCTGA CACCCGCCGC CTTTCCCCGG CACTGGCTGG GAGGGCGCCC TGCAAAGTTG 180GGAACGCGGA GCCCCGGACC CGCTCCCGCC GCCTCCGGCT CGCCCAGGGG GGGTCGCCGG 240GAGGAGCCCG GGGGAGAGGG ACCAGGAGGG GCCCGCGGCC TCGCAGGGGC GCCCGCGCCC 300CCACCCCTGC CCCCGCCAGC GGACCGGTCC CCCACCCCCG GTCCTTCCAC C ATG CAC 357

Met?His

1TTG?CTG?GGC?TTC?TTC?TCT?GTG?GCG?TGT?TCT?CTG?CTC?GCC?GCT?GCG?CTG 405Leu?Leu?Gly?Phe?Phe?Ser?Val?Ala?Cys?Ser?Leu?Leu?Ala?Ala?Ala?Leu

5 10 15CTC?CCG?GGT?CCT?CGC?GAG?GCG?CCC?GCC?GCC?GCC?GCC?GCC?TTC?GAG?TCC 453Leu?Pro?Gly?Pro?Arg?Glu?Ala?Pro?Ala?Ala?Ala?Ala?Ala?Phe?Glu?Ser

20 25 30GGA?CTC?GAC?CTC?TCG?GAC?GCG?GAG?CCC?GAC?GCG?GGC?GAG?GCC?ACG?GCT 501Gly?Leu?Asp?Leu?Ser?Asp?Ala?Glu?Pro?Asp?Ala?Gly?Glu?Ala?Thr?Ala?35 40 45 50TAT?GCA?AGC?AAA?GAT?CTG?GAG?GAG?CAG?TTA?CGG?TCT?GTG?TCC?AGT?GTA 549Tyr?Ala?Ser?Lys?Asp?Leu?Glu?Glu?Gln?Leu?Arg?Ser?Val?Ser?Ser?Val

55 60 65GAT?GAA?CTC?ATG?ACT?GTA?CTC?TAC?CCA?GAA?TAT?TGG?AAA?ATG?TAC?AAG 597Asp?Glu?Leu?Met?Thr?Val?Leu?Tyr?Pro?Glu?Tyr?Trp?Lys?Met?Tyr?Lys

70 75 80TGT?CAG?CTA?AGG?AAA?GGA?GGC?TGG?CAA?CAT?AAC?AGA?GAA?CAG?GCC?AAC 645Cys?Gln?Leu?Arg?Lys?Gly?Gly?Trp?Gln?His?Asn?Arg?Glu?Gln?Ala?Asn

85 90 95CTC?AAC?TCA?AGG?ACA?GAA?GAG?ACT?ATA?AAA?TTT?GCT?GCA?GCA?CAT?TAT 693Leu?Asn?Ser?Arg?Thr?Glu?Glu?Thr?Ile?Lys?Phe?Ala?Ala?Ala?His?Tyr

100 105 110AAT?ACA?GAG?ATC?TTG?AAA?AGT?ATT?GAT?AAT?GAG?TGG?AGA?AAG?ACT?CAA 741Asn?Thr?Glu?Ile?Leu?Lys?Ser?Ile?Asp?Asn?Glu?Trp?Arg?Lys?Thr?Gln115 120 125 130TGC?ATG?CCA?CGG?GAG?GTG?TGT?ATA?GAT?GTG?GGG?AAG?GAG?TTT?GGA?GTC 789Cys?Met?Pro?Arg?Glu?Val?Cys?Ile?Asp?Val?Gly?Lys?Glu?Phe?Gly?Val

135 140 145GCG?ACA?AAC?ACC?TTC?TTT?AAA?CCT?CCA?TGT?GTG?TCC?GTC?TAC?AGA?TGT 837Ala?Thr?Asn?Thr?Phe?Phe?Lys?Pro?Pro?Cys?Val?Ser?Val?Tyr?Arg?Cys

150 155 160GGG?GGT?TGC?TGC?AAT?AGT?GAG?GGG?CTG?CAG?TGC?ATG?AAC?ACC?AGC?ACG 885Gly?Gly?Cys?Cys?Asn?Ser?Glu?Gly?Leu?Gln?Cys?Met?Asn?Thr?Ser?Thr

165 170 175AGC?TAC?CTC?AGC?AAG?ACG?TTA?TTT?GAA?ATT?ACA?GTG?CCT?CTC?TCT?CAA 933Ser?Tyr?Leu?Ser?Lys?Thr?Leu?Phe?Glu?Ile?Thr?Val?Pro?Leu?Ser?Gln

180 185 190GGC?CCC?AAA?CCA?GTA?ACA?ATC?AGT?TTT?GCC?AAT?CAC?ACT?TCC?TGC?CGA 981Gly?Pro?Lys?Pro?Val?Thr?Ile?Ser?Phe?Ala?Asn?His?Thr?Ser?Cys?Arg195 200 205 210TGC?ATG?TCT?AAA?CTG?GAT?GTT?TAC?AGA?CAA?GTT?CAT?TCC?ATT?ATT?AGA 1029Cys?Met?Ser?Lys?Leu?Asp?Val?Tyr?Arg?Gln?Val?His?Ser?Ile?Ile?Arg

215 220 225CGT?TCC?CTG?CCA?GCA?ACA?CTA?CCA?CAG?TGT?CAG?GCA?GCG?AAC?AAG?ACC 1077Arg?Ser?Leu?Pro?Ala?Thr?Leu?Pro?Gln?Cys?Gln?Ala?Ala?Asn?Lys?Thr

230 235 240TGC?CCC?ACC?AAT?TAC?ATG?TGG?AAT?AAT?CAC?ATC?TGC?AGA?TGC?CTG?GCT 1125Cys?Pro?Thr?Asn?Tyr?Met?Trp?Asn?Asn?His?Ile?Cys?Arg?Cys?Leu?Ala

245 250 255CAG?GAA?GAT?TTT?ATG?TTT?TCC?TCG?GAT?GCT?GGA?GAT?GAC?TCA?ACA?GAT 1173Gln?Glu?Asp?Phe?Met?Phe?Ser?Ser?Asp?Ala?Gly?Asp?Asp?Ser?Thr?Asp

260 265 270GGA?TTC?CAT?GAC?ATC?TGT?GGA?CCA?AAC?AAG?GAG?CTG?GAT?GAA?GAG?ACC 1221Gly?Phe?His?Asp?Ile?Cys?Gly?Pro?Asn?Lys?Glu?Leu?Asp?Glu?Glu?Thr275 280 285 290TGT?CAG?TGT?GTC?TGC?AGA?GCG?GGG?CTT?CGG?CCT?GCC?AGC?TGT?GGA?CCC 1269Cys?Gln?Cys?Val?Cys?Arg?Ala?Gly?Leu?Arg?Pro?Ala?Ser?Cys?Gly?Pro

295 300 305CAC?AAA?GAA?CTA?GAC?AGA?AAC?TCA?TGC?CAG?TGT?GTC?TGT?AAA?AAC?AAA 1317His?Lys?Glu?Leu?Asp?Arg?Asn?Ser?Cys?Gln?Cys?Val?Cys?Lys?Asn?Lys

310 315 320CTC?TTC?CCC?AGC?CAA?TGT?GGG?GCC?AAC?CGA?GAA?TTT?GAT?GAA?AAC?ACA 1365Leu?Phe?Pro?Ser?Gln?Cys?Gly?Ala?Asn?Arg?Glu?Phe?Asp?Glu?Asn?Thr

325 330 335TGC?CAG?TGT?GTA?TGT?AAA?AGA?ACC?TGC?CCC?AGA?AAT?CAA?CCC?CTA?AAT 1413Cys?Gln?Cys?Val?Cys?Lys?Arg?Thr?Cys?Pro?Arg?Asn?Gln?Pro?Leu?Asn

340 345 350CCT?GGA?AAA?TGT?GCC?TGT?GAA?TGT?ACA?GAA?AGT?CCA?CAG?AAA?TGC?TTG 1461Pro?Gly?Lys?Cys?Ala?Cys?Glu?Cys?Thr?Glu?Ser?Pro?Gln?Lys?Cys?Leu355 360 365 370TTA?AAA?GGA?AAG?AAG?TTC?CAC?CAC?CAA?ACA?TGC?AGC?TGT?TAC?AGA?CGG 1509Leu?Lys?Gly?Lys?Lys?Phe?His?His?Gln?Thr?Cys?Ser?Cys?Tyr?Arg?Arg

375 380 385CCA?TGT?ACG?AAC?CGC?CAG?AAG?GCT?TGT?GAG?CCA?GGA?TTT?TCA?TAT?AGT 1557Pro?Cys?Thr?Asn?Arg?Gln?Lys?Ala?Cys?Glu?Pro?Gly?Phe?Ser?Tyr?Ser

390 395 400GAA?GAA?GTG?TGT?CGT?TGT?GTC?CCT?TCA?TAT?TGG?AAA?AGA?CCA?CAA?ATG 1605Glu?Glu?Val?Cys?Arg?Cys?Val?Pro?Ser?Tyr?Trp?Lys?Arg?Pro?Gln?Met

405 410 415AGC TAAGATTGTA CTGTTTTCCA GTTCATCGAT TTTCTATTAT GGAAAACTGT 1658SerGTTGCCACAG TAGAACTGTC TGTGAACAGA GAGACCCTTG TGGGTCCATG CTAACAAAGA 1718CAAAAGTCTG TCTTTCCTGA ACCATGTGGA TAACTTTACA GAAATGGACT GGAGCTCATC 1778TGCAAAAGGC CTCTTGTAAA GACTGGTTTT CTGCCAATGA CCAAACAGCC AAGATTTTCC 1838TCTTGTGATT TCTTTAAAAG AATGACTATA TAATTTATTT CCACTAAAAA TATTGTTTCT 1898GCATTCATTT TTATAGCAAC AACAATTGGT AAAACTCACT GTGATCAATA TTTTTATATC 1958ATGCAAAATA TGTTTAAAAT AAAATGAAAA TTGTATTAT, 1997 (2) sequences, 33 data:

(i) sequence signature:

(A) length: 419 amino acid

(B) type: amino acid

(D) topological structure: linearity is molecule type (ii): protein (xi) sequence description: sequence 33:Met His Leu Leu Gly Phe Phe Ser Val Ala Cys Ser Leu Leu Ala Ala 15 10 15Ala Leu Leu Pro Gly Pro Arg Glu Ala Pro Ala Ala Ala Ala Ala Phe

20 25 30Glu?Ser?Gly?Leu?Asp?Leu?Ser?Asp?Ala?Glu?Pro?Asp?Ala?Gly?Glu?Ala

35 40 45Thr?Ala?Tyr?Ala?Ser?Lys?Asp?Leu?Glu?Glu?Gln?Leu?Arg?Ser?Val?Ser

50 55 60Ser?Val?Asp?Glu?Leu?Met?Thr?Val?Leu?Tyr?Pro?Glu?Tyr?Trp?Lys?Met?65 70 75 80Tyr?Lys?Cys?Gln?Leu?Arg?Lys?Gly?Gly?Trp?Gln?His?Asn?Arg?Glu?Gln

85 90 95Ala?Asn?Leu?Asn?Ser?Arg?Thr?Glu?Glu?Thr?Ile?Lys?Phe?Ala?Ala?Ala

100 105 110His?Tyr?Asn?Thr?Glu?Ile?Leu?Lys?Ser?Ile?Asp?Asn?Glu?Trp?Arg?Lys

115 120 125Thr?Gln?Cys?Met?Pro?Arg?Glu?Val?Cys?Ile?Asp?Val?Gly?Lys?Glu?Phe

130 135 140Gly?Val?Ala?Thr?Asn?Thr?Phe?Phe?Lys?Pro?Pro?Cys?Val?Ser?Val?Tyr145 150 155 160Arg?Cys?Gly?Gly?Cys?Cys?Asn?Ser?Glu?Gly?Leu?Gln?Cys?Met?Asn?Thr

165 170 175Ser?Thr?Ser?Tyr?Leu?Ser?Lys?Thr?Leu?Phe?Glu?Ile?Thr?Val?Pro?Leu

180 185 190Ser?Gln?Gly?Pro?Lys?Pro?Val?Thr?Ile?Ser?Phe?Ala?Asn?His?Thr?Ser

195 200 205Cys?Arg?Cys?Met?Ser?Lys?Leu?Asp?Val?Tyr?Arg?Gln?Val?His?Ser?Ile

210 215 220Ile?Arg?Arg?Ser?Leu?Pro?Ala?Thr?Leu?Pro?Gln?Cys?Gln?Ala?Ala?Asn225 230 235 240Lys?Thr?Cys?Pro?Thr?Asn?Tyr?Met?Trp?Asn?Asn?His?Ile?Cys?Arg?Cys

245 250 255Leu?Ala?Gln?Glu?Asp?Phe?Met?Phe?Ser?Ser?Asp?Ala?Gly?Asp?Asp?Ser

260 265 270Thr?Asp?Gly?Phe?His?Asp?Ile?Cys?Gly?Pro?Asn?Lys?Glu?Leu?Asp?Glu

275 280 285Glu?Thr?Cys?Gln?Cys?Val?Cys?Arg?Ala?Gly?Leu?Arg?Pro?Ala?Ser?Cys

290 295 300Gly?Pro?His?Lys?Glu?Leu?Asp?Arg?Asn?Ser?Cys?Gln?Cys?Val?Cys?Lys305 310 315 320Asn?Lys?Leu?Phe?Pro?Ser?Gln?Cys?Gly?Ala?Asn?Arg?Glu?Phe?Asp?Glu

325 330 335Asn?Thr?Cys?Gln?Cys?Val?Cys?Lys?Arg?Thr?Cys?Pro?Arg?Asn?Gln?Pro

340 345 350Leu?Asn?Pro?Gly?Lys?Cys?Ala?Cys?Glu?Cys?Thr?Glu?Ser?Pro?Gln?Lys

355 360 365Cys?Leu?Leu?Lys?Gly?Lys?Lys?Phe?His?His?Gln?Thr?Cys?Ser?Cys?Tyr

370 375 380Arg?Arg?Pro?Cys?Thr?Asn?Arg?Gln?Lys?Ala?Cys?Glu?Pro?Gly?Phe?Ser385 390 395 400Tyr?Ser?Glu?Glu?Val?Cys?Arg?Cys?Val?Pro?Ser?Tyr?Trp?Lys?Arg?Pro

405 410 415Gln Met Ser (2) sequences, 34 data:

(i) sequence signature:

(A) length: 22 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 34:TGAGTGATTTGTAGCTGCTGTG 22 (2) sequences 35 data:

(i) sequence signature:

(A) length: 22 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 35:TATTGCAGCAACCCCCACATCT 22 (2) sequences 36 data:

(i) sequence signature:

(A) length: 4416 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi)：36：CCACGCGCAG CGGCCGGAGA TGCAGCGGGG CGCCGCGCTG TGCCTGCGAC TGTGGCTCTG 60CCTGGGACTC CTGGACGGCC TGGTGAGTGG CTACTCCATG ACCCCCCCGA CCTTGAACAT 120CACGGAGGAG TCACACGTCA TCGACACCGG TGACAGCCTG TCCATCTCCT GCAGGGGACA 180GCACCCCCTC GAGTGGGCTT GGCCAGGAGC TCAGGAGGCG CCAGCCACCG GAGACAAGGA 240CAGCGAGGAC ACGGGGGTGG TGCGAGACTG CGAGGGCACA GACGCCAGGC CCTACTGCAA 300GGTGTTGCTG CTGCACGAGG TACATGCCAA CGACACAGGC AGCTACGTCT GCTACTACAA 360GTACATCAAG GCACGCATCG AGGGCACCAC GGCCGCCAGC TCCTACGTGT TCGTGAGAGA 420CTTTGAGCAG CCATTCATCA ACAAGCCTGA CACGCTCTTG GTCAACAGGA AGGACGCCAT 480GTGGGTGCCC TGTCTGGTGT CCATCCCCGG CCTCAATGTC ACGCTGCGCT CGCAAAGCTC 540GGTGCTGTGG CCAGACGGGC AGGAGGTGGT GTGGGATGAC CGGCGGGGCA TGCTCGTGTC 600CACGCCACTG CTGCACGATG CCCTGTACCT GCAGTGCGAG ACCACCTGGG GAGACCAGGA 660CTTCCTTTCC AACCCCTTCC TGGTGCACAT CACAGGCAAC GAGCTCTATG ACATCCAGCT 720GTTGCCCAGG AAGTCGCTGG AGCTGCTGGT AGGGGAGAAG CTGGTCCTGA ACTGCACCGT 780GTGGGCTGAG TTTAACTCAG GTGTCACCTT TGACTGGGAC TACCCAGGGA AGCAGGCAGA 840GCGGGGTAAG TGGGTGCCCG AGCGACGCTC CCAGCAGACC CACACAGAAC TCTCCAGCAT 900CCTGACCATC CACAACGTCA GCCAGCACGA CCTGGGCTCG TATGTGTGCA AGGCCAACAA 960CGGCATCCAG CGATTTCGGG AGAGCACCGA GGTCATTGTG CATGAAAATC CCTTCATCAG 1020CGTCGAGTGG CTCAAAGGAC CCATCCTGGA GGCCACGGCA GGAGACGAGC TGGTGAAGCT 1080GCCCGTGAAG CTGGCAGCGT ACCCCCCGCC CGAGTTCCAG TGGTACAAGG ATGGAAAGGC 1140ACTGTCCGGG CGCCACAGTC CACATGCCCT GGTGCTCAAG GAGGTGACAG AGGCCAGCAC 1200AGGCACCTAC ACCCTCGCCC TGTGGAACTC CGCTGCTGGC CTGAGGCGCA ACATCAGCCT 1260GGAGCTGGTG GTGAATGTGC CCCCCCAGAT ACATGAGAAG GAGGCCTCCT CCCCCAGCAT 1320CTACTCGCGT CACAGCCGCC AGGCCCTCAC CTGCACGGCC TACGGGGTGC CCCTGCCTCT 1380CAGCATCCAG TGGCACTGGC GGCCCTGGAC ACCCTGCAAG ATGTTTGCCC AGCGTAGTCT 1440CCGGCGGCGG CAGCAGCAAG ACCTCATGCC ACAGTGCCGT GACTGGAGGG CGGTGACCAC 1500GCAGGATGCC GTGAACCCCA TCGAGAGCCT GGACACCTGG ACCGAGTTTG TGGAGGGAAA 1560GAATAAGACT GTGAGCAAGC TGGTGATCCA GAATGCCAAC GTGTCTGCCA TGTACAAGTG 1620TGTGGTCTCC AACAAGGTGG GCCAGGATGA GCGGCTCATC TACTTCTATG TGACCACCAT 1680CCCCGACGGC TTCACCATCG AATCCAAGCC ATCCGAGGAG CTACTAGAGG GCCAGCCGGT 1740GCTCCTGAGC TGCCAAGCCG ACAGCTACAA GTACGAGCAT CTGCGCTGGT ACCGCCTCAA 1800CCTGTCCACG CTGCACGATG CGCACGGGAA CCCGCTTCTG CTCGACTGCA AGAACGTGCA 1860TCTGTTCGCC ACCCCTCTGG CCGCCAGCCT GGAGGAGGTG GCACCTGGGG CGCGCCACGC 1920CACGCTCAGC CTGAGTATCC CCCGCGTCGC GCCCGAGCAC GAGGGCCACT ATGTGTGCGA 1980AGTGCAAGAC CGGCGCAGCC ATGACAAGCA CTGCCACAAG AAGTACCTGT CGGTGCAGGC 2040CCTGGAAGCC CCTCGGCTCA CGCAGAACTT GACCGACCTC CTGGTGAACG TGAGCGACTC 2100GCTGGAGATG CAGTGCTTGG TGGCCGGAGC GCACGCGCCC AGCATCGTGT GGTACAAAGA 2160CGAGAGGCTG CTGGAGGAAA AGTCTGGAGT CGACTTGGCG GACTCCAACC AGAAGCTGAG 2220CATCCAGCGC GTGCGCGAGG AGGATGCGGG ACGCTATCTG TGCAGCGTGT GCAACGCCAA 2280GGGCTGCGTC AACTCCTCCG CCAGCGTGGC CGTGGAAGGC TCCGAGGATA AGGGCAGCAT 2340GGAGATCGTG ATCCTTGTCG GTACCGGCGT CATCGCTGTC TTCTTCTGGG TCCTCCTCCT 2400CCTCATCTTC TGTAACATGA GGAGGCCGGC CCACGCAGAC ATCAAGACGG GCTACCTGTC 2460CATCATCATG GACCCCGGGG AGGTGCCTCT GGAGGAGCAA TGCGAATACC TGTCCTACGA 2520TGCCAGCCAG TGGGAATTCC CCCGAGAGCG GCTGCACCTG GGGAGAGTGC TCGGCTACGG 2580CGCCTTCGGG AAGGTGGTGG AAGCCTCCGC TTTCGGCATC CACAAGGGCA GCAGCTGTGA 2640CACCGTGGCC GTGAAAATGC TGAAAGAGGG CGCCACGGCC AGCGAGCACC GCGCGCTGAT 2700GTCGGAGCTC AAGATCCTCA TTCACATCGG CAACCACCTC AACGTGGTCA ACCTCCTCGG 2760GGCGTGCACC AAGCCGCAGG GCCCCCTCAT GGTGATCGTG GAGTTCTGCA AGTACGGCAA 2820CCTCTCCAAC TTCCTGCGCG CCAAGCGGGA CGCCTTCAGC CCCTGCGCGG AGAAGTCTCC 2880CGAGCAGCGC GGACGCTTCC GCGCCATGGT GGAGCTCGCC AGGCTGGATC GGAGGCGGCC 2940GGGGAGCAGC GACAGGGTCC TCTTCGCGCG GTTCTCGAAG ACCGAGGGCG GAGCGAGGCG 3000GGCTTCTCCA GACCAAGAAG CTGAGGACCT GTGGCTGAGC CCGCTGACCA TGGAAGATCT 3060TGTCTGCTAC AGCTTCCAGG TGGCCAGAGG GATGGAGTTC CTGGCTTCCC GAAAGTGCAT 3120CCACAGAGAC CTGGCTGCTC GGAACATTCT GCTGTCGGAA AGCGACGTGG TGAAGATCTG 3180TGACTTTGGC CTTGCCCGGG ACATCTACAA AGACCCTGAC TACGTCCGCA AGGGCAGTGC 3240CCGGCTGCCC CTGAAGTGGA TGGCCCCTGA AAGCATCTTC GACAAGGTGT ACACCACGCA 3300GAGTGACGTG TGGTCCTTTG GGGTGCTTCT CTGGGAGATC TTCTCTCTGG GGGCCTCCCC 3360GTACCCTGGG GTGCAGATCA ATGAGGAGTT CTGCCAGCGG CTGAGAGACG GCACAAGGAT 3420GAGGGCCCCG GAGCTGGCCA CTCCCGCCAT ACGCCGCATC ATGCTGAACT GCTGGTCCGG 3480AGACCCCAAG GCGAGACCTG CATTCTCGGA GCTGGTGGAG ATCCTGGGGG ACCTGCTCCA 3540GGGCAGGGGC CTGCAAGAGG AAGAGGAGGT CTGCATGGCC CCGCGCAGCT CTCAGAGCTC 3600AGAAGAGGGC AGCTTCTCGC AGGTGTCCAC CATGGCCCTA CACATCGCCC AGGCTGACGC 3660TGAGGACAGC CCGCCAAGCC TGCAGCGCCA CAGCCTGGCC GCCAGGTATT ACAACTGGGT 3720GTCCTTTCCC GGGTGCCTGG CCAGAGGGGC TGAGACCCGT GGTTCCTCCA GGATGAAGAC 3780ATTTGAGGAA TTCCCCATGA CCCCAACGAC CTACAAAGGC TCTGTGGACA ACCAGACAGA 3840CAGTGGGATG GTGCTGGCCT CGGAGGAGTT TGAGCAGATA GAGAGCAGGC ATAGACAAGA 3900AAGCGGCTTC AGGTAGCTGA AGCAGAGAGA GAGAAGGCAG CATACGTCAG CATTTTCTTC 3960TCTGCACTTA TAAGAAAGAT CAAAGACTTT AAGACTTTCG CTATTTCTTC TACTGCTATC 4020TACTACAAAC TTCAAAGAGG AACCAGGAGG ACAAGAGGAG CATGAAAGTG GACAAGGAGT 4080GTGACCACTG AAGCACCACA GGGAAGGGGT TAGGCCTCCG GATGACTGCG GGCAGGCCTG 4140GATAATATCC AGCCTCCCAC AAGAAGCTGG TGGAGCAGAG TGTTCCCTGA CTCCTCCAAG 4200GAAAGGGAGA CGCCCTTTCA TGGTCTGCTG AGTAACAGGT GCNTTCCCAG ACACTGGCGT 4260TACTGCTTGA CCAAAGAGCC CTCAAGCGGC CCTTATGCCA GCGTGACAGA GGGCTCACCT 4320CTTGCCTTCT AGGTCACTTC TCACACAATG TCCCTTCAGC ACCTGACCCT GTGCCCGCCA 4380GTTATTCCTT GGTAATATGA GTAATACATC AAAGAG 4416 (2)37：

(i) sequence signature:

(A) length: 4273 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi)：37：AAGCTTATCG ATTTCGAACC CGGGGGTACC GAATTCCTCG AGTCTAGAGG AGCATGCCTG 60CAGGTCGACC GGGCTCGATC CCCTCGCGAG TTGGTTCAGC TGCTGCCTGA GGCTGGACGA 120CCTCGCGGAG TTCTACCGGC AGTGCAAATC CGTCGGCATC CAGGAAACCA GCAGCGGCTA 180TCCGCGCATC CATGCCCCCG AACTGCAGGA GTGGGGAGGC ACGATGGCCG CTTTGGTCCC 240GGATCTTTGT GAAGGAACCT TACTTCTGTG GTGTGACATA ATTGGACAAA CTACCTACAG 300AGATTTAAAG CTCTAAGGTA AATATAAAAT TTTTAAGTGT ATAATGTGTT AAACTACTGA 360TTCTAATTGT TTGTGTATTT TAGATTCCAA CCTATGGAAC TGATGAATGG GAGCAGTGGT 420GGAATGCCTT TAATGAGGAA AACCTGTTTT GCTCAGAAGA AATGCCATCT AGTGATGATG 480AGGCTACTGC TGACTCTCAA CATTCTACTC CTCCAAAAAA GAAGAGAAAG GTAGAAGACC 540CCAAGGACTT TCCTTCAGAA TTGCTAAGTT TTTTGAGTCA TGCTGTGTTT AGTAATAGAA 600CTCTTGCTTG CTTTGCTATT TACACCACAA AGGAAAAAGC TGCACTGCTA TACAAGAAAA 660TTATGGAAAA ATATTCTGTA ACCTTTATAA GTAGGCATAA CAGTTATAAT CATAACATAC 720TGTTTTTTCT TACTCCACAC AGGCATAGAG TGTCTGCTAT TAATAACTAT GCTCAAAAAT 780TGTGTACCTT TAGCTTTTTA ATTTGTAAAG GGGTTAATAA GGAATATTTG ATGTATAGTG 840CCTTGACTAG AGATCATAAT CAGCCATACC ACATTTGTAG AGGTTTTACT TGCTTTAAAA 900AACCTCCCAC ACCTCCCCCT GAACCTGAAA CATAAAATGA ATGCAATTGT TGTTGTTAAC 960TTGTTTATTG CAGCTTATAA TGGTTACAAA TAAAGCAATA GCATCACAAA TTTCACAAAT 1020AAAGCATTTT TTTCACTGCA TTCTAGTTGT GGTTTGTCCA AACTCATCAA TGTATCTTAT 1080CATGTCTGGA TCTGCCGGTC TCCCTATAGT GAGTCGTATT AATTTCGATA AGCCAGGTTA 1140ACCTGCATTA ATGAATCGGC CAACGCGCGG GGAGAGGCGG TTTGCGTATT GGGCGCTCTT 1200CCGCTTCCTC GCTCACTGAC TCGCTGCGCT CGGTCGTTCG GCTGCGGCGA GCGGTATCAG 1260CTCACTCAAA GGCGGTAATA CGGTTATCCA CAGAATCAGG GGATAACGCA GGAAAGAACA 1320TGTGAGCAAA AGGCCAGCAA AAGGCCAGGA ACCGTAAAAA GGACGCGTTG CTGGCGTTTT 1380TCCATAGGCT CCGCCCCCCT GACGAGCATC ACAAAAATCG ACGCTCAAGT CAGAGGTGGC 1440GAAACCCGAC AGGACTATAA AGATACCAGG CGTTTCCCCC TGGAAGCTCC CTCGTGCGCT 1500CTCCTGTTCC GACCCTGCCG CTTACCGGAT ACCTGTCCGC CTTTCTCCCT TCGGGAAGCG 1560TGGCGCTTTC TCAATGCTCA CGCTGTAGGT ATCTCAGTTC GGTGTAGGTC GTTCGCTCCA 1620AGCTGGGCTG TGTGCACGAA CCCCCCGTTC AGCCCGACCG CTGCGCCTTA TCCGGTAACT 1680ATCGTCTTGA GTCCAACCCG GTAAGACACG ACTTATCGCC ACTGGCAGCA GCCACTGGTA 1740ACAGGATTAG CAGAGCGAGG TATGTAGGCG GTGCTACAGA GTTCTTGAAG TGGTGGCCTA 1800ACTACGGCTA CACTAGAAGG ACAGTATTTG GTATCTGCGC TCTGCTGAAG CCAGTTACCT 1860TCGGAAAAAG AGTTGGTAGC TCTTGATCCG GCAAACAAAC CACCGCTGGT AGCGGTGGTT 1920TTTTTGTTTG CAAGCAGCAG ATTACGCGCA GAAAAAAAGG ATCTCAAGAA GATCCTTTGA 1980TCTTTTCTAC GGGGTCTGAC GCTCAGTGGA ACGAAAACTC ACGTTAAGGG ATTTTGGTCA 2040TGAGATTATC AAAAAGGATC TTCACCTAGA TCCTTTTAAA TTAAAAATGA AGTTTTAAAT 2100CAATCTAAAG TATATATGAG TAAACTTGGT CTGACAGTTA CCAATGCTTA ATCAGTGAGG 2160CACCTATCTC AGCGATCTGT CTATTTCGTT CATCCATAGT TGCCTGACTC CCCGTCGTGT 2220AGATAACTAC GATACGGGAG GGCTTACCAT CTGGCCCCAG TGCTGCAATG ATACCGCGAG 2280ACCCACGCTC ACCGGCTCCA GATTTATCAG CAATAAACCA GCCAGCCGGA AGGGCCGAGC 2340GCAGAAGTGG TCCTGCAACT TTATCCGCCT CCATCCAGTC TATTAATTGT TGCCGGGAAG 2400CTAGAGTAAG TAGTTCGCCA GTTAATAGTT TGCGCAACGT TGTTGCCATT GCTACAGGCA 2460TCGTGGTGTC ACGCTCGTCG TTTGGTATGG CTTCATTCAG CTCCGGTTCC CAACGATCAA 2520GGCGAGTTAC ATGATCCCCC ATGTTGTGCA AAAAAGCGGT TAGCTCCTTC GGTCCTCCGA 2580TCGTTGTCAG AAGTAAGTTG GCCGCAGTGT TATCACTCAT GGTTATGGCA GCACTGCATA 2640ATTCTCTTAC TGTCATGCCA TCCGTAAGAT GCTTTTCTGT GACTGGTGAG TACTCAACCA 2700AGTCATTCTG AGAATAGTGT ATGCGGCGAC CGAGTTGCTC TTGCCCGGCG TCAATACGGG 2760ATAATACCGC GCCACATAGC AGAACTTTAA AAGTGCTCAT CATTGGAAAA CGTTCTTCGG 2820GGCGAAAACT CTCAAGGATC TTACCGCTGT TGAGATCCAG TTCGATGTAA CCCACTCGTG 2880CACCCAACTG ATCTTCAGCA TCTTTTACTT TCACCAGCGT TTCTGGGTGA GCAAAAACAG 2940GAAGGCAAAA TGCCGCAAAA AAGGGAATAA GGGCGACACG GAAATGTTGA ATACTCATAC 3000TCTTCCTTTT TCAATATTAT TGAAGCATTT ATCAGGGTTA TTGTCTCATG AGCGGATACA 3060TATTTGAATG TATTTAGAAA AATAAACAAA TAGGGGTTCC GCGCACATTT CCCCGAAAAG 3120TGCCACCTGA CGTCTAAGAA ACCATTATTA TCATGACATT AACCTATAAA AATAGGCGTA 3180TCACGAGGCC CTTTCGTCTC GCGCGTTTCG GTGATGACGG TGAAAACCTC TGACACATGC 3240AGCTCCCGGA GACGGTCACA GCTTGTCTGT AAGCGGATGC CGGGAGCAGA CAAGCCCGTC 3300AGGGCGCGTC AGCGGGTGTT GGCGGGTGTC GGGGCTGGCT TAACTATGCG GCATCAGAGC 3360AGATTGTACT GAGAGTGCAC CATATGGACA TATTGTCGTT AGAACGCGGC TACAATTAAT 3420ACATAACCTT ATGTATCATA CACATACGAT TTAGGTGACA CTATAGAACT CGAGCAGAGC 3480TTCCAAATTG AGAGAGAGGC TTAATCAGAG ACAGAAACTG TTTGAGTCAA CTCAAGGATG 3540GTTTGAGGGA CTGTTTAACA GATCCCCTTG GTTTACCACC TTGATATCTA CCATTATGGG 3600ACCCCTCATT GTACTCCTAA TGATTTTGCT CTTCGGACCC TGCATTCTTA ATCGATTAGT 3660CCAATTTGTT AAAGACAGGA TATCAGTGGT CCAGGCTCTA GTTTTGACTC AACAATATCA 3720CCAGCTGAAG CCTATAGAGT ACGAGCCATA GATAAAATAA AAGATTTTAT TTAGTCTCCA 3780GAAAAAGGGG GGAATGAAAG ACCCCACCTG TAGGTTTGGC AAGCTAGCTT AAGTAACGCC 3840ATTTTGCAAG GCATGGAAAA ATACATAACT GAGAATAGAG AAGTTCAGAT CAAGGTCAGG 3900AACAGATGGA ACAGCTGAAT ATGGGCCAAA CAGGATATCT GTGGTAAGCA GTTCCTGCCC 3960CGGCTCAGGG CCAAGAACAG ATGGAACAGC TGAATATGGG CCAAACAGGA TATCTGTGGT 4020AAGCAGTTCC TGCCCCGGCT CAGGGCCAAG AACAGATGGT CCCCAGATGC GGTCCAGCCC 4080TCAGCAGTTT CTAGAGAACC ATCAGATGTT TCCAGGGTGC CCCAAGGACC TGAAATGACC 4140CTGTGCCTTA TTTGAACTAA CCAATCAGTT CGCTTCTCGC TTCTGTTCGC GCGCTTCTGC 4200TCCCCGAGCT CAATAAAAGA GCCCACAACC CCTCACTCGG GGCGCCAGTC CTCCGATTGA 4260CTGAGTCGCC CGG 4273 (2)38：

(i) sequence signature:

(A) length: 216 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linear (ii) molecule type: cDNA (xi) sequence description: sequence 38:CAAGAAAGCG GCTTCAGCTG TAAAGGACCT GGCCAGAATG TGGCTGTGAC CAGGGCACAC 60CCTGACTCCC AAGGGAGGCG GCGGCGGCCT GAGCGGGGGG CCCGAGGAGG CCAGGTGTTT 120TACAACAGCG AGTATGGGGA GCTGTCGGAG CCAAGCGAGG AGGACCACTG CTCCCCGTCT 180GCCCGCGTGA CTTTCTTCAC AGACAACAGC TACTAA 216 (2) sequences 39 data:

(i) sequence signature:

(A) length: 17 amino acid

(B) type: amino acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: peptide

(xi) sequence description: sequence 39:Glu Glu Thr Ile Lys Phe Ala Ala Ala His Tyr Asn Thr Glu Ile Leu1 5 10 15Lys (2) sequence 40 data:

(i) sequence signature:

(A) length: 1836 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(ix) feature:

(A) title/index: CDS

(B) position: 168..1412

(xi) sequence description: sequence 40:GCGGCCGCGT CGACGCAAAA GTTGCGAGCC GCCGAGTCCC GGGAGACGCT CGCCCAGGGG 60GGTCCCCGGG AGGAAACCAC GGGACAGGGA CCAGGAGAGG ACCTCAGCCT CACGCCCCAG 120CCTGCGCCAG CCAACGGACC GGCCTCCCTG CTCCCGGTCC ATCCACC ATG CAC TTG 176

Met?His?Leu

1CTG?TGC?TTC?TTG?TCT?CTG?GCG?TGT?TCC?CTG?CTC?GCC?GCT?GCG?CTG?ATC 224Leu?Cys?Phe?Leu?Ser?Leu?Ala?Cys?Ser?Leu?Leu?Ala?Ala?Ala?Leu?Ile

5 10 15CCC?AGT?CCG?CGC?GAG?GCG?CCC?GCC?ACC?GTC?GCC?GCC?TTC?GAG?TCG?GGA 272Pro?Ser?Pro?Arg?Glu?Ala?Pro?Ala?Thr?Val?Ala?Ala?Phe?Glu?Ser?Gly?20 25 30 35CTG?GGC?TTC?TCG?GAA?GCG?GAG?CCC?GAC?GGG?GGC?GAG?GTC?AAG?GCT?TTT 320Leu?Gly?Phe?Ser?Glu?Ala?Glu?Pro?Asp?Gly?Gly?Glu?Val?Lys?Ala?Phe

40 45 50GAA?GGC?AAA?GAC?CTG?GAG?GAG?CAG?TTG?CGG?TCT?GTG?TCC?AGC?GTA?GAT 368Glu?Gly?Lys?Asp?Leu?Glu?Glu?Gln?Leu?Arg?Ser?Val?Ser?Ser?Val?Asp

55 60 65GAG?CTG?ATG?TCT?GTC?CTG?TAC?CCA?GAC?TAC?TGG?AAA?ATG?TAC?AAG?TGC 416Glu?Leu?Met?Ser?Val?Leu?Tyr?Pro?Asp?Tyr?Trp?Lys?Met?Tyr?Lys?Cys

70 75 80CAG?CTG?CGG?AAA?GGC?GGC?TGG?CAG?CAG?CCC?ACC?CTC?AAT?ACC?AGG?ACA 464Gln?Leu?Arg?Lys?Gly?Gly?Trp?Gln?Gln?Pro?Thr?Leu?Asn?Thr?Arg?Thr

85 90 95GGG?GAC?AGT?GTA?AAA?TTT?GCT?GCT?GCA?CAT?TAT?AAC?ACA?GAG?ATC?CTG 512Gly?Asp?Ser?Val?Lys?Phe?Ala?Ala?Ala?His?Tyr?Asn?Thr?Glu?Ile?Leu100 105 110 115AAA?AGT?ATT?GAT?AAT?GAG?TGG?AGA?AAG?ACT?CAA?TGC?ATG?CCA?CGT?GAG 560Lys?Ser?Ile?Asp?Asn?Glu?Trp?Arg?Lys?Thr?Gln?Cys?Met?Pro?Arg?Glu

120 125 130GTG?TGT?ATA?GAT?GTG?GGG?AAG?GAG?TTT?GGA?GCA?GCC?ACA?AAC?ACC?TTC 608Val?Cys?Ile?Asp?Val?Gly?Lys?Glu?Phe?Gly?Ala?Ala?Thr?Asn?Thr?Phe

135 140 145TTT?AAA?CCT?CCA?TGT?GTG?TCC?GTC?TAC?AGA?TGT?GGG?GGT?TGC?TGC?AAC 656Phe?Lys?Pro?Pro?Cys?Val?Ser?Val?Tyr?Arg?Cys?Gly?Gly?Cys?Cys?Asn

150 155 160AGG?GAG?GGG?CTG?CAG?TGC?ATG?AAC?ACC?AGC?ACA?GGT?TAC?CTC?AGC?AAG 704Arg?Glu?Gly?Leu?Gln?Cys?Met?Asn?Thr?Ser?Thr?Gly?Tyr?Leu?Ser?Lys

165 170 175ACG?TTG?TTT?GAA?ATT?ACA?GTG?CCT?CTC?TCA?CAA?GGC?CCC?AAA?CCA?GTC 752Thr?Leu?Phe?Glu?Ile?Thr?Val?Pro?Leu?Ser?Gln?Gly?Pro?Lys?Pro?Val180 185 190 195ACA?ATC?AGT?TTT?GCC?AAT?CAC?ACT?TCC?TGC?CGG?TGC?ATG?TCT?AAA?CTG 800Thr?Ile?Ser?Phe?Ala?Asn?His?Thr?Ser?Cys?Arg?Cys?Met?Ser?Lys?Leu

200 205 210GAT?GTT?TAC?AGA?CAA?GTT?CAT?TCA?ATT?ATT?AGA?CGT?TCT?CTG?CCA?GCA 848Asp?Val?Tyr?Arg?Gln?Val?His?Ser?Ile?Ile?Arg?Arg?Ser?Leu?Pro?Ala

215 220 225ACA?TTA?CCA?CAG?TGT?CAG?GCA?GCT?AAC?AAG?ACA?TGT?CCA?ACA?AAC?TAT 896Thr?Leu?Pro?Gln?Cys?Gln?Ala?Ala?Asn?Lys?Thr?Cys?Pro?Thr?Asn?Tyr

230 235 240GTG?TGG?AAT?AAC?TAC?ATG?TGC?CGA?TGC?CTG?GCT?CAG?CAG?GAT?TTT?ATC 944Val?Trp?Asn?Asn?Tyr?Met?Cys?Arg?Cys?Leu?Ala?Gln?Gln?Asp?Phe?Ile

245 250 255TTT?TAT?TCA?AAT?GTT?GAA?GAT?GAC?TCA?ACC?AAT?GGA?TTC?CAT?GAT?GTC 992Phe?Tyr?Ser?Asn?Val?Glu?Asp?Asp?Ser?Thr?Asn?Gly?Phe?His?Asp?Val260 265 270 275TGT?GGA?CCC?AAC?AAG?GAG?CTG?GAT?GAA?GAC?ACC?TGT?CAG?TGT?GTC?TGC 1040Cys?Gly?Pro?Asn?Lys?Glu?Leu?Asp?Glu?Asp?Thr?Cys?Gln?Cys?Val?Cys

280 285 290AAG?GGG?GGG?CTT?CGG?CCA?TCT?AGT?TGT?GGA?CCC?CAC?AAA?GAA?CTA?GAT 1088Lys?Gly?Gly?Leu?Arg?Pro?Ser?Ser?Cys?Gly?Pro?His?Lys?Glu?Leu?Asp

295 300 305AGA?GAC?TCA?TGT?CAG?TGT?GTC?TGT?AAA?AAC?AAA?CTT?TTC?CCT?AAT?TCA 1136Arg?Asp?Ser?Cys?Gln?Cys?Val?Cys?Lys?Asn?Lys?Leu?Phe?Pro?Asn?Ser

310 315 320TGT?GGA?GCC?AAC?AGG?GAA?TTT?GAT?GAG?AAT?ACA?TGT?CAG?TGT?GTA?TGT 1184Cys?Gly?Ala?Asn?Arg?Glu?Phe?Asp?Glu?Asn?Thr?Cys?Gln?Cys?Val?Cys

325 330 335AAA?AGA?ACG?TGT?CCA?AGA?AAT?CAG?CCC?CTG?AAT?CCT?GGG?AAA?TGT?GCC 1232Lys?Arg?Thr?Cys?Pro?Arg?Asn?Gln?Pro?Leu?Asn?Pro?Gly?Lys?Cys?Ala340 345 350 355TGT?GAA?TGT?ACA?GAA?AAC?ACA?CAG?AAG?TGC?TTC?CTT?AAA?GGG?AAG?AAG 1280Cys?Glu?Cys?Thr?Glu?Asn?Thr?Gln?Lys?Cys?Phe?Leu?Lys?Gly?Lys?Lys

360 365 370TTC?CAC?CAT?CAA?ACA?TGC?AGT?TGT?TAC?AGA?AGA?CCG?TGT?GCG?AAT?CGA 1328Phe?His?His?Gln?Thr?Cys?Ser?Cys?Tyr?Arg?Arg?Pro?Cys?Ala?Asn?Arg

375 380 385CTG?AAG?CAT?TGT?GAT?CCA?GGA?CTG?TCC?TTT?AGT?GAA?GAA?GTA?TGC?CGC 1376Leu?Lys?His?Cys?Asp?Pro?Gly?Leu?Ser?Phe?Ser?Glu?Glu?Val?Cys?Arg

390 395 400TGT?GTC?CCA?TCG?TAT?TGG?AAA?AGG?CCA?CAT?CTG?AAC?TAAGATCATA 1422Cys?Val?Pro?Ser?Tyr?Trp?Lys?Arg?Pro?His?Leu?Asn

405 410 415CCAGTTTTCA GTCAGTCACA GTCATTTACT CTCTTGAAGA CTGTTGGAAC AGCACTTAGC 1482ACTGTCTATG CACAGAAAGA CTCTGTGGGA CCACATGGTA ACAGAGGCCC AAGTCTGTGT 1542TTATTGAACC ATGTGGATTA CTGCGGGAGA GGACTGGCAC TCATGTGCAA AAAAAACCTC 1602TTCAAAGACT GGTTTTCTGC CAGGGACCAG ACAGCTGAGG TTTTTCTCTT GTGATTTAAA 1662AAAAGAATGA CTATATAATT TATTTCCACT AAAAATATTG TTCCTGCATT CATTTTTATA 1722GCAATAACAA TTGGTAAAGC TCACTGTGAT CAGTATTTTT ATAACATGCA AAACTATGTT 1782TAAAATAAAA TGAAAATTGT ATTATAAAAA AAAAAAAAAA AAAAAAAAAA GCTT, 1836 (2) sequences, 41 data:

(i) sequence signature:

(A) length: 415 amino acid

(B) type: amino acid

(D) topological structure: linearity

(ii) molecule type: protein

(xi) sequence description: sequence 41:Met His Leu Leu Cys Phe Leu Ser Leu Ala Cys Ser Leu Leu Ala Ala 15 10 15Ala Leu Ile Pro Ser Pro Arg Glu Ala Pro Ala Thr Val Ala Ala Phe

20 25 30Glu?Ser?Gly?Leu?Gly?Phe?Ser?Glu?Ala?Glu?Pro?Asp?Gly?Gly?Glu?Val

35 40 45Lys?Ala?Phe?Glu?Gly?Lys?Asp?Leu?Glu?Glu?Gln?Leu?Arg?Ser?Val?Ser

50 55 60Ser?Val?Asp?Glu?Leu?Met?Ser?Val?Leu?Tyr?Pro?Asp?Tyr?Trp?Lys?Met?65 70 75 80Tyr?Lys?Cys?Gln?Leu?Arg?Lys?Gly?Gly?Trp?Gln?Gln?Pro?Thr?Leu?Asn

85 90 95Thr?Arg?Thr?Gly?Asp?Ser?Val?Lys?Phe?Ala?Ala?Ala?His?Tyr?Asn?Thr

100 105 110Glu?Ile?Leu?Lys?Ser?Ile?Asp?Asn?Glu?Trp?Arg?Lys?Thr?Gln?Cys?Met

115 120 125Pro?Arg?Glu?Val?Cys?Ile?Asp?Val?Gly?Lys?Glu?Phe?Gly?Ala?Ala?Thr

130 135 140Asn?Thr?Phe?Phe?Lys?Pro?Pro?Cys?Val?Ser?Val?Tyr?Arg?Cys?Gly?Gly145 150 155 160Cys?Cys?Asn?Arg?Glu?Gly?Leu?Gln?Cys?Met?Asn?Thr?Ser?Thr?Gly?Tyr

165 170 175Leu?Ser?Lys?Thr?Leu?Phe?Glu?Ile?Thr?Val?Pro?Leu?Ser?Gln?Gly?Pro

180 185 190Lys?Pro?Val?Thr?Ile?Ser?Phe?Ala?Asn?His?Thr?Ser?Cys?Arg?Cys?Met

195 200 205Ser?Lys?Leu?Asp?Val?Tyr?Arg?Gln?Val?His?Ser?Ile?Ile?Arg?Arg?Ser

210 215 220Leu?Pro?Ala?Thr?Leu?Pro?Gln?Cys?Gln?Ala?Ala?Asn?Lys?Thr?Cys?Pro225 230 235 240Thr?Asn?Tyr?Val?Trp?Asn?Asn?Tyr?Met?Cys?Arg?Cys?Leu?Ala?Gln?Gln

245 250 255Asp?Phe?Ile?Phe?Tyr?Ser?Asn?Val?Glu?Asp?Asp?Ser?Thr?Asn?Gly?Phe

260 265 270His?Asp?Val?Cys?Gly?Pro?Asn?Lys?Glu?Leu?Asp?Glu?Asp?Thr?Cys?Gln

275 280 285Cys?Val?Cys?Lys?Gly?Gly?Leu?Arg?Pro?Ser?Ser?Cys?Gly?Pro?His?Lys

290 295 300Glu?Leu?Asp?Arg?Asp?Ser?Cys?Gln?Cys?Val?Cys?Lys?Asn?Lys?Leu?Phe305 310 315 320Pro?Asn?Ser?Cys?Gly?Ala?Asn?Arg?Glu?Phe?Asp?Glu?Asn?Thr?Cys?Gln

325 330 335Cys?Val?Cys?Lys?Arg?Thr?Cys?Pro?Arg?Asn?Gln?Pro?Leu?Asn?Pro?Gly

340 345 350Lys?Cys?Ala?Cys?Glu?Cys?Thr?Glu?Asn?Thr?Gln?Lys?Cys?Phe?Leu?Lys

355 360 365Gly?Lys?Lys?Phe?His?His?Gln?Thr?Cys?Ser?Cys?Tyr?Arg?Arg?Pro?Cys

370 375 380Ala?Asn?Arg?Leu?Lys?His?Cys?Asp?Pro?Gly?Leu?Ser?phe?Ser?Glu?Glu385 390 395 400Val?Cys?Arg?Cys?Val?Pro?Ser?Tyr?Trp?Lys?Arg?Pro?His?Leu?Asn

405 410 415 (2) sequences, 42 data:

(i) sequence signature:

(A) length: 22 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 42:TCTCTTCTGT GCTTGAGTTG AG 22 (2) sequences 43 data:

(i) sequence signature:

(A) length: 22 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 43:TCTCTTCTGT CCCTGAGTTG AG 22 (2) sequences 44 data:

(i) sequence signature:

(A) length: 65 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 44:TGTGCTGCAG CAAATTTTAT AGTCTCTTCT GTGGCGGCGG CGGCGGCGGG CGCCTCGCGA 60GGACC 65 (2) sequences 45 data:

(i) sequence signature:

(A) length: 30 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 45:CTGGCAGGGA ACTGCTAATA ATGGAATGAA 30 (2) sequences 46 data:

(i) sequence signature:

(A) length: 84 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 46:GGGCTCCGCG TCCGAGAGGT CGAGTCCGGA CTCGTGATGG TGATGGTGAT GGGCGGCGGC 60GGCGGCGGGC GCCTCGCGAG GACC 84 (2) sequences 47 data:

(i) sequence signature:

(A) length: 31 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 47:GTATTATAAT GTCCTCCACC AAATTTTATA G 31 (2) sequences 48 data:

(i) sequence signature:

(A) length: 93 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 48:GTTCGCTGCC TGACACTGTG GTAGTGTTGC TGGCGGCCGC TAGTGATGGT GATGGTGATG 60AATAATGGAA TGAACTTGTC TGTAAACATC CAG 93 (2) sequences 49 data:

(i) sequence signature:

(A) length: 18 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 49:CATGTACGAA CCGCCAGG 18 (2) sequences 50 data:

(i) sequence signature:

(A) length: 20 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 50:AATGACCAGA GAGAGGCGAG 20 (2) sequences 51 data:

(i) sequence signature:

(A) length: 10 amino acid

(B) type: amino acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: sequence 51:Ala Val Val Met Thr Gln Thr pro Ala Ser1 5 10 (2) sequences 52 data:

(i) sequence signature:

(A) length: 1741 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ix) feature:

(A) title/index: CDS

(B) position: 453..1706

(xi) sequence description: sequence 52:GCCCCCGCCG AGCGCTCCGC GCGCAGCCGC CGGGCCGGGC CGGCCCGCGG AGGGCGCGCT 60GCGAGCGGCC ACTGGGTCCT GCTTCCCTCC TTCCTCTCCC TCCTCCTCCT CCTCCTTCTC 120TCTGCGCTTT CCACCGCTCC CGAGCGAGCG CACGCTCGGA TGTCCGGTTT CCTGGTGGGT 180TTTTTACCTG GCAAAGTCCG GATAACTTCG GTGAGAATTT GCAAAGAGGC TGGGAGCTCC 240CCTGCAGGCG TCTGGGAGCT GCTGCCGCCG TCGCATCTTC TCCATCCCGC GGATTTTACT 300GCCTTGGATA TTGCGAGGGG AGGGAGGGGG GTGAGGACAG CAAAAAGAAA GGGGTGGGGG 360GGGGGAGAGA AAAGGAAAAG AAGGAGCCTC GGAATTGTGC CCGCATTCCT GCGCTGCCCC 420GCGGCCCCCC TCCGCTCTGC CATCTCCGCA CA ATG CAC TTG CTG GAG ATG CTC 473

Met?His?Leu?Leu?Glu?Met?Leu

1 5TCC?CTG?GGC?TGC?TGC?CTC?GCT?GCT?GGC?GCC?GTG?CTC?CTG?GGA?CCC?CGG 521Ser?Leu?Gly?Cys?Cys?Leu?Ala?Ala?Gly?Ala?Val?Leu?Leu?Gly?Pro?Arg

10 15 20CAG?CCG?CCC?GTC?GCC?GCC?GCC?TAC?GAG?TCC?GGG?CAC?GGC?TAC?TAC?GAG 569Gln?Pro?Pro?Val?Ala?Ala?Ala?Tyr?Glu?Ser?Gly?His?Gly?Tyr?Tyr?Glu

25 30 35GAG?GAG?CCC?GGT?GCC?GGG?GAA?CCC?AAG?GCT?CAT?GCA?AGC?AAA?GAC?CTG 617Glu?Glu?Pro?Gly?Ala?Gly?Glu?Pro?Lys?Ala?His?Ala?Ser?Lys?Asp?Leu?40 45 50 55GAA?GAG?CAG?TTG?CGA?TCT?GTG?TCC?AGT?GTG?GAT?GAA?CTC?ATG?ACA?GTA 665Glu?Glu?Gln?Leu?Arg?Ser?Val?Ser?Ser?Val?Asp?Glu?Leu?Met?Thr?Val

60 65 70CTT?TAC?CCA?GAA?TAC?TGG?AAA?ATG?TTC?AAA?TGT?CAG?TTG?AGG?AAA?GGA 713Leu?Tyr?Pro?Glu?Tyr?Trp?Lys?Met?Phe?Lys?Cys?Gln?Leu?Arg?Lys?Gly

75 80 85GGT?TGG?CAA?CAC?AAC?AGG?GAA?CAC?TCC?AGC?TCT?GAT?ACA?AGA?TCA?GAT 761Gly?Trp?Gln?His?Asn?Arg?Glu?His?Ser?Ser?Ser?Asp?Thr?Arg?Ser?Asp

90 95 100GAT?TCA?TTG?AAA?TTT?GCC?GCA?GCA?CAT?TAT?AAT?GCA?GAG?ATC?CTG?AAA 809Asp?Ser?Leu?Lys?Phe?Ala?Ala?Ala?His?Tyr?Asn?Ala?Glu?Ile?Leu?Lys

105 110 115AGT?ATT?GAT?ACT?GAA?TGG?AGA?AAA?ACC?CAG?GGC?ATG?CCA?CGT?GAA?GTG 857Ser?Ile?Asp?Thr?Glu?Trp?Arg?Lys?Thr?Gln?Gly?Met?Pro?Arg?Glu?Val120 125 130 135TGT?GTG?GAT?TTG?GGG?AAA?GAG?TTT?GGA?GCA?ACT?ACA?AAC?ACC?TTC?TTT 905Cys?Val?Asp?Leu?Gly?Lys?Glu?Phe?Gly?Ala?Thr?Thr?Asn?Thr?Phe?Phe

140 145 150AAA?CCC?CCG?TGT?GTA?TCC?ATC?TAC?AGA?TGT?GGA?GGT?TGC?TGC?AAT?AGT 953Lys?Pro?Pro?Cys?Val?Ser?Ile?Tyr?Arg?Cys?Gly?Gly?Cys?Cys?Asn?Ser

155 160 165GAA?GGA?CTC?CAG?TGT?ATG?AAT?ATC?AGC?ACA?AAT?TAC?ATC?AGC?AAG?ACA 1001Glu?Gly?Leu?Gln?Cys?Met?Asn?Ile?Ser?Thr?Asn?Tyr?Ile?Ser?Lys?Thr

170 175 180TTG?TTT?GAG?ATT?ACA?GTG?CCT?CTC?TCT?CAT?GGC?CCC?AAA?CCT?GTA?ACA 1049Leu?Phe?Glu?Ile?Thr?Val?Pro?Leu?Ser?His?Gly?Pro?Lys?Pro?Val?Thr

185 190 195GTC?AGT?TTT?GCC?AAT?CAC?ACG?TCC?TGC?CGA?TGC?ATG?TCT?AAG?TTG?GAT 1097Val?Ser?Phe?Ala?Asn?His?Thr?Ser?Cys?Arg?Cys?Met?Ser?Lys?Leu?Asp200 205 210 215GTT?TAC?AGA?CAA?GTT?CAT?TCT?ATC?ATA?AGA?CGT?TCC?TTG?CCA?GCA?ACA 1145Val?Tyr?Arg?Gln?Val?His?Ser?Ile?Ile?Arg?Arg?Ser?Leu?Pro?Ala?Thr

220 225 230CAA?ACT?CAG?TGT?CAT?GTG?GCA?AAC?AAG?ACC?TGT?CCA?AAA?AAT?CAT?GTC 1193Gln?Thr?Gln?Cys?His?Val?Ala?Asn?Lys?Thr?Cys?Pro?Lys?Asn?His?Val

235 240 245TGG?AAT?AAT?CAG?ATT?TGC?AGA?TGC?TTA?GCA?CAG?CAC?GAT?TTT?GGT?TTC 1241Trp?Asn?Asn?Gln?Ile?Cys?Arg?Cys?Leu?Ala?Gln?His?Asp?Phe?Gly?Phe

250 255 260TCT?TCT?CAC?CTT?GGA?GAT?TCT?GAC?ACA?TCT?GAA?GGA?TTC?CAT?ATT?TGT 1289Ser?Ser?His?Leu?Gly?Asp?Ser?Asp?Thr?Ser?Glu?Gly?Phe?His?Ile?Cys

265 270 275GGG?CCC?AAC?AAA?GAG?CTG?GAT?GAA?GAA?ACC?TGT?CAA?TGC?GTC?TGC?AAA 1337Gly?Pro?Asn?Lys?Glu?Leu?Asp?Glu?Glu?Thr?Cys?Gln?Cys?Val?Cys?Lys280 285 290 295GGA?GGT?GTG?CGG?CCC?ATA?AGC?TGT?GGC?CCT?CAC?AAA?GAA?CTA?GAC?AGG 1385Gly?Gly?Val?Arg?Pro?Ile?Ser?Cys?Gly?Pro?His?Lys?Glu?Leu?Asp?Arg

300 305 310GCA?TCA?TGT?CAG?TGC?ATG?TGC?AAA?AAC?AAA?CTG?CTC?CCC?AGT?TCC?TGT 1433Ala?Ser?Cys?Gln?Cys?Met?Cys?Lys?Asn?Lys?Leu?Leu?Pro?Ser?Ser?Cys

315 320 325GGG?CCT?AAC?AAA?GAA?TTT?GAT?GAA?GAA?AAG?TGC?CAG?TGT?GTA?TGT?AAA 1481Gly?Pro?Asn?Lys?Glu?Phe?Asp?Glu?Glu?Lys?Cys?Gln?Cys?Val?Cys?Lys

330 335 340AAG?ACC?TGT?CCC?AAA?CAT?CAT?CCA?CTA?AAT?CCT?GCA?AAA?TGC?ATC?TGC 1529Lys?Thr?Cys?Pro?Lys?His?His?Pro?Leu?Asn?Pro?Ala?Lys?Cys?Ile?Cys

345 350 355GAA?TGT?ACA?GAA?TCT?CCC?AAT?AAA?TGT?TTC?TTA?AAA?GGA?AAA?AGA?TTT 1577Glu?Cys?Thr?Glu?Ser?Pro?Asn?Lys?Cys?Phe?Leu?Lys?Gly?Lys?Arg?Phe360 365 370 375CAT?CAC?CAG?ACA?TGC?AGT?TGT?TAC?AGA?CCA?CCA?TGT?ACA?GTC?CGA?ACG 1625His?His?Gln?Thr?Cys?Ser?Cys?Tyr?Arg?Pro?Pro?Cys?Thr?Val?Arg?Thr

380 385 390AAA?CGC?TGT?GAT?GCT?GGA?TTT?CTG?TTA?GCT?GAA?GAA?GTG?TGC?CGC?TGT 1673Lys?Arg?Cys?Asp?Ala?Gly?Phe?Leu?Leu?Ala?Glu?Glu?Val?Cys?Arg?Cys

395 400 405GTA?CGC?ACA?TCT?TGG?AAA?AGA?CCA?CTT?ATG?AAT?TAAGCGAAGA?AAGCACTACT 1726Val?Arg?Thr?Ser?Trp?Lys?Arg?Pro?Leu?Met?Asn

410 415CGCTATATAG TGTCG, 1741 (2) sequences, 53 data:

(i) sequence signature:

(A) length: 418 amino acid

(B) type: amino acid

(D) topological structure: linearity

(ii) molecule type: protein

(xi) sequence description: sequence 53:Met His Leu Leu Glu Met Leu Ser Leu Gly Cys Cys Leu Ala Ala Gly 15 10 15Ala Val Leu Leu Gly Pro Arg Gln Pro Pro Val Ala Ala Ala Tyr Glu

20 25 30Ser?Gly?His?Gly?Tyr?Tyr?Glu?Glu?Glu?Pro?Gly?Ala?Gly?Glu?Pro?Lys

35 40 45Ala?His?Ala?Ser?Lys?Asp?Leu?Glu?Glu?Gln?Leu?Arg?Ser?Val?Ser?Ser

50 55 60Val?Asp?Glu?Leu?Met?Thr?Val?Leu?Tyr?Pro?Glu?Tyr?Trp?Lys?Met?Phe?65 70 75 80Lys?Cys?Gln?Leu?Arg?Lys?Gly?Gly?Trp?Gln?His?Asn?Arg?Glu?His?Ser

85 90 95Ser?Ser?Asp?Thr?Arg?Ser?Asp?Asp?Ser?Leu?Lys?Phe?Ala?Ala?Ala?His

100 105 110Tyr?Asn?Ala?Glu?Ile?Leu?Lys?Ser?Ile?Asp?Thr?Glu?Trp?Arg?Lys?Thr

115 120 125Gln?Gly?Met?Pro?Arg?Glu?Val?Cys?Val?Asp?Leu?Gly?Lys?Glu?Phe?Gly

130 135 140Ala?Thr?Thr?Asn?Thr?Phe?Phe?Lys?Pro?Pro?Cys?Val?Ser?Ile?Tyr?Arg145 150 155 160Cys?Gly?Gly?Cys?Cys?Asn?Ser?Glu?Gly?Leu?Gln?Cys?Met?Asn?Ile?Ser

165 170 175Thr?Asn?Tyr?Ile?Ser?Lys?Thr?Leu?Phe?Glu?Ile?Thr?Val?Pro?Leu?Ser

180 185 190His?Gly?Pro?Lys?Pro?Val?Thr?Val?Ser?Phe?Ala?Asn?His?Thr?Ser?Cys

195 200 205Arg?Cys?Met?Ser?Lys?Leu?Asp?Val?Tyr?Arg?Gln?Val?His?Ser?Ile?Ile

210 215 220Arg?Arg?Ser?Leu?Pro?Ala?Thr?Gln?Thr?Gln?Cys?His?Val?Ala?Asn?Lys225 230 235 240Thr?Cys?Pro?Lys?Asn?His?Val?Trp?Asn?Asn?Gln?Ile?Cys?Arg?Cys?Leu

245 250 255Ala?Gln?His?Asp?Phe?Gly?Phe?Ser?Ser?His?Leu?Gly?Asp?Ser?Asp?Thr

260 265 270Ser?Glu?Gly?Phe?His?Ile?Cys?Gly?Pro?Asn?Lys?Glu?Leu?Asp?Glu?Glu

275 280 285Thr?Cys?Gln?Cys?Val?Cys?Lys?Gly?Gly?Val?Arg?Pro?Ile?Ser?Cys?Gly

290 295 300Pro?His?Lys?Glu?Leu?Asp?Arg?Ala?Ser?Cys?Gln?Cys?Met?Cys?Lys?Asn305 310 315 320Lys?Leu?Leu?Pro?Ser?Ser?Cys?Gly?Pro?Asn?Lys?Glu?Phe?Asp?Glu?Glu

325 330 335Lys?Cys?Gln?Cys?Val?Cys?Lys?Lys?Thr?Cys?Pro?Lys?His?His?Pro?Leu

340 345 350Asn?Pro?Ala?Lys?Cys?Ile?Cys?Glu?Cys?Thr?Glu?Ser?Pro?Asn?Lys?Cys

355 360 365Phe?Leu?Lys?Gly?Lys?Arg?Phe?His?His?Gln?Thr?Cys?Ser?Cys?Tyr?Arg

370 375 380Pro?Pro?Cys?Thr?Val?Arg?Thr?Lys?Arg?Cys?Asp?Ala?Gly?Phe?Leu?Leu385 390 395 400Ala?Glu?Glu?Val?Cys?Arg?Cys?Val?Arg?Thr?Ser?Trp?Lys?Arg?Pro?Leu

405 410 415Met Asn (2) sequences, 54 data:

(i) sequence signature:

(A) length: 1582 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: DNA (genome)

( xi ) ：54：CTAGAGTTGA ACCAGATAAG AAAGTCTCTT CTTCCGGTAA GATATTATGG ACCTATAACA 60TCTGTGTACT TAAAAGTAGA TTGGGAGTGA AAGGCAGACT TTTGATGTTC TGTACACTGT 120TGAAACCCCT TAGCGTGGTC CTCTGTAACC TGCTCACCCT GCCCCAAGGA GGCAGCTAGC 180CAATGCCACC AGCCCAACGG AAACCCCAGT GCTTTTCCAA TGGGGAAATG CAGTCACTTT 240TCTTTGGATG CTACACATCC TTTCTGGAAT ATGTCTCACA CACATCTCTC TTTATCACCC 300CCTTTTTCAA GTAAACCAAC TTCTTGCAGA AGCTGACAAT GTGTCTCTTT ACTCTCCACG 360AAGATTCTGG CCCTTCTCTT CACCTGTCAG AAGTTTAGGA TTCCAAAGGG ATCATTAGCA 420TCCATCCCAA CAGCCTGCAC TGCATCCTGA GAACTGCGGT TCTTGGATCA TCAGGCAACT 480TTCAACTACA CAGACCAAGG GAGAGAGGGG ACCCCTCCGA GGTCCCATAG GGTTCTCTGA 540CATAGTGATG ACCTTTTTCC AAACTTTGAG CAGGGCGCTG GGGGCCAGGC GTGCGGGAGG 600GAGGACAAGA ACTCGGGAGT GGCCGAGGAT AAAGCGGGGG CTCCCTCCAC CCCACGGTGC 660CCAGTTTCTC CCCGCTGCAC GTGGTCCAGG GTGGTCGCAT CACCTCTAAA GCCGGTCCCG 720CCAACCGCCA GCCCCGGGAC TGAACTTGCC CCTCCGGCCG CCCGCTCCCC GCAGGGGACA 780GGGGCGGGGA GGGAGAGATC CAGAGGGGGG CTGGGGGAGG TGGGNCCGCC GGGGAGGAGN 840CGAGGGAAAC GGGGAGCTCC AGGGAGACGG CTTCCGAGGG AGAGTGAGAG GGGAGGGCAG 900CCCGGGCTCG GCACGCTCCC TCCCTCGGCC GCTTTCTCTC ACATAAGCGC AGGCAGAGGG 960CGCGTCAGTC ATGCCCTGCC CCTGCGCCCG CCGCCGCCGC CGCCGCCGCT CAGCCCGGCG 1020CGCTCTGGAG GATCCTGCGC CGCGGCGCTC CCGGGCCCCG CCGCCGCCAG CCGCCCCGGC 1080GGCCCTCCTC CCGCCCCCGG CACCGCCGCC AGCGCCCCCG CCGCAGCGCC CGCGGCCCGG 1140CTCCTCTCAC TTCGGGGAAG GGGAGGGAGG AGGGGGACGA GGGCTCTGGC GGGTTTGGAG 1200GGGCTGAACA TCGCGGGGTG TTCTGGTGTC CCCCGCCCCG CCTCTCCAAA AAGCTACACC 1260GACGCGGACC GCGGCGGCGT CCTCCCTCGC CCTCGCTTCA CCTCGCGGGC TCCGAATGCG 1320GGGAGCTCGG ATGTCCGGTT TCCTGTGAGG CTTTTACCTG ACACCCGCCG CCTTTCCCCG 1380GCACTGGCTG GGAGGGCGCC CTGCAAAGTT GGGAACGCGG AGCCCCGGAC CCGCTCCCGC 1440CGCCTCCGGC TCGCCCAGGG GGGGTCGCCG GGAGGAGCCC GGGGGAGAGG GACCAGGAGG 1500GGCCCGCGGC CTCGCAGGGG CGCCCGCGCC CCCACCCCTG CCCCCGCCAG CGGACCGGTC 1560CCCCACCCCC GGTCCTTCCA CC 1582 ( 2 ) 55：

(i) sequence signature:

(A) length: 20 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: DNA

(xi) sequence description: sequence 55:CACGGCTTAT GCAAGCAAAG 20 (2) sequences 56 data:

(i) sequence signature:

(A) length: 20 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: DNA

(xi) sequence description: sequence 56:AACACAGTTT TCCATAATAG 20 (2) sequences 57 data:

(i) sequence signature:

(A) length: 18 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: DNA

(xi) sequence description: sequence 57:GCCACGGTAG GTCTGCGT 18 (2) sequences 58 data:

(i) sequence signature:

(A) length: 18 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: DNA

(xi) sequence description: sequence 58:TTTCTTTGAC AGGCTTAT 18 (2) sequences 59 data:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: DNA

(xi) sequence description: sequence 59:ATCTTGAAAA GTAAGTATGG G 21 (2) sequences 60 data:

(i) sequence signature:

(A) length: 20 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: DNA

(xi) sequence description: sequence 60:ATGACTTGAC AGGTATTGAT 20 (2) sequences 61 data:

(i) sequence signature:

(A) length: 20 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: DNA

(xi) sequence description: sequence 61:AGCAAGACGG TGGGTATTGT 20 (2) sequences 62 data:

(i) sequence signature:

(A) length: 22 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: DNA

(xi) sequence description: sequence 62:CCCTTCTTTG TAGTTATTTG AA 22 (2) sequences 63 data:

(i) sequence signature:

(A) length: 20 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: DNA

(xi) sequence description: sequence 63:CCACAGTGAG TATGAATTAA 20 (2) sequences 64 data:

(i) sequence signature:

(A) length: 18 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: DNA

(xi) sequence description: sequence 64:TTCTTCCAAA GGTGTCAG 18 (2) sequences 65 data:

(i) sequence signature:

(A) length: 18 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: DNA

(xi) sequence description: sequence 65:GGAGATGGTA GCAGAATG 18 (2) sequences 66 data:

(i) sequence signature:

(A) length: 23 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: DNA (xi) sequence description: sequence 66:CTATTTGTCT AGACTCAACA GAT 23 (2) sequences 67 data:

(i) sequence signature:

(A) length: 22 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: DNA

(xi) sequence description: sequence 67:CAAACATGCA GGTAAGAGAT CC 22 (2) sequences 68 data:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: DNA

(xi) sequence description: sequence 68:TGTTCTCCTA GCTGTTACAG A 21 (2) sequences 69 data:

(i) sequence signature:

(A) length: 24 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: DNA

(xi) sequence description: sequence 69:GGCGAGGTCA AGGTAGGTGC AAGG 24 (2) sequences 70 data:

(i) sequence signature:

(A) length: 26 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: DNA

(xi) sequence description: sequence 70:ATTGTCTTTG ACAGGCTTTT TGAAGG 26 (2) sequence 71 data:

(i) sequence signature:

(A) length 21 bp

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: DNA

(xi) sequence description: sequence 71: GAGATCCTGA AAAGTAAGTA G 21 (2) sequences 72 data:

(i) sequence signature:

(A) length: 24bp

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: DNA

(xi) sequence description: sequence 72:TGTGACTCGA CAGGTATTGA TAAT 24 (2) sequences 73 data:

(i) sequence signature:

(A) length: 20bp

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: DNA

(xi) sequence description: sequence 73:CTCAGCAAGA CGGTAGGTAT 20 (2) sequences 74 data:

(i) sequence signature:

(A) length: 25bp

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: DNA

(xi) sequence description: sequence 74:TTGTCCCTTG TAGTTGTTTG AAATT 25 (2) sequences 75 data:

(i) sequence signature:

(A) length: 20bp

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: DNA

(xi) sequence description: sequence 75:ACATTACCAC AGTGAGTATG 20 (2) sequences 76 data:

(i) sequence signature:

(A) length: 26bp

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: DNA

(xi) sequence description: sequence 76:

(2) sequence 77 data:

(i) sequence signature:

(A) length: 23bp

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: DNA

(xi) sequence description: sequence 77:AATGTTGAAG ATGGTAAGTA AAA 23 (2) sequences 78 data:

(i) sequence signature:

(A) length: 16bp

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: DNA

(xi) sequence description: sequence 78:TCTAGACTCA ACCAAT 16 (2) sequences 79 data:

(i) sequence signature:

(A) length: 22 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: DNA

(xi) sequence description: sequence 79:CAAACATGCA GGTAAGGAGT GT 22 (2) sequences 80 data:

(i) sequence signature:

(A) length: 24 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: DNA

(xi) sequence description: sequence 80:TTTTCCCCTA GTTGTTACAG AAGA 24 (2) sequences 81 data:

(i) sequence signature:

(A) length: 19 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linearity

(ii) molecule type: DNA

(xi) sequence description: sequence 81:Leu Ser Lys Thr Val Ser Gly Ser Glu Gln Asp Leu Pro H1s Glu Leu1 5 10 15His Val Glu

Claims (44)

1. A purifying that can be incorporated into the Flt4 receptor tyrosine kinase and isolated polypeptide.
2. 2. according to the Mammals polypeptide of claim 1.
3. 3. according to the human polypeptide of claim 1.
4. 4. go back the polypeptide that apparent molecular weight that the SDS-PAGE under the ortho states measures is about 32KD according to having of claim 3.
5. 5. according to other the polypeptide of human polypeptide claim 3 and essentially no.
6. 6. by the purifying and the isolated polypeptide of claim 1, described polypeptide is that the plasmid pFLT4-L of ATCC registration number 97231 encodes by preservation.
7. 7. according to claim 1 and polypeptide that have the aminoacid sequence of a part that contains sequence 33.
8. 8. according to the polypeptide of claim 1, it comprises about 161 aminoacid sequences to about 211 residues from sequence 33 shown in sequence 33.
9. 9. according to the polypeptide of claim 1, it comprises about 131 aminoacid sequences to about 211 residues from sequence 33 shown in sequence 33.
10. 10. according to the polypeptide of claim 1, it comprises the aminoacid sequence from about 113 to 213 residues of sequence 33 shown in the sequence 33.
11. 11. according to the polypeptide of claim 1, it comprise shown in the sequence 33 approximately from the aminoacid sequence of about 113 to 227 residues of sequence 33.
12. 12. according to the polypeptide of claim 1, it comprises about 103 to 217 amino acids of sequence 33.
13. 13. by the polypeptide of claim 1, it comprises about 103-225 amino acids of sequence 33.
14. 14. by the polypeptide of claim 1, it comprises about 103-227 amino acids of sequence 33.
15. 15. according to the polypeptide of claim 1, it comprises about 32-227 amino acids of sequence 33.
16. 16. according to each polypeptide among the claim 1-15, wherein said polypeptide can stimulate the tyrosine phosphorylation of the Flt4 receptor tyrosine kinase in the host cell of expressing this Flt4 receptor tyrosine kinase.
17. 17. by the described polypeptide of claim 1, it has about 1 to 499 amino acids residue of sequence 33.
18. 18. by each polypeptide among the claim 1-17, it further comprises a detectable mark.
19. 19. the protein that contains first polypeptide that is incorporated into second polypeptide of a purifying, wherein at least one of this first polypeptide and second polypeptide is according to each polypeptide among the claim 1-17, and albumen wherein can be incorporated into the Flt4 receptor tyrosine kinase.
20. 20. according to the purifying protein of claim 19, wherein said first polypeptid covalence is connected to described second polypeptide.
21. 21. according to the purifying protein of claim 19, each of wherein said first polypeptide and second polypeptide all be one according to each polypeptide among the claim 1-17.
22. 22. a purifying and isolating nucleic acid, it comprises the nucleotide sequence of coding by each polypeptide among the claim 1-17.
23. 23. by the nucleic acid of claim 22, it comprises the nucleotide sequence of the polypeptide that coding is made up of about 113-213 amino acids of sequence 33.
24. 24. by the nucleic acid of claim 22, it comprises the nucleotide sequence of the polypeptide that coding is made up of about 103-217 amino acids of sequence 33.
25. 25. by the nucleic acid of claim 22, it has the nucleotide sequence of about 352 to 1608 Nucleotide of sequence 32.
26. 26. by the nucleic acid of claim 22, it comprises the segmental VEGF-C of insertion with the plasmid pFLT4-L of ATCC registration number 97321 preservations of coding VEGF-C.
27. 27. comprise carrier according to each nucleic acid among the claim 22-26.
28. 28. with transforming by each nucleic acid among the claim 22-26 or the host cell of transfection.
29. 29. can be specifically and according to the antibody of each polypeptide reaction among the claim 1-17.
30. 30. the antibody by claim 29, it is a monoclonal antibody.
31. 31. one kind in the pharmacy acceptable solvent, adjuvant, and vehicle, or contain the medicinal compositions of each polypeptide among the with good grounds claim 1-17 in the carrier.
32. 32. preparation can be incorporated into the method for the polypeptide of Flt4 receptor tyrosine kinase specifically, the method comprising the steps of:

    (a) in host cell, express by the arbitrary nucleic acid of claim 22-26; And

    (b) purifying can specificity be incorporated into the polypeptide of Flt4 receptor tyrosine kinase from the growth medium of this host cell or described host cell.
33. 33. can be incorporated into the polypeptide of Flt4 receptor tyrosine kinase specifically, this polypeptide is to produce by the method according to claim 32.
34. 34. mouse polypeptide according to claim 1.
35. 35. according to the polypeptide of claim 34, it comprises the part of the aminoacid sequence shown in the sequence 41, this part can be incorporated into the Flt4 receptor tyrosine kinase specifically.
36. 36. purifying with separate the nucleic acid of coding by claim 34 or 35 polypeptide.
37. 37. purifying with separate the nucleic acid that has about 16 Nucleotide at least, this nucleic acid can hybridize to specifically the coding VEGF-C people's gene.
38. 38. nucleic acid according to claim 37, it hybridizes on the people's gene of coding VEGF-C, hybridization conditions is: its amplifying nucleic acid can not be hybridized in the people's gene of coding VEGF or VEGF-B, and wherein this nucleic acid comprises and selects in sequence 32 and be complementary to the successive nucleotide sequence of at least 20 Nucleotide of the nucleotide sequence of sequence 32.
39. 39. in biological tissue, detect the method for endotheliocyte, comprise step:

    The cell biological tissue that will contain endothelium is exposed to by each polypeptide among the claim 1-18, and it is can be incorporated under the condition of endotheliocyte at this polypeptide; And

    Detection is incorporated into the described polypeptide of the endotheliocyte in the described biological tissue, thereby detects this endotheliocyte.
40. 40. according to the method for claim 39, further comprise the step of washing this biological tissue, this washing step is carrying out after the described exposing step and before detecting step.
41. 41. regulate the method for Mammals endothelial cell growth, comprise step:

    With the Mammals endotheliocyte be exposed to significant quantity exist by in each the polypeptide among the claim 1-17 to regulate the growth of Mammals endotheliocyte.
42. 42. purifying and the isolating polypeptide that can be incorporated into Kdr (VEGFR-2), this polypeptide has the aminoacid sequence of a part that contains sequence 33.
43. 43. the nucleic acid that contains the VEGF-C promotor of a purifying.
44. 44. by the nucleic acid of claim 43, it comprises the part of sequence 54, and this part can promote the operatively expression of gene of connected proteins encoded under VEGF-C is expressed in the condition of natural host cell.

Images