JP2002525086A - Platelet-derived growth factor C, DNA encoding the same, and use thereof - Google Patents

Abstract

  (57) [Summary] The present invention relates to PDGF-C, a novel member of the PDGF / VEGF family of growth factors, as well as nucleotide sequences encoding them, methods for their production, antibodies and other antagonists thereto, transfectants expressing them, and Transformed host cells, pharmaceutical compositions containing them, and their use in medical and diagnostic applications are described.

Description

DETAILED DESCRIPTION OF THE INVENTION

The present invention relates to a growth factor for connective tissue cells, fibroblasts, myofibroblasts, and glial cells, and / or a growth factor for endothelial cells, in particular, a novel platelet-derived growth factor / vascular endothelial growth. The present invention relates to a factor-like growth factor, a polynucleotide sequence encoding the factor, pharmaceutical and diagnostic compositions and methods utilizing or derived from the factor.

BACKGROUND OF THE INVENTION In a developing fetus, the primary vascular network is established by in situ differentiation of mesodermal cells in a process called angiogenesis. All subsequent processes associated with the production of new blood vessels in the fetus, and neovascularization in the adult, are governed by the sprouting or division of new capillaries from existing blood vessels in a process called angiogenesis (Pepper et al., Enzyme & Protein, 1996 49 138-162; Brier et al., Dev. Dyn. 1995 204 228-239;
Risau, Nature, 1997 386 671-674).
Angiogenesis is involved not only in embryonic development and normal tissue growth, repair and regeneration, but also in the reproductive cycle of women, establishment and maintenance of pregnancy, and repair of wounds and breaks. In addition to the angiogenesis that takes place in normal individuals, angiogenesis phenomena occur in a number of pathological processes, especially tumor growth and metastasis, and, as in diabetic retinopathy, psoriasis, and joint disease, and the like.
It is associated with other conditions, such as increased vascular proliferation, particularly angiogenesis in the microvasculature. Inhibition of angiogenesis is useful to prevent or reduce these pathological processes.

[0003] On the other hand, to stimulate the formation of collateral circulation in tissue infarction or arterial stenosis, for example, after tissue or organ transplantation or in coronary heart disease or occlusive thrombotic vasculitis, etc. It is desirable to promote angiogenesis in situations where angiogenesis is to be established or dilated.

[0004] The angiogenic process is highly complex, maintaining endothelial cells during the cell cycle,
It is associated with extracellular matrix degradation, surrounding tissue migration and invasion, and finally tube formation. The molecular mechanisms leading to the complex process of angiogenesis are not understood.

[0005] Due to the critical role of angiogenesis in a number of biological and pathological processes, the factors involved in controlling angiogenesis have been strongly investigated. Many growth factors
It has been shown to be involved in the regulation of angiogenesis. These include fibroblast growth factor (FGF), platelet-derived growth factor (PDGF), transforming growth factor alpha (TGFα), and hepatocyte growth factor (HGF). See, for example, Falkman et al. Biol. Chem.
, 1992 267 10931-10934.

A specific family of endothelial cell-specific growth factors, vascular endothelial growth factor (VEGF)
It has been suggested that their corresponding receptors contribute to the stimulation of endothelial cell growth and differentiation and to certain functions of differentiated cells. These factors are PDGF
A member of the family, primarily endothelial receptor tyrosine kinase (RTK
It seems to work through).

[0007] Nine proteins in the PDGF family, namely two PDGFs (
A and B) and VEGF, six members closely related to VEGF, were identified. Said six members closely related to VEGF are Ludwig I
International Patent Application No. PCT / US96 / 02957 (WO 96/26736) by the Nstate for Cancer Research and the University of Helsinki
VE) described in US Patent Nos. 5,840,693 and 5,607,918.
GF-B and EMBO J. et al., Joukov et al. , 1996 15
290-298 and Lee et al., Proc. Natl. Acad. Sci
. USA, 1996 93 1988-1992, and in PCT / US97 / 14696 (WO98 / 07832) and Achen et al., Proc. Natl. Acad. Sci. USA, 1998
95 548-553, and Maglion (Maglion).
e) et al., Proc. Natl. Acad. Sci. USA, 1991 889
267-9271, and Human Geno.
International Patent Application PCT / US94 / 05291 by me Sciences (WO
95/24473) and Human Genome Sc.
International Patent Application PCT / US95 / 07283 (WO 96/3)
9421). Each of these VEGF family members has 30% to 45% amino acid sequence identity to VEGF. These VEGF family members form a cysteine knot motif with 6
Shares a VEGF homology domain containing two cysteine residues. Functional features of the VEGF family include induction of varying degrees of mitogenic activity on endothelial cells, induction of vascular permeability and angiogenic and lymphangiogenic properties.

[0008] Vascular endothelial growth factor (VEGF) is a homodimeric glycoprotein that has been isolated from multiple sources. VEGF shows highly specific mitogenic activity on endothelial cells. VEGF has important regulatory functions in the formation of new blood vessels during fetal angiogenesis and in adult angiogenesis (Carmeliet).
et al., Nature, 1996 380 435-439; Farrara (F.
et al., Nature, 1996 380 439-442; Ferrara and Davis-Smyth.
, Endocrine Rev .; , 1997 18 4-25). The importance of the role played by VEGF has been shown by studies showing that inactivation of one VEGF allele results in fetal lethality due to vascular insufficiency (Carmeliet et al., Nature, 19
96 380 435-439; Ferrara et al., Natur.
e, 1996 380 439-442). In addition, VEGF has a strong chemoattractant activity on monocytes, can induce plasminogen activator and plasminogen activator inhibitor in endothelial cells, and has microvascular permeability. Can be induced. Depending on the activity of the latter, it is sometimes called vascular permeability factor (VPF). The isolation and properties of VEGF have been studied. Ferrara et al. Cellular Biochem.
, 1991 47 211-218 and Connolly J. et al. Cel
lull Biochem. , 1991 47 219-223. Selective mRNA splicing of one VEGF gene yields five VEGF isoforms.

[0009] VEGF-B has similar vascular and other properties to VEGF, but it is distributed and expressed in different tissues than VEGF. Specifically, VEGF-B
Is very strongly expressed in the heart, but only weakly in the lungs. In contrast, VEGF is the opposite. This is VEGF and VEG
FB suggests that they may have functional differences, despite the fact that they are co-expressed in many tissues.

[0010] VEGF-B is a cellular resinoid acid binding protein type I (CRABP-I
) Was isolated using a yeast co-hybrid interaction trap screening method by screening for cellular proteins that could interact with).
Its isolation and characteristics are described in PCT / US96 / 02957 and Olofsson.
son) et al., Proc. Natl. Acad. Sci. USA, 1996 93 2576-2581.

[0011] VEGF-C is derived from the culture supernatant of the PC-3 prostate adenocarcinoma cell line (CRL1435) using cells transfected to express VEGFR-3. Tyrosine kinase VEGFR-3 (Fl
t4) was isolated by screening for its ability to produce tyrosine phosphorylation. VEGF-C was purified using affinity chromatography on recombinant VEGFR-3 and cloned from a PC-3 cDNA library. Its isolation and characteristics are described in JMB, et al.
OJ. , 1996 15 290-298.

[0012] VEGF-D was obtained from a human breast cDNA library commercially available from Clontech as "Soares Break" as a hybridization probe.
st 3NbHBst ", isolated by screening with expressed sequence tags obtained from a human cDNA library (Achen).
Et al., Proc. Natl. Acad. Sci. USA, 1998 95 548
-553). Its isolation and characteristics are described in International Patent Application No. PCT / US97 / 14696.
(WO 98/07832).

The VEGF-D gene is widely expressed in adult humans, but of course is not ubiquitously expressed. VEGF-D is strongly expressed in heart, lung and skeletal muscle. VEGF-D is expressed at moderate levels in the spleen and ovaries, small intestine, and colon, with lower expression occurring in kidney, pancreas, thymus, prostate, and testis.
VEGF-D mRNA was not detected in RNA from brain, placenta, liver, or exsanguinated leukocytes.

PlGF was isolated from a (pregnant) term placenta cDNA library. Its isolation and characteristics are described in Maglione et al., Proc. Natl. Ac
ad. Sci. USA, 1991 88 9267-9271. At present, its biological function is not well understood.

VEGF2 has been isolated from a highly oncogenic estrogen-dependent human breast cancer cell line. This molecule has approximately 22% homology to PDGF and VEG
Although described as having 30% homology to F, no method is known for isolating the gene encoding VEGF2, and no characterization of its biological activity is disclosed.

VEGF3 was isolated from a cDNA library from colon tissue. VEG
F3 is described as having approximately 36% identity and 66% similarity to VEGF. The method of isolating the gene encoding VEGF3 is unclear, and no characterization of its biological activity is disclosed.

The similarity between two proteins is determined by comparing the amino acid sequence of one of the proteins and a conserved amino acid substitution with the sequence of a second protein, while identity is conserved. Determined without including amino acid substitution.

[0018] PDGF / VEGF family members act primarily by binding to receptor tyrosine kinases. Five endothelial cell specific receptor tyrosine kinases have been identified. That is, VEGFR-1 (Flt-1), VEGF
R-2 (KDR / Flk-2), VEGFR-3 (Flt4), Tie and T
ek / Tie-2. All of these have endogenous tyrosine kinase activity required for signal transduction. VEGFR-1, VEGFR-2, VEGFR-3,
The essential and specific role of Tie and Tek / Tie-2 in angiogenesis and angiogenesis has been demonstrated by targeted mutations that inactivate these receptors in mouse embryos.

A receptor tyrosine kinase known to bind to VEGF is VE
Only GFR-1, VEGFR-2 and VEGFR-3. VEGFR-1 and VEGFR-2 bind to VEGF with high affinity, and VEGFR-1 binds to VEGF.
It also binds to GF-B and PlGF. VEGF-C has been shown to be a ligand for VEGFR-3, which also activates VEGFR-2 (Joukov et al., The EMBO Journal, 1996 15 290-298). The ligand for Tek / Tie-2 is Regeneron
International Patent Application PCT / US95 / 129 by Pharmaceuticals, Inc.
35 (WO 96/11269). The ligand for Tie has not yet been identified.

Recently, a novel 130-135 kDa VEGF isoform-specific receptor has been purified and cloned (Soker et al., Cell, 19).
98 92 735-745). This VEGF receptor was found to bind to the VEGF ₁₆₅ isoform via an exon 7 coding sequence that exhibits weak affinity for heparin (Soker et al., Cell, 1998.
2 735-745). Surprisingly, the receptor was shown to be identical to human neuropilin-1 (NP-1), a receptor involved in early stage neuromorphogenesis. PlGF-2 also appears to interact with NP-1 (Migudaru (Migdal), etc., J.Biol.Chem., 1998 273 2
2272-22278).

VEGFR-1, VEGFR-2, VEGFR-3 are separately expressed by endothelial cells. VEGFR-1 and VEGFR-2 are both expressed on vascular endothelium (Yale helix (Oelrichs) etc., Oncogene, 1992 8
11-18; Kaipainen et al. Exp. Med. ,
1993 178 2077-2088; Dumont et al., Dev.
. Dyn. , 1995 203 80-92; Fong et al., Dev.
Dyn. , 1996 207 1-10), VEGFR-3 is mostly expressed on the lymphatic endothelium of adult tissues (Kaipainen et al., Pr.
oc. Natl. Acad. Sci. USA, 1995 9 3566-357.
0). VEGFR-3 is also expressed in blood vessels around tumors.

[0022] Disruption of the VEGFR gene causes abnormal growth of blood vessels, resulting in premature lethality during pregnancy. Analysis of fetuses with fully inactivated VEGFR-1 suggests that this receptor is required for functional organization of the endothelium (Fong et al., Nature, 1995 376 66-). 70). However, deletion of the intracellular tyrosine kinase domain of VEGFR-1 creates viable mice with normal blood vessels (Hiratsuka
Ka) et al., Proc. Natl. Acad. Sci. USA 1998 95 9
349-9354). The reasons for these differences require further explanation and suggest that receptor signaling via tyrosine kinase is not required for proper functioning of VEGFR-1. Analysis of homozygous mice harboring the inactivating allele of VEGFR-2 suggests that this receptor is required for endothelial cell proliferation, hematopoiesis and also for angiogenesis (Shalaby). Et al., Nature, 1995 376 62-66.
Shalaby et al., Cell, 1997 89 981-99.
0). Inactivation of VEGFR-3 causes cardiovascular insufficiency due to abnormal organization of large blood vessels (Dumont et al., Science, 1998.
282 946-949).

VEGFR-1 is mainly expressed on endothelial cells during development, but it is also found on hematopoietic progenitor cells during the early stages of embryogenesis (Fon
g) et al., Nature, 1995 376 66-70). In adults, monocytes and macrophages also express this receptor (Barleon)
Blood, 1996 87 3336-3343). VE in the fetus
GFR-1 is mostly, if not entirely, expressed in blood vessels (Brier, et al., Dev. Dyn., 1995 204 228-239).
Fong et al., Dev. Dyn. , 1996 207 1-10).
.

The receptor VEGFR-3 is widely expressed on endothelial cells during early embryonic development, but is gradually restricted to venous endothelium and then to lymphatic endothelium as embryogenesis proceeds (Kaipainen). Natl. Ac, Proc.
ad. Sci. USA, 1995 92 3566-3570). VEGFR-
3 is expressed on lymphatic endothelial cells of adult tissues. This receptor is essential for vascular development during embryogenesis. Complete inactivation of both copies of the VEGFR-3 gene in mice resulted in defective angiogenesis characterized by an abnormally large defect in organization with defective lumens, and in the pericardial space. Fluid pooled and cardiovascular insufficiency developed 9.5 days after sexual activity. Based on these findings, VEGF
R-3 has been suggested to be necessary for the primary vascular network to mature into larger blood vessels. However, VEGF in the development of lymphatic vasculature
The role of R-3 could not be studied in these mice because the embryo died before the lymphoid system appeared. Nevertheless, VEGFR-3 is presumed to play a role in lymphatic development and lymphangiogenesis due to its specific expression on lymphatic endothelial cells during embryogenesis and adulthood. . This is VEGFR-
Ectopic expression of the 3 ligand, VEGF-C, in the skin of transgenic mice is supported by the finding that lymphatic endothelial cell proliferation and dilation of blood vessels in the dermis have occurred. Furthermore, this suggests that VEGF-C may have a primary function in lymphatic endothelium and a secondary function in angiogenesis and permeability regulation shared with VEGF. Suggests (Yokov (J
oukov) et al., EMBO J .; , 1996 15 290-298).

Some of the inhibitors of the VEGF / VEGF receptor system have been shown to prevent tumor growth by anti-angiogenic function. Na, Kim
Ture, 1993 362 841-844 and Saleh et al., C
cancel Res. , 1996 56 393-401.

As mentioned above, growth factors of the VEGF family are members of the PDGF family.
Members. PDGF is used for connective tissue cells, fibroblasts, myofibroblasts and
Play an important role in cell growth and / or mobility (Heldin (Heldi
n) and the like, “Structure of platelet-derived g
rowfactor: Implifications for funti
onal properties ", Growth Factor, 1993. 8 245-252). In adults, PDGF stimulates injury treatment (Rob
Robson et al., Lancet, 1992.339 23-25). Structure
Structurally, PDGF isoforms are homodimers (PGGF-AA and PDGF-AA).
(GF-BB) or heterodimer (PDGF-AB)
Disulfide bond dimers of A- and B-polypeptide chains.

[0027] PDGF isoforms provide two structurally related receptors for target cells.
Exhibits its effect by binding to putter tyrosine kinase (RTK)
. Alpha receptors bind to both the A and B chains of PDGF,
, Beta receptor binds only to the B chain. These two receptors are
Expressed by many in vitro grown cell lines, primarily in vitro
-Expressed by mesenchymal cells in vivo. PDGF is in vitro
Regulates cell growth, cell survival, and chemotaxis of many cell types (Heldin (
Heldin) et al., Biochim Biophys Acta. , 1998 1378 F79-113). In Vivo,
They are often associated with epithelial cells (PDGF) in juxtaposition to PDGFR-expressing mesenchyme.
-A) or expressed in endothelial cells (PDGF-B);
Works in molds. Tumor cells and cell lines developed in vitro
For example, co-expression of PDGF and the above-described receptor is useful for cell transformation.
A critical accident secretion loop is created (Betscholtz)
Et al., Cell, 1988.39 447-57; Keating
), Etc. R. Coll Surg Edinb. , 199035 172-
4). In several pathological conditions, including malignant tumors, atherosclerosis, and fibroproliferative disorders
Overexpression of PDGF has been observed (Heldin et al.
 Molecular and Cellular Biology of W
soundRepair, New York: Plenum Press, 19
96, 249-273).

The importance of PDGF as a growth factor for cell proliferation and survival has recently been shown to have different physiological roles between PDGF and its receptor, despite the overlapping ligand specificity of PDGFR. Studies have shown this. Homozygous null mutations in either of these two PDGF ligands or receptors are lethal. Approximately 50% of homozygous PDGF-A-deficient mice have an early lethal phenotype, whereas surviving animals have emphysema with inappropriate alveolar diaphragm formation due to alveolar myofibroblast deficiency. With a strong postnatal phenotype (Bostrom
rom) et al., Cell, 1996 85 863-873). PDGF-A-deficient mice also have a dermal phenotype characterized by thin dermis, malformed hair follicles, and thin hairs (Karlsson et al., Developmentmen.
t, 1999 126 2611-2). PDGF-A is also required for normal development of oligodendrocytes and subsequent myelination of the central nervous system (Fruttiger et al., Development, 1999 126 4).
57-67). The phenotype of PDGFR-alpha-deficient mice is more severe with early fetal death at E10, incomplete head closure, impaired neural crest, cardiovascular defects, skeletal defects, and odemas ( Soriano
) Et al., Development, 1997 124 2691-70). PDG
FB and PDGFR-beta deficient mice also have a similar phenotype characterized by renal, hematological and cardiovascular abnormalities (Levine (Levein)).
een) et al., Genes Dev. , 1994 8 1875-187; Soriano et al., Genes Dev. , 1994 8 1888-
96; Lindahl et al., Science, 1997 277.
242-5; Lindahl, Development, 199
8 125 3313-2), where renal and cardiovascular defects are at least partially due to the lack of proper recruitment of parietal cells (vascular smooth muscle cells, pericytes or glomerular stromal cells) to blood vessels. (Levenen et al., Genes)
Dev. , 1994 8 1875-1887; Lindahl
) Et al., Science, 1997 277 242-5; Lindal.
ahl), Development, 1998 125 3313-2).

[0029] SUMMARY OF THE INVENTION The invention relates generally to endothelial cells, connective tissue cells, myofibroblasts, and glial cells, but are not limited to, proliferation or differentiation and / or growth of cells expressing the PDGF-C receptor And / or isolated novel growth factors having the ability to stimulate and / or enhance intrinsic motility, isolated polynucleotide sequences encoding the novel growth factors, and diagnostic and / or therapeutic applications A useful composition.

According to one aspect, the invention relates to at least nucleotides 37-1071 of the sequence shown in FIG. 1 (SEQ ID NO: 2), at least nucleotides of the sequence shown in FIG. 3 (SEQ ID NO: 3) 6-6956, at least 85%, preferably at least 90%, most preferably at least 95% identity to at least nucleotides 196-1233 of the sequence shown in Figure 5 (SEQ ID NO: 6). Provide an isolated and purified nucleic acid molecule consisting of a nucleotide sequence. 5 and at least nucleotides 37-1071 of the sequence shown in FIG. 1 (SEQ ID NO: 2).
At least nucleotides 196-12 of the sequence shown in SEQ ID NO: 6
33 encodes a novel polynucleotide called PDGF-C (formally named "VEGF-F"), which comprises PDGF-A, PDGF-B, VEGF,
It is structurally homologous to VEGF-B, VEGF-C and VEGF-D. In one preferred embodiment, the nucleic acid molecule has the sequence shown in FIG. 1 (SEQ ID NO: 2).
Having at least nucleotides 37-1071, at least nucleotides 6-956 of the sequence shown in FIG. 3 (SEQ ID NO: 3), or at least nucleotides 196-1233 of the sequence shown in FIG. 5 (SEQ ID NO: 6) It is.
This aspect of the invention further comprises at least nucleotides 37-1071 of the sequence shown in FIG. 1 (SEQ ID NO: 2), at least nucleotides 6-956 of the sequence shown in FIG. Also included are DNA molecules having at least nucleotides 196-1233 of the sequence set forth in SEQ ID NO: 5 (SEQ ID NO: 6), or a sequence that hybridizes under stringent conditions to fragments thereof.

According to a second aspect, the polypeptide of the invention is a cell expressing the PDGF-C receptor, including but not limited to endothelial cells, connective tissue cells, myofibroblasts and glial cells 2 (sequence identification number 3), FIG. 4 (sequence identification number 5) or FIG. 6 (sequence identification) having the ability to stimulate and / or enhance proliferation or differentiation and / or growth and / or intrinsic motility of No. 7), or a fragment or analog thereof, comprising PDGF-C receptor, including but not limited to endothelial cells, connective tissue cells (such as fibroblasts), myofibroblasts, and glial cells. It has the ability to stimulate and / or enhance the proliferation or differentiation and / or growth and / or motility of the expressing cells. Preferably, the polypeptide is the amino acid sequence of FIG. 2 (SEQ ID NO: 3), FIG. 4 (SEQ ID NO: 5) or FIG. 6 (SEQ ID NO: 7), or a fragment thereof having the biological activity of PDGF-C Or at least 85%, preferably at least 90%, most preferably at least 95% identity to the analog. A preferred fragment is the PDGF of PDGF-C.
/ VEGF is a truncated form of PDGF-C having a part of the homology domain (PVHD). Its minimal domain is residues 230-345. However, the domain is N
It can be extended to residue 164 toward the end. Here, PVHD is cut PDG
It is defined as F-C. Truncated PDGF-C is the active form of PDGF-C.

For use in the present application, the percentage sequence identity is determined by the Lasergene package (DNASTAR, Ltd. Abacus House, Manor Roa).
d, West Ealing London W130AS U.S.A. K. This is measured by using an alignment tool called “MEGALIGN”, which is commercially available from), in its preset state. The alignment is then fine-tuned manually and the number of identities is estimated in comparable areas.

[0033] Preferably, the polypeptide encoded from the polypeptide or polynucleotide comprises vascular endothelial cells, lymphatic endothelial cells, connective tissue cells (such as fibroblasts), myofibroblasts, and glial cells. Has the ability to stimulate any one or more of proliferation, differentiation, intrinsic motility, survival or vascular permeability of cells expressing the PDGF-C receptor, including but not limited to. Preferably, said encoded polypeptide from a polypeptide or polynucleotide has the ability to stimulate injury treatment. PDGF-C also has an antagonistic effect on cells,
They are not included in the biological activity of PDGF-C. Hereafter, these abilities are referred to as “PD
These are referred to as "GF-C biological activities" and can be easily tested by known methods.

As used herein, the term “PDGF-C” is referred to in FIG. 2 (SEQ ID NO: 3).
4) (SEQ ID NO: 5) or the polypeptide of FIG. 6 (SEQ ID NO: 7) and fragments or analogs thereof having the biological activity of PDGF-C as defined above;
It is a generic term for a polynucleotide capable of encoding PDGF-C, or a fragment or analog thereof having PDGF-C biological activity. The polynucleotide may be naked and / or contained in a vector or liposome.

In another preferred embodiment, the present invention provides a polypeptide that processes the amino acid sequence: PXCLLVXRCGGXCXCC (SEQ ID NO: 1), wherein the amino acid sequence is PDGF-
Three amino acid residues (NCA) unique to C and between the third and fourth cysteines
(See FIG. 9-SEQ ID NO: 8-17) PDGF / VEGF
Different from other members of the family.

[0036] Polypeptides having conserved substitutions, insertions or deletions but retaining the PDGF-C biological activity are also within the scope of the present invention. Those of skill in the art will be familiar with readily available methods for producing such polypeptides, such as using site-directed mutagenesis or specific enzymatic cleavage or ligation. For those skilled in the art, it is also possible that a peptidomimetic compound or compound in which one or more amino acid residues have been replaced by a non-naturally occurring amino acid or amino acid analog will retain the necessary aspects of said PDGF-C biological activity. Yes, it will also be appreciated. Such compounds can be readily prepared and tested by known methods, and are also included in the scope of the present invention.

In addition, possible variants of the PDGF-C polypeptide obtained by alternative splicing as known for VEGF and VEGF-B, and the nucleic acid sequence encoding PDGF-C Naturally occurring allelic variants of are also within the scope of the invention. Allelic variants are well known and represent alternative forms of a nucleic acid sequence that have single or multiple nucleotide substitutions, deletions or additions, but do not cause any functional changes in the encoded polypeptide.

[0038] Such variants of PDGF-C can be made by targeting non-essential regions of the PDGF-C polypeptide for modification. These non-essential regions are expected to be outside the strongly conserved regions shown in FIG. 9 (SEQ ID NOs: 8-17). Specifically, the growth factors of the PDGF family, including VEGF, are dimers, VEGF, VEGF-B, VEGF
-C, VEGF-D, PIGF, PDGF-A and PDGF-B show complete conservation of the eight cysteine residues of the N-terminal domain, i.e., the PDGF / VEGF-like domain (Olofsson et al.). Proc. Natl.
Acad. Sci. USA, 1996, 93 2576-2581;
Joukov) et al., EMBO J .; , 1996 15 290-298). These cysteines are thought to be involved in intra- and inter-cellular disulfide bonds. In addition, there are strong, but not complete, conserved cysteine residues in the C-terminal domain. Loops 1, 2, and 3 of each subunit, formed by intracellular disulfide bonds, are involved in the binding of PDGF / VEGF family growth factors to receptors (Andersson et al., Gr.
owth Factors, 1995 12 159-164).

Thus, for those skilled in the art, these cysteine residues should be conserved in all of the proposed variants, and the active sites conserved in loops 1, 2 and 3 should be conserved. It is well known. However, other regions of the molecule are expected to be of low importance for its biological function, and thus provide a suitable target for modification. The ability of the modified polypeptide to exhibit said PDGF-C biological activity can be readily tested by standard activity assays, such as the fibroblast proliferation assay of Example 6.

[0040] Some modified PDGF-C polypeptides are useful on cells including, but not limited to, endothelial cells, connective tissue cells, myofibroblasts, and / or glial cells.
It is contemplated that it has the ability to bind to the receptor, but cannot stimulate cell proliferation, differentiation, migration, intrinsic motility or survival, or induce blood vessel growth, connective tissue development, or injury treatment. These modified polypeptides can act as competitive or non-competitive inhibitors of the PDGF-C polypeptide and the PDGF / VEGF family, where inhibition or reduction of the PDGF-C polypeptide or the PDGF / VEGF family growth factor is desirable. Expected to be useful in situations. Thus, although such receptor-binding, non-mitogenic, non-differentiation, non-migratory, non-motility, non-survival, non-connective tissue development,
Also included within the scope of the invention are non-injured therapeutic or non-angiogenic proliferative PDGF-C polypeptide variants, which are referred to herein as "receptor binding, but otherwise inactive variants." Called. Since PDGF-C forms a dimer to activate its only known receptor, one monomer is a variant-modified PDGF-C that is receptor-binding but otherwise inactive. The second monomer is wild-type PDGF-C
Alternatively, it is considered to consist of the wild-type growth factor of the PDGF / VEGF family. These dimers can bind to their corresponding receptors but cannot trigger downstream signaling.

Also, wild-type PDGF- on its cells, including but not limited to endothelial cells, connective tissue cells (such as fibroblasts), myofibroblasts, and / or glial cells, to its corresponding receptor. It is contemplated that there are other modified PDGF-C polypeptides capable of blocking the binding of C or PDGF / VEGF family wild-type growth factors. Thus, these dimers may stimulate endothelial cell proliferation, differentiation, migration, survival, induce vascular permeability, and / or enhance proliferation and / or differentiation, and / or intrinsic motility of connective tissue cells. It will not be able to trigger. These modified polypeptides can be PDGF-C growth factor or PDGF /
It can act as a competitive or non-competitive inhibitor of VEGF family growth factors, and it is expected that blocking or reducing the action of PDGF-C or PDGF / VEGF family growth factors would be useful in situations where it is desired. Such situations include tissue remodeling that occurs during invasion of tumor cells into the normal cell population by primary or metastatic tumorigenesis. Therefore, such PDGF-C or PD
GF / VEGF family growth factor binding, but non-mitogenic, non-differentiation, non-migratory, non-proprietary motility, non-survival, non-connective tissue development, non-injury Alternatively, non-angiogenic PDGF-C growth factor variants are also included within the scope of the invention, and are referred to herein as "PDGF-C growth factor-dimer forming, but otherwise inactive. Or an interfering variant. "

One example of a PDGF-C growth factor-dimer forming, but otherwise inactive or interfering, variant is where PDGF-C has a mutation that prevents cleavage of the CUB domain from the protein. is there. Further, the PDGF-C growth factor-dimer forming, but otherwise inactive or interfering, variant is
VEGF, VEGF-B, VEGF-C, VEGF-D, linked to the CUB domain, with mutations that prevent cleavage of the CUB domain from the protein.
It could be made up of a monomer of PDGF-C, PDGF-A, PDGF-B or PlGF, preferably an activating monomer. P mentioned above
DGF-C growth factor-dimer-forming but otherwise inactive or interfering variants and dimers formed with monomers attached to the mutant CUB domain bind to their corresponding receptors I will not be able to do that.

One variation of this configuration is VEGF, VEGF-B, VEGF-C
, VEGF-D, PDGF-C, PDGF-A, PDGF-B or PlGF, and VEGF, VEGF-B, VEGF-C, VEGF-D, PD
In this configuration, a proteolytic cleavage site is inserted between a mutated CUB domain linked to an activating monomer of GF-C, PDGF-A, PDGF-B or PlGF. Addition of specific protease (s) to the proteolytic site cleaves the CUB domain, thereby releasing the activated dimer, which can bind to its corresponding receptor. In this way,
Controlled release of the activated dimer is possible.

According to a third aspect, the present invention provides a purified isolated nucleic acid encoding a polypeptide as defined above or a polypeptide fragment of the present invention. This nucleic acid is DN
A, can be genomic DNA, cDNA or RNA, which can be single-stranded or double-stranded. The nucleic acid can be isolated from a cell or tissue source and can be of recombinant or synthetic origin. Depending on the degeneracy of the genetic code, those skilled in the art will recognize that each sequence may have the amino acid sequence depicted in FIG. 2 (SEQ ID NO: 3), FIG. 4 (SEQ ID NO: 5) or FIG. Active fragments or analogs, their receptor binding but otherwise inactive or partially inactive variants or PDGF-C growth factor-dimer forming but otherwise inactive or It will be appreciated that many such coding sequences are possible, encoding those variants that are interfering.

In a fourth aspect of the present invention, a vector comprising the cDNA of the present invention or the nucleic acid molecule according to the third aspect of the present invention, and a nucleic acid molecule or vector of the present invention, are transformed or transfected. Provide a host cell. These can be of prokaryotic or eukaryotic origin. These cells are particularly suitable for the expression of the polypeptides of the invention and have been transformed by baculovirus, Amer
S available from ican Type Culture Collection
insect cells such as f9 cells (ATCC SPL-171) and a human embryonic kidney cell line 293-EBNA transfected with an appropriate expression plasmid
including. Preferred vectors of the invention are expression vectors in which the nucleic acids of the invention are operably linked to one or more suitable promoters and / or other control sequences, and have been transformed or transfected by those vectors. Suitable host cells are capable of expressing the polypeptide of the invention. Other suitable vectors are those suitable for transfection of mammalian cells, or gene therapy, such as adenovirus-, vaccinia-, or retrovirus-based vectors or liposomes. Various such vectors are known.

The present invention further provides a method for producing a vector capable of expressing a polypeptide encoded by a nucleic acid according to the present invention, said nucleic acid comprising one or more suitable promoters and / or A method comprising operably linking to another control sequence is provided.

The present invention further provides a method for producing a polypeptide of the present invention, comprising the steps of expressing a nucleic acid or vector of the present invention in a host cell, and a growth medium from or from the host cell. And isolating the polypeptide from the above.

In yet another aspect, the invention provides an antibody that specifically reacts with a polypeptide of the invention or a fragment of the polypeptide. This aspect of the invention includes antibodies specific for variants, immunoreactive fragments, analogs, or recombinants of PDGF-C. These antibodies are useful as inhibitors or agonists of PDGF-C and as diagnostics to detect and quantify PDGF-C. Polyclonal or monoclonal antibodies can be used. Monoclonal or polyclonal antibodies can be raised against a polypeptide of the invention, or a fragment or analog thereof, using standard methods. In addition, the polypeptide can be linked to an epitope tag, such as FLAG ^™ octapeptide, to aid in affinity purification. For some purposes, it may be desirable to use a humanized or chimeric monoclonal antibody, for example, if a monoclonal antibody is used to suppress the effects of PDGF-C in a clinical context. unknown. Such antibodies can be further modified by the addition of cytotoxic or cytostatic agents. Methods for producing these, including recombinant DNA methods, are well known.

[0049] This aspect of the invention further includes an antibody that recognizes PDGF-C and is appropriately labeled.

The polypeptides or antibodies of the present invention can be labeled with a detectable label and used for diagnostic purposes. Similarly, a polypeptide of the invention so labeled can be used to identify its corresponding receptor in situ. The polypeptide or antibody will be capable of being covalently or non-covalently linked to a suitable supermagnetic, paramagnetic, high electron density, ecogenic, or radioactive material for imaging. Diagnostic assays can use radioactive or non-radioactive labels. Specific examples of radiolabels include ¹²⁵ I and ³²
There are radioactive atoms or groups such as P. Specific examples of the non-radioactive label include an enzyme label such as horseradish peroxidase and a fluorescent label such as fluorescein-5-isothiocyanate (FITC). Labeling may be direct or indirect, covalent or non-covalent.

The clinical use of the present invention includes diagnostic use, acceleration of angiogenesis in tissue or organ transplantation, stimulation of injury treatment, or development of connective tissue, or tissue infarction or artery such as coronary artery disease. Formation of collateral circulation in stenosis, suppression of angiogenesis in the treatment of cancer or diabetic retinopathy, suppression of tissue remodeling during tumor cell invasion into normal cell populations by primary or metastatic tumorigenesis , There is. PDG in cancer biopsy specimens
Quantitation of FC would be useful as an indicator of future metastatic risk.

[0052] PDGF-C may also be associated with various pulmonary conditions. The PDGF-C assay could be used to diagnose various lung disorders. PDG
FC could also be used in the treatment of lung disorders to improve pulmonary blood circulation and / or gas exchange between the lungs and the bloodstream. Similarly, PDGF-
C could be used to improve cardiac blood circulation and O ₂ permeability in cases of heart failure. Similarly, PDGF-C could be used to improve blood flow and gas exchange in chronic obstructive airway disease.

Thus, the present invention is a method of stimulating angiogenesis, lymphangiogenesis, neovascularization, connective tissue development and / or injury treatment in a mammal in need of such treatment. Thus, there is provided a method comprising administering to the mammal an effective dose of PDGF-C or a fragment or analog thereof having PDGF-C biological activity. Optionally, said PDGF-C or a fragment or analog thereof is VEGF, VEGF-B, VEGF-C, VEGF-D, PlG.
It can be administered together with or in combination with any one or more of F, PDGF-A, PDGF-B, FGF and / or heparin.

Conversely, PDGF-C antagonists (eg, antibodies and / or competitive or non-competitive inhibitors of PDGF-C binding both in dimer formation and receptor binding) can be used, eg, to increase vascular permeability. As in the lungs arising from
Conditions related to fluid retention, such as congestive heart failure, could be used to treat by exerting an onset effect on vascular permeability to counter that fluid retention. PDGF-C can also be used to treat fibrotic conditions such as those found in the lung, kidney and liver. The administration of PDGF-C could be used to treat malabsorption syndrome in the intestinal tract, liver or kidney as a result of its increased vascular circulation and increased vascular permeability activity.

Accordingly, the present invention is a method of inhibiting angiogenesis, lymphangiogenesis, neovascularization, connective tissue development and / or damage treatment in a mammal in need of such treatment. Thus, there is provided a method comprising the step of administering an effective dose of a PDGF-C antagonist to the mammal. The antagonist may inhibit the activity of a receptor, such as by blocking PDGF-C from binding to its corresponding receptor on target cells, or by using a receptor-binding PDGF-C variant. Any agent that blocks the action of PDGF-C may be used. Suitable antagonists include, but are not limited to, PDGF-
Antibodies to C, the PDGF-C of PDGF-C, such as the receptor binding or PDGF-C dimer-forming but non-mitogenic PDGF-C variants described above.
Competitive or non-competitive inhibitors of binding to the C receptor, compounds that bind to PDGF-C and / or modify or counter their function, antisense nucleotide sequences described below.

A method is provided for measuring an agent that binds to activated truncated form of PDGF-C. The method comprises the steps of contacting the activated truncated form of PDGF-C with a test agent and monitoring binding by appropriate means. Agents can include both compounds and other proteins.

The present invention provides a screening system for discovering agents that bind to activated truncated PDGF-C. The screening system comprises the steps of: preparing an activated truncated PDGF-C; contacting the activated truncated PCGF-C with a test agent; Quantifying the binding to PDGF-C. The screening system can also be used to identify agents that inhibit proteolytic cleavage of the full-length PDGF-C protein, thereby blocking the release of the activated truncated PDGF-C. For this use, full-length PDGF-C must be prepared and prepared.

The use of this screening system provides a means for determining compounds that may alter the biological function of PDGF-C. This screening method can be applied to large-scale automated processing such as the PANDE ^™ (Baxter-Dade Diagnostics) system, etc., to enable efficient and large-scale screening of agents having a potentially curative action.

For this screening system, preferably using recombinant DNA technology, activated truncated PDGF-C or full-length PDGF-C as described herein
To adjust. A test agent, eg, a compound or protein, is introduced into a reaction vessel containing the activated truncated PDGF-C or full-length PDGF-C. Binding of the test agent to activated truncated PDGF-C or full-length PDGF-C is measured by any suitable means, including, but not limited to, radioactively or chemically labeling the test agent. The activated truncated PDGF-C or full-length PDG
The F-C linkage is described in US Pat. No. 5,585,27, incorporated herein by reference.
No. 7 can also be used. In this method, the binding of the test agent to activated truncated PDGF-C or full length PDGF-C is assessed by monitoring the ratio of folded protein to unfolded protein. Specific examples of this monitoring method include, but are not limited to, the sensitivity of activated truncated PDGF-C or full-length PDGF-C to proteases, or compliance with binding to proteins by specific antibodies to folded proteins ( amenability).

Those skilled in the art will recognize that IC ₅₀ values are dependent on the selectivity of the agent being tested. For example, agents with an IC _{50 of} 10 nM or less are generally considered to be very good candidates for drug treatment. However,
Agents that have low affinity but are selective for a particular target may be better candidates. One skilled in the art will recognize that information regarding the binding potential, inhibitory activity or selectivity of a particular agent is useful for the development of pharmaceutical products.

When PDGF-C or a PDGF-C antagonist is used for therapeutic purposes, the dose or route of administration will depend on the characteristics of the patient and the condition being treated, and It will be at the discretion of the doctor or veterinarian. Suitable routes include oral, subcutaneous, intramuscular, intraperitoneal or intravenous injection, parenteral, topical administration, implantation and the like. Topical administration of PDGF-C can be used similarly to VEGF. For example, an effective amount of truncated PDGF-C may be used at about 0.1 to 1000 when used in injury treatment or other applications where enhanced angiogenesis is advantageous.
It is administered to organisms in need at a dose between μg / kg body weight.

[0062] The PDGF-C or PDGF-C antagonist can be used in combination with a suitable pharmaceutical carrier. The resulting composition has a therapeutically effective amount of PDGF-C or a PDGF-C antagonist, a pharmaceutically acceptable non-toxic salt thereof, and a pharmaceutically acceptable solid or liquid carrier or adjuvant. . Specific examples of such carriers or adjuvants include, but are not limited to, saline, buffered saline, Ringer's solution, mineral oil, talc, corn starch, gelatin, lactose, saccharose, microcrystalline cellulose, kaolin, mannitol, phosphorus There are dicalcium acid, sodium chloride, alginic acid, dextrose, water, glycerol, ethanol, thickener, stabilizers, suspending agents, and combinations thereof.
The compositions may include solutions, suspensions, tablets, capsules, creams, ointments (s
alve), elixir, syrup, wafer, ointment,
Other conventional shapes can be used. The formulation is adapted to the mode of administration. Compositions with PDGF-C may further optionally be
PDGF-A, PDGF-B, VEGF, VEGF-B, VEGF-C, VEG
One or more of FD, PlGF and / or heparin can be included. P
A composition comprising DGF-C may have about 0.1% of its active compound (s).
To 90% by weight, more usually about 10% to 30%.

In the case of an intramuscular preparation, a sterile preparation, preferably a suitable soluble salt form of the cleavage active PDGF-C such as a hydrochloride, may be prepared by removing pyrogen-free water (dilution), physiological saline or The drug can be administered by dissolving it in a pharmaceutical diluent such as a 5% glucose solution. A suitable insoluble form of the compound may be prepared and administered as a suspension in an aqueous base or a pharmaceutically acceptable oil base such as an ester of a long chain fatty acid such as ethyl oleate. it can.

According to yet another aspect, the present invention provides a method, typically as a test kit,
A diagnostic / prognostic indicator is provided. For example, in one embodiment of the present invention, PDG
There is provided a diagnostic / prognostic sign test kit comprising an antibody to F-C and a means for detecting, more preferably evaluating, the binding between this antibody and PDGF-C. In one embodiment of the diagnostic / prognostic sign test kit of the invention, PDGF
A second antibody (secondary antibody) to an antibody of the same isotype and animal origin as the antibody to -C (primary antibody) is provided. The secondary antibody is bound to a detectable label, allowing either unlabeled primary antibody or PDGF-C to bind to the substrate,
The antibody interaction between GF-C / primary antibody is determined by binding of primary antibody to PDGF-C,
Subsequent binding of the labeled secondary antibody to the primary antibody can be demonstrated by measuring the amount of label bound to the substrate. In a particularly preferred embodiment of the present invention, the diagnostic / prognostic sign test kit comprises a conventional immunosorbent assay (ELISA).
) Can be provided as a kit.

In another embodiment, the diagnostic / prognostic sign test kit comprises a PDCF-C
This sequence structure is used to detect any abnormality in PDGF-C expression with the aim of proving whether it is associated with a given disease state. It may have a polymerase chain reaction means for comparison with that disclosed in the application.

Further, the diagnostic / prognostic test kit comprises a restriction enzyme and genomic DNA
To generate a DNA band pattern on the gel,
Limitations for comparing any of the abnormalities in GF-C expression with those disclosed in this application to detect any abnormalities, with the aim of establishing whether any abnormalities are associated with a given disease state It may have a fragment length polymorphism (RFLP) generation means.

According to yet another aspect, the present invention relates to a method of detecting a PDGF-C gene abnormality in a subject that may be associated with a disease state in the subject. The method comprises the steps of providing a DNA or RNA sample from the subject;
PDGF-CD operably linked to a sample or RNA to a polymerase
Contacting with a primer specific for NA, PDGF-C from the sample
The step of selectively amplifying DNA by polymerase chain reaction and the nucleotide sequence of the amplified PDGF-C DNA from the sample are shown in FIG. 1 (SEQ ID NO: 2) or FIG. 3 (SEQ ID NO: 5). Comparing with the obtained nucleotide sequence. The present invention further provides a PDG operably linked to a polymerase.
Includes the provision of a test kit that has a pair of primers specific for FC DNA, thereby enabling the polymerase to selectively amplify PDGF-C DNA from a DNA sample.

The present invention further provides a method for detecting PDGF-C in a biological sample, the method comprising contacting the sample with a reagent capable of binding to PDGF-C, and detecting the binding. And a method comprising: Preferably, said reagent capable of binding to PDGF-C is an antibody against PDGF-C, particularly preferably a monoclonal antibody. In one preferred embodiment, the binding and / or degree of binding is detected by a detectable label, suitable labels are described below.

In another aspect, the present invention relates to a protein dimer consisting of said PDGF-C polypeptide, especially a disulfide bond dimer. These protein dimers of the present invention include PDGF-C polypeptide homodimers,
GF-C and VEGF, VEGF-B, VEGF-C, VEGF-D, PlGF,
Includes both PDGF-A or heterodimers with PDGF-B.

According to yet another aspect of the present invention, there is provided a method of isolating PDGF-C, comprising the step of expressing PDGF-C to promote the release of PDGF-C from the cell, wherein the cell is And a step of purifying PDGF-C thus released.

Yet another aspect of the invention is a vector having an antisense nucleotide sequence complementary to at least a portion of a DNA sequence encoding PDGF-C or a fragment or analog thereof having PDGF-C biological activity. Regarding the offer. Furthermore, the antisense nucleotide sequence can be directed to the promoter region of the PDGF-C gene, which can be used to suppress or at least reduce PDGF-C expression, or to other untranslated regions of the gene. .

According to yet another aspect of the present invention, such a vector having an antisense sequence can be used to suppress, or at least reduce, PDGF-C expression.
Use of this type of vector to suppress this PDGF-C expression is
If C expression is associated with a disease, for example, the tumor may become PDGF- Preferred when producing C. Transforming such tumor cells with a vector containing the antisense nucleotide sequence will inhibit or delay the growth or tissue remodeling of the tumor.

[0073] In another embodiment of the present invention, the full-length PDGF-C protein is an active PDGF
Related to the discovery that it appears to be a potential growth factor that needs to be activated by proteolytic processing to release the / VEGF homology domain. The putative proteolytic sites are residues 231 to 234, residues -RKS of the full-length protein.
R-. This is a two base motif. This site is the mouse PDGF
Stored structurally in -C. The -RKSR- putative proteolytic site is PD
It is also found in GF-A, PDGF-B, VEGF-C and VEGF-D. Of these four proteins, the putative proteolytic site is the PDGF / V
It is also found just before the minimal domain of the EGF homology domain. Taken together, these facts suggest that this is a proteolytic site.

[0074] Suitable proteases include, but are not limited to, plasmids, factor X, and enterokinase. The N-terminal CUB domain may have been used in some extracellular compartments to hold PDGF-C in a latent state, and by limited protein hydrolysis when PDGF-C is needed. May act as an inhibitory domain that is removed.

According to this aspect of the present invention, an activated truncated PDGF-C is made or PDG
Methods for controlling the receptor binding specificity of FC are provided. These methods are
Expressing an expression vector comprising a polynucleotide encoding a polypeptide having PDGF-C biological activity, and processing at least one of the expressed polypeptide to produce the activated truncated PDGF-C. And supplying an amount for proteolytic degradation of

This embodiment further includes a method of selectively activating a polypeptide having growth factor activity. The method comprises expressing an expression vector comprising a polypeptide having growth factor activity, a CUB domain, and a polynucleotide encoding a proteolytic site between the polypeptide and the CUB domain. Processing the peptide to provide a proteolytic amount of at least one enzyme for producing the activated truncated PDGF-C.

Furthermore, this embodiment relates to a nucleic acid molecule encoding a polypeptide having the biological activity of PDGF-C and a polypeptide comprising said amino acid sequence RKSR or a proteolytic site having a structurally conserved amino acid sequence thereof. Including the isolation of

This embodiment further comprises an activator monomer of PDGF-C and VEGF, VEGF-B, VEGF-C, VEGF-D, PDGF-C bound to the CUB domain.
, PDGF-A, activating monomer of PDGF-B or PlGF, or alternatively, VEGF, VEGF-B, VEGF-C, VEGF-D, PDGF-C, PD
Includes an isolated dimer having an activating monomer of GF-A, PDGF-B or PlGF and an activating monomer of PDGF-C bound to a CUB domain. The isolated dimer may or may not have a proteolytic site between the activating monomer and the CUB domain binding.

The polynucleotides of the present invention, such as those described above, fragments of these polynucleotides, and those polynucleotides that have sufficient similarity to hybridize under stringent conditions to the untranslated strands of those polynucleotides. Nucleotide variants are all useful for identifying, purifying, and isolating polynucleotides encoding other non-human, mammalian PDGF-Cs. Therefore,
Such polynucleotide fragments and variants are within the scope of the present invention. Specific examples of stringent hybridization conditions are as follows. 5X SSC, 20 mM NaPO _4, hybridization of 42 ° C. in PH6.8,50% formamide, washed with 0.2X SSC, 42 ° C.. It is desirable for those skilled in the art to appropriately change these conditions based on the length of the sequence to be hybridized and the content of GC nucleotide bases, and that there exists a method for determining such changes. , Will understand. For example, Sambrook et al., "Molecular Clonin
g: A Laboratory Manual ", 2nd edition, p. 9.47-9.
. 51, Cold Spring Harbor, New York; Cold S
See the Spring Harbor Laboratory (1989).

Further, purified and isolated polynucleotides encoding other non-human and mammalian PDGF-C types are also aspects of the present invention. The same applies to antibodies having specific immunoreactivity. Accordingly, the present invention includes purified and isolated mammalian PDGF-C polypeptides, as well as purified and isolated polynucleotides encoding such polypeptides.

It will be clearly understood that the nucleic acid molecules and polypeptides of the present invention can be made by synthetic or recombinant means, and can be purified from natural sources.

For the purposes of this specification, the term “comprising” means “
Including, but not limited to ". "Comprise
A similar meaning applies to the word "ses)."

Detailed Description of the Preferred Embodiment FIG. 1 (SEQ ID NO: 2) shows that c encodes a novel member of the VEGF / PDGF family, human PDGF-C (hPDGF-C) (2108 bp).
1 illustrates the complete nucleotide sequence of DNA. Clone # 4 encoding hPDGF-C (see FIGS. 3 and 4: SEQ ID NOs: 4 and 5) is not full length,
About 80 base pairs (corresponding to 27 amino acids) were missing when compared to the mouse protein. Additional cDNA clones were isolated from a human fetal lung cDNA library to obtain an insert containing this missing sequence. Clone # 10 had a longer insert than clone # 4. 5 inserts from clone # 10
The 'region was sequenced and found to contain the missing sequence. Some 5 'untranslated sequences, the translated portion of the cDNA encoding human PDGF-C, and some 3' untranslated nucleotide sequences are depicted in FIG. 1 (SEQ ID NO: 2). The frame stop codon is the start ATG (start AT
G (underlined in FIG. 1) is located 21 bp upstream.

The work of isolating this novel human PDGF / VEGF is described in Washington, D.C. C. Sequence Tag (EST) at the National Center for Biotechnology Information (NCBI)
Starting after searching the database, dbEST, the human EST sequence (W21436)
) Which appears to encode part of the human homolog of the mouse PDGF-C. 5′-GAA GTT GAG GAA CCC AGT G-3 ′ Forward direction (SEQ ID NO: 25) 5′-CTT GCC AAG AAG TTG CCA AG-3 ′ Reverse based on the human EST sequence Direction (sequence identification number 26).

Using these oligonucleotides, the human fetal lung 5′-STRETCH P purchased from Clontech was used by the polymerase chain reaction (PCR).
A 348 bps polynucleotide from the LUS λgt10 cDNA library was amplified. The PCR product is transferred to Original TA Cloning
Kit (Invitrogen) was cloned into pCR2.1 vector.
The 348 bps cloning PCR product was then used to generate h
A PDGF-C probe was constructed.

The 10 ⁶ lambda clones of the human fetal lung 5′-STRETCH PLUS λGT10 cDNA library (Clontech) were transformed into hP by standard methods.
Screened with DGF-C probe. From multiple positive clones,
One, clone # 4, was analyzed in more detail and the nucleotide sequence of its insert was determined by standard methods using internal and vector oligonucleotides. The insert of this clone # 4 contains the full-length human PDGF-C (hPDGF-C
C) contains the partial nucleotide sequence of the cDNA encoding C). The nucleotide sequence (1536 bp) of this clone # 4 is shown in FIG. 3 (SEQ ID NO: 4).
The untranslated portion of this cDNA contains nucleotides 6-956. The deduced amino acid sequence of the translated portion of this insert is shown in FIG. 4 (SEQ ID NO: 5). The polynucleotide of this deduced amino acid sequence contains the first two nucleotides found in full-length hPDGF-C.
Eight amino acid residues will be missing. However, the polynucleotide has sufficient proteolytically active fragments to activate the PDGF alpha receptor. It should be noted that the first glycine (Gly) in SEQ ID NO: 5 is not found in the full-length hPDGF-C.

The mouse EST sequence (AI020581) was obtained from Washington, D.C. C. Identified in a database search of the dbEST database of NCBI, Inc., which appears to encode a new mouse PDGF, part of PDGF-C. The mouse c
A large portion of DNA was obtained by PCR amplification using DNA from a mouse fetal λgt10 cDNA library as a template. To amplify the 3 ′ end of the cDNA, a sense primer obtained from the mouse EST sequence was used (the sequence of this primer was 5′-CTT CAG TAC CTT GGA
AGAG, primer 1 (SEQ ID NO: 27)). To amplify the 5 'end of the cDNA, an antisense primer obtained from the mouse EST was used (the sequence of this primer was 5'-CGC TTG ACC
AGG AGA CAAC, primer 2 (SEQ ID NO: 28)).
The λgt10 vector primer is a sense 5′-ACG TGA ATT
CAG CAA GTT CAG CCT GGT TAA (primer 3 (SEQ ID NO: 29)) and antisense 5'-ACG TGG ATC CTG A
GT ATT TCT TCC AGG GTA (Primer 4 (SEQ ID NO: 30)). Combinations of these vector primers and in-vivo primers obtained from mouse EST were used for standard PCR reactions. The size of the amplified fragment was about 750 bp (3'-fragment) and 800 b
p (5'-fragment). These fragments were cloned into the pCR2.1 vector and analyzed for nucleotide sequence using vector primers and in vivo primers. Since these fragments did not contain the full length sequence of mPDGF-C, a mouse liver ZAP cDNA library was screened using standard conditions. As a probe using primers 1 and 2,
Also, using the DNA from the mouse fetal λgt10 library as a template, a 261 bp ³² P-labeled PCR fragment was generated (see above). Multiple positive plaques were purified and the nucleotide sequence of their inserts was
Obtained after subcloning into script. Vector specific primers and in vivo primers were used. By combining the nucleotide sequence information of the prepared PCR clone and the isolated clone, mPDGF-C
Could be estimated (see FIG. 6) (SEQ ID NO: 7).
.

FIG. 7 shows a comparative sequence alignment of the amino acid sequences of mouse and human PDGF-C (SEQ ID NOs: 6 and 2, respectively). This alignment shows that these human and mouse PDGF-Cs are found in 345 residues of the full length protein.
FIG. 3 illustrates that it shows about 87% identity including 5 amino acid substitutions. Most of the observed amino acid sequence substitutions are conserved in nature. The predicted cleavage site for signal peptidase of mPDGF-C is between residues G19 and T20. This will create a secreted mouse peptide of 326 amino acid residues.

FIG. 8 shows the signal sequence (hatched box), the N-terminal CUB domain,
FIG. 4 provides the schematic domain structure of mouse PDGF-C with a terminal PDGF / VEGF-homology domain (open box). The amino acid sequence indicated by the line has no apparent similarity to the CUB domain or the VEGF-homology domain.

The high sequence identity suggests that human and mouse PDGF-C have almost identical domain structures. Amino acid sequence comparisons revealed that both mouse and human PDGF-C exhibit novel domain structures. Apart from the PDGF / VEGF-homology domains located at the C-terminal regions of both proteins (residues 164-345), the N-terminal regions of both PDGF-Cs have a domain called the CUB domain (Bork) And Beckmann, J. Mol. Biol., 1993 231 ,
539-545). This approximately 110 amino acids (domain of amino acid residues 50-160 was originally identified as a complementary Clr / Cls, but has more recently been identified as bone morphogenic protein 1 (BMP-1) (Wozney ( Wozney), S
science, 1988 242 , 1528-1534), and further, neuropilin-1 (NP-1) (Soker, etc., Cel, etc.).
1, 1988 92 735-745). Although the functional role of the CUB domain is unclear, it may be involved in protein-protein interactions and interactions with carbohydrates, including heparin sulfate proteoglycans.

FIG. 9 shows the C-terminal PDGF / VEGF-homology domains of human and mouse PDGF-C and PDGF / VEGF family members, VEGF ₁₆₅ , PlG.
_{F-2, VEGF-B 167} , Pox Orf VEGF, VEGF-C, VEG
C-terminal PD of FD, PDGF-A and PDGF-B (SEQ ID NO: 8-17)
Figure 2 shows an amino acid sequence alignment with the GF / VEGF-homology domain. Some of the amino acid sequences of the N- and C-terminal regions of VEGF-C and VEGF-D are omitted in this figure. Gaps were introduced to optimize the alignment. This alignment is described in Hein's method (Method Enzymol. 1990 183 626-45)
Created using the AM residue weight table. Residues boxed indicate amino acids corresponding to PDGF-C in two spaced units.

The above alignment shows, with one exception, PDGF-C having the expected pattern of unchanged cysteine residues, a hallmark of this family. That is, three additional amino acids (NCAs) are inserted between cysteines 3 and 4, usually separated by two residues. This feature of the sequence of PDGF-C was very unexpected.

A phylogenetic tree was constructed based on the amino acid sequence alignment shown in FIG. This is shown in FIG.
0 is shown. The data show that the PDGF-C homology domain is VEGF-C and VEGF-C.
This indicates a strong association with the PDGF / VEGF-homology domain of GF-D.

As illustrated in FIG. 11, amino acid sequences from multiple CUB-containing proteins were aligned (SEQ ID NOs: 18-24). The results show that one CUB domain of human and mouse PDGF-C (SEQ ID NOs: 18 and 19, respectively) shows considerable identity to the most relevant CUB domain. A sequence from human BMP-1 with three CUB domains (CUB1-3 (SEQ ID NOS: 20-22)) and a human neuron with two CUB domains (CUB1-2) (SEQ ID NOS: 23 and 24, respectively) Pyrin-1 is shown. Gaps were introduced to optimize alignment. This alignment is based on the method of J. Hein (Methods Enzym).
ol. , 1990 183 626-45) with PAM250 residue weight.
Made using table.

FIG. 12 shows Northern blot analysis of PDGF-C transcript expression in multiple human tissues. This analysis indicates that PDGF-C is encoded by a major transcript of about 3.8-3.9 kb and a minor transcript of 2.8 kb. The numbers on the right indicate the size (in kb) of the mRNA. Tissue expression of PDGF-C was determined using a commercially available Multiple Tissue Northern blot (MT
N, Clontech).
The blots were hybridized using the PressHby solution at 68 ° C. for 1 hour (high stringency conditions) according to the supplier's instructions and with a 353 bp hPDGF-C EST probe from a fetal lung cDNA library as described above. I searched. The blots were then incubated in 2 × SSC with 0.05% SDS at 50 ° C. for 30 minutes in 0.1 × SSC with 0.1% SDS.
And washed at 50 ° C. for another 40 minutes. These plots were then placed on film and exposed at -70 ° C. These blots show that PDGF-C transcripts show heart, liver,
It is most abundant in kidney, pancreas, and ovaries, while lower levels of transcript indicate that it is present in most other tissues, including placenta, skeletal muscle, and prostate. PDGF-C transcripts were below detection levels in spleen, colon, and peripheral blood T lymphocytes.

FIG. 13 shows the regulation of PDGF-C mRNA expression by hypoxia. A size marker (in kb) is shown on the left side of the lower panel. PDGF-
The estimated size of C mRNA is shown on the left side of the upper panel (2.7 and 3.5 kb, respectively). To determine whether PDGF-C was induced by hypoxia, cultured human dermal fibroblasts were exposed to hypoxia for 0, 4, 8, and 24 hours. Poly (A) + mRNA was isolated from cells using oligo dT cellulose affinity purification. The isolated mRNA was electrophoresed through a 12% agarose gel using 4 μg of mRNA per line. Northern blot was performed and hybridized with the PDGF-C probe. The size of the two bands and the same filters were used for the hVEGF, hVEGF-B and hVEGF-C probes (Enholm et al., Oncogene,
1997 14 2475-2483), and these m
It was determined by insertion based on the known size of RNA. The results, shown in FIG. 13, indicate that PDGF-C is not regulated by hypoxia in human dermal fibroblasts.

FIG. 14 shows the expression of PDGF-C mRNA in a human tumor cell line. To determine whether PDGF-C is expressed in major human cell lines, poly (A) + mRNA was isolated from multiple known tumor cell lines and
RNA was electrophoresed through a 12% agarose gel, Northern blot and P
Analyzed by hybridization with the DGF-C probe. The results shown in FIG. 14 indicate that PDGF-C mRNA was found to be JEG3 (human choriocarcinoma, ATCC
# HTB-36), G401 (Wilms tumor, ATCC # CRL-144)
1), DAMI (megakaryocytic leukemia), A549 (human lung cancer, ATCC #CC)
L-185) and HEL (human erythroleukemia cells, ATCC # TID-180). It is thought that further growth of these PDGF-C-expressing tumors can be suppressed by suppressing PDGF-C. It is also contemplated that PDGF-C expression may be used as a means to identify a particular type of tumor.

Example 1 Generation of Specific Anti-Peptide Antibodies to Human PDGF-C Two synthetic peptides were generated and then used to raise antibodies against human PDGF-C. The first synthetic peptide corresponds to residues 29-48 at the N-terminus of full length PDGF-C, which have additional cysteine residues at the N and C termini. : CKFQFSSNKEQNGVQDPQHERC (SEQ ID NO: 31)
). The second synthetic peptide comprises residues 230 of the internal region of full-length PDGF-C.
Corresponds to -250 with an additional cysteine residue at the C-terminus. : GRKSRVV
DLNLLTEEVRLYSC (SEQ ID NO: 32)
Each uses the carrier protein keyhole limpet hemocyanin (KL) using N-succinimidyl 3- (2-pyridyldithio) propionate (SPDP) (Pharmacia) according to the supplier's instructions.
H, Calbiochem). 200-300 micrograms of the conjugate in phosphate buffered saline (PBS) were suspended in Freund's complete adjuvant and injected subcutaneously at multiple sites in the rabbit. Rabbits were boosted subcutaneously at two week intervals with the same amount of conjugate suspended in Freund's incomplete adjuvant. Blood was collected from the rabbit and collected. Serum was prepared using standard methods known to those skilled in the art.

Example 2: Expression of full-length human PDGF-C in mammalian cells A full- length cDNA encoding human PDGF-C was converted to a mammalian expression vector, pSG5 (Stratagene, La Jolla) having the SV40 promoter.
, CA). Using the DEAE-dextran method, COS-
One cell was transfected with this construct and, in another transfection, with the pSG5 vector without the cDNA insert as a control. Twenty-four hours after these transfections, serum-free medium was added to the transfected COS-1 cells, and aliquots containing secreted proteins were collected over 24 hours after the addition of this medium. These aliquots were precipitated using ice-cold 10% trichloroacetic acid for 30 minutes, and the precipitate was washed with acetone. These precipitated proteins were dissolved in SDS loading buffer under reducing conditions and separated on SDS-PAGE gels using standard methods. These separated proteins were electrotransferred to Hybond filters, and the preparation was performed by immunoblotting using the rabbit antiserum against the in vivo peptide of full-length PDGF-C as described above. Using enhanced chemiluminescence (ECL, Amersham)
Bound antibody was detected. FIG. 15 shows the results of this immunoblot. The sample was only partially reduced and the monomer of human PDGF-C was 55%
It migrated as a kDa species (lower band) and the dimer migrated as a 100 kDa species (upper band). This indicates that the protein is secreted intact and that no major proteolytic processing occurs during secretion of this molecule in mammalian cells.

[0100]Example 3: Generation of full-length and truncated human PDGF-C in baculovirus-infected Sf9 cells Present The full length coding portion of the human PDGF-C cDNA (970 bp) was prepared under standard conditions.
Using Deep Vent DNA polymerase (Biolabs)
Amplified by PCR. The full-length PDGF-C was amplified for 30 cycles.
. Each cycle consisted of 1 minute denaturation at 94 ° C, 1 minute annealing at 56 ° C,
Extension at 2 ° C. for 2 minutes. The forward primer used was 5‘CG GGATCC CGAATCCAACCTGAGTAG3 '(SEQ ID NO: 33)
Met. This primer is used in the BamHT region for in-frame cloning.
Includes place (underline). The reverse primer used was 5‘GGAATTCCTAA
TGGTGATGGGTGATGATGTTTGTCATCGTCATCTCCT
CCTGTGCTCCCTCT3 '(SEQ ID NO: 34). This ply
The mer has a C-terminal 6X after the EcoRI site (underlined) and an enterokinase site.
 His tag coding sequence. Furthermore, PDGF / VE of human PDGF-C
Residues 230-345 of the GF homology domain (PVHD) were prepared according to standard conditions and methods.
Using Deep Vent DNA polymerase (Biolabs)
Amplified by CR. Residues 230-345 of the PVHD of PDGF-C were replaced with 25
The cycle was amplified. Here, each cycle consists of denaturation at 94 ° C. for 1 minute and 56 ° C.
It consisted of annealing for 1 minute and extension at 72 ° C. for 4 minutes. Square used
Primer for 5 ° CGGATCCCGGAAGAAAATCCAGAGTG
GTG3 '(SEQ ID NO: 35). This primer is in-frame (
Includes BamHI site (underlined) for cloning in frame. use
The reverse primer was 5‘GGAATTCCTAATGGTGATGGTGTG
ATGATGTTTGTCATCGTCATCTCCTCCCTGTGCTCCC
TCT-3 '(SEQ ID NO: 36). This primer is the EcoRI part
Position (underlined) and after the enterokinase site, the C-terminal 6X His tag code
And an array. The PCR product is digested with BamHI and EcoRI,
Baculovirus expression vector, pAcGP67A. Ko
Confirm that the correct sequence of the PCR product cloned in the construct is correct.
Performed by otide sequencing. The expression vector is then transferred to the manufacturer's protocol.
BaculoGold Linearized Baculo according to Pharmingen
Ils DNA and Sf9 insect cells were co-transfected. The manual (
Pharmingen) to begin large-scale protein production and protein purification
Prior to amplification, the recombinant baculovirus was multiply amplified.

Sf9 cells, adapted to serum-free medium, were infected with recombinant baculovirus at approximately 7-fold multi-fold infection. The medium containing the recombinant protein was collected 4 days after infection and incubated with Ni-NTA agarose beads (Qiagen). The beads were collected on a column and 50 mM containing 300 mM NaCl.
After washing well with a sodium phosphate buffer, pH 8 (wash buffer), the bound proteins were removed while increasing the concentration of imidazole in the wash buffer (
(100 mM to 500 mM). These diluted proteins were subjected to SDS-on 12.5% polyacrylamide gel under reducing and non-reducing conditions.
Analyzed by PAGE. For immunoblot analysis, the protein is
Electrotransfer (electr) to Hybond filter in 45 minutes
was transferred).

FIGS. 16A-C show the isolation and partial characterization of full length human PDGF-C protein. In FIG. 16A, the recombinant full-length protein was visualized on a blot using an anti-peptide antibody against the N-terminal peptide (described above). FIG.
In B, the recombinant full-length protein was visualized on a blot using an anti-peptide antibody against an in vivo peptide (described above). The separated proteins were visualized by staining with Coomassie brilliant blue (FIG. 16C). FIG. 16A-
The numbers below C indicate the concentration of imidazole used to elute the protein from the Ni-NTA column and are expressed in molar (M). FIGS. 16A-C also show that the full-length protein was 90 kDa under non-reducing conditions.
It shows that it migrates as a species and, under reducing conditions, migrates as a 55 kDa species. This also indicates that the full length protein is expressed as a disulfide-linked dimer.

FIGS. 17A-C show the isolation and partial characterization of truncated human PDGF-C containing only the PDGF / VEGF homology domain. In FIG. 17A, Ni
-Immunoblot analysis of the fractions eluted from the agarose column shows that this protein can be eluted at imidazole concentrations ranging from 100-500 mM. These eluted fractions were analyzed under non-reducing conditions and the truncated human PDGF-C was visualized on a blot using an anti-peptide antibody against the in vivo peptide (described above). FIG. 17B shows Coomassie brilliant blue staining of the same fraction as FIG. 17A. This indicates that this procedure creates a highly purified material that migrates as a 36 kDa species. FIG. 17C shows non-reduction (non-red.) And reduction (red.
. 4) Coomassie brilliant blue staining of truncated human PDGF-C protein. The data indicate that the protein is a secreted dimer held together by disulfide bonds, and that the monomer migrates as a 24 kDa species.

Example 4: Receptor binding properties of full-length and truncated PDGF-C To evaluate the interaction between full-length and truncated PDGF-C and the VEGF receptor, human VEGFR of full-length and truncated PDGF-C was evaluated. -1, VEGFR-
2, and VEGFR-3 (Olfsson, et al., Proc. Na.
tl. Acad. Sci. USA, 1998 95 11709-11714).
The ability to bind to a soluble Ig-fusion protein containing the extracellular domain of VEGFR-1-Ig, VEGFR-2-Ig and VEGFR-3-I
These fusion proteins, designated g, were transiently expressed in human 293EBNA cells. All Ig fusion proteins were human VEGFR. Cells were incubated for 24 hours after transfection, washed with Dulbecco's modified Eagle's medium (DMEM) containing 0.2% bovine serum albumin, and washed for 24 hours.
Time starved. Next, the fusion protein was precipitated from clarified and conditioned media using Protein A-Sepharose beads (Pharmacia).
These beads were combined with 100 microliters of 10 × binding buffer (5% bovine serum albumin, 0.2% Tween 20 and 10 μg / ml heparin) and pre-filled with a mammalian expression plasmid encoding full-length or truncated PDGF-C or Combine with conditioned medium from 900 microliters of 293 cells transfected with the control vector, followed by ³⁵ S-cysteine and methionine (Promix
, Amersham) for 4-6 hours. After 2.5 hours at room temperature,
The Sepharose beads were washed three times with binding buffer at 4 ° C., once with phosphate buffered saline, and boiled in SDS-PAGE buffer. Labeled protein bound to the Ig fusion protein was analyzed by SDS-PAGE under reducing conditions. Radiolabeled protein was detected by using a phosphorimeter. In all of these analyses, radiolabeled PDGF-C was labeled with any VE
No mp interaction with the GF receptor was shown.

Next, the ability of full-length and truncated PDGF-C to bind to human PDGF receptor alpha and beta was tested by analyzing their ability to compete with PDGF-BB for binding to the PDGF receptor. did. These binding experiments were performed on porcine aortic endothelial-1 (PAE-1) cells stably expressing the human PDGF receptor alpha and beta (Erikson (Erikson)
Ssson) et al., EMBO J, 1992, 11 , 543-550). Binding experiments are essentially Herudin (Heldin) etc. (EMBO J, 1988, 7 1
387-1393). Various concentrations of human full-length and truncated PDGF
-C or human PDGF-BB was mixed with 5 ng / ml ¹²⁵ I-PDGF-BB in binding buffer (PBS containing 1 ng / ml bovine serum albumin). Aliquots were incubated for 90 minutes in 24-well culture dishes on ice with PAE-1.
Cells were incubated with the expressing receptor. After three washes with binding buffer, cell-bound ¹²⁵ I-PDGF-BB was added to 20 mM Tris-HCl, pH 7
. Extracted by lysis of cells in 5,10% glycerol, 1% Triton X-100. The amount of cell bound radioactivity was measured with a gamma counter. ¹²⁵ I-labeled PDGF against PAE-1 cells expressing PDGF alpha receptor
The standard curve for the binding of the BB homodimer is shown in FIG. By gradually adding excess unlabeled protein to the incubation, it efficiently competed with the cell association of the labeled tracer.

FIG. 19 graphically illustrates that the truncated PDGF-C competed efficiently for binding to the PDGF alpha receptor, whereas the full length protein did not. Neither of these full-length proteins nor the truncated proteins competed for the PDGF beta receptor.

Example 5 Phosphorylation of PDGF Alpha Receptor To test whether PDGF-C causes enhanced phosphorylation of PDGF alpha receptor, full-length and truncated PDGF-C bind to PDGF alpha receptor. The ability to stimulate phosphorylation was tested. Human PDGF
Serum-deficient porcine aortic endothelial (PAE) cells that stably express the alpha receptor were isolated from 1 mg / ml BSA, 10 mg / ml PDGF-AA and 100 ng / m2.
l full-length human PDGF-CC homodimer (flPDGF-CC)
g / ml cleaved PDGF-CC homodimer (cPDGF-CC) or 10n
The mixture was incubated for 90 minutes on ice with PBS supplemented with a mixture of g / ml PDGF-AA and 100 ng / ml cut PDGF-CC. Full length and cut PD
The GF-CC homodimer was prepared as described above. Addition of polypeptide 6
After 0 minutes, the cells were washed with lysis buffer (20 mM Tris-HCl, pH 7.5,
. 5% Triton X-100, 0.5% deoxycholic acid, 10 mM EDTA,
(1 mM orthovanadate, 1 mM PMSF 1% trazilol).
The PDGF alpha receptor was immunoprecipitated from the clarified lysate with a rabbit antiserum to human PDGF alpha receptor (Erickson (Er).
iksson) et al., EMBO J, 1992 11 543-550). The precipitated receptor was applied to an SDS-PAGE gel. After SDS gel electrophoresis, the precipitated receptors were transferred to nitrocellulose filters, and these filters were transferred to anti-phosphotyrosine antibody PY-20 (Transducti).
on Laboratories). These filters were then incubated with horseradish peroxidase-conjugated anti-mouse antibodies. Bound antibodies were detected using enhanced chemiluminescence (ECL, Amersham). The filters were then stripped and probed again with the PDGF alpha-receptor rabbit antiserum, and the amount of receptor was determined by incubation with horseradish peroxidase-conjugated anti-rabbit antibody. Bound antibodies were detected using enhanced chemiluminescence (ECL, Amersham). Searching the filter with a PDGF alpha-receptor rabbit antibody confirmed that the same amount of receptor was present in all lanes. PDGF-AA is included in the experiment as a control. FIG. 20 shows that truncated, but not full-length, PDGF-CC efficiently induced phosphorylation of PDGF alpha-receptor tyrosine. This is because the truncated PDGF-CC is a powerful PD
This indicates that it is a GF alpha receptor agonist.

Example 6: Mitogenic activity of PDGF-C on fibroblasts FIG. 21 shows the mitogenic activity of cleaved and full-length PDGF-CC on fibroblasts. This assay is essentially a method described by Mori et al. Biol.
Chem. , 1991 266 21158-21164. Serum-deficient human foreskin fibroblasts were cultured in the presence of 0.2 μm Ci [3H] thymidine with 1 mg / ml BSA and 3 ng / ml, 10 ng / ml or 30 ng / ml full-length PDGF-CC (flPDGF-CC). , Truncated PDGF
Incubated with 1 ml of serum-free medium supplemented with -CC (cPDGF-CC) or PDGF-AA for 24 hours. After trichloroacetic acid (TCA) precipitation, [3H] thymidine incorporation into DNA was measured using a beta counter. The results indicate that truncated PDGF-CC, but not full-length PDGF-CC, is a potent mitogen for fibroblasts. PDGF-AA is included in the experiment as a control.

[0109] PDGF-C does not bind to any of the known VEGF receptors. PDG
FC is currently the only VEGF family member that can bind to the PDGF alpha receptor and increase its phosphorylation. PDGF
-C is also currently the only VEGF family member that is a potent mitogen for fibroblasts. These properties indicate that truncated PDGF
-C is not a VEGF family member, suggesting that it may be a novel PDGF. In addition, full-length proteins may be potential growth factors that need to be activated by proteolytic processing to release active PDGF / VEGF homology domains. The putative proteolytic site is a dibasic motif found at residues 231-234 of the full-length protein, -RKSR-. This site is structurally conserved in a comparison of mouse and human PDGF-C (FIG. 7). Suitable proteases include, but are not limited to, Factor X and enterokinase. The N-terminal CUB domain may be usable to locate this potential growth factor in some extracellular compartments (eg, extracellular matrix), eg, fetal development, tissue regeneration, bone regeneration It may be expressed as an inhibitor that is removed by limited proteolysis when needed, such as during tissue remodeling, including remodeling, active angiogenesis, tumor progression, tumor invasion, metastasis and / or injury treatment. Absent.

Example 7: PDGF receptor binding of truncated PDGF-C To assess the interaction between truncated PDGF-C and PDGF alpha and beta receptors, truncated PDGF-C expresses PDGF alpha and beta receptors, respectively. The ability to bind to porcine aortic endothelial-1 (PAE-1) cells was tested (Eriksson et al., EMBO J, 199).
2 11 543-550). This binding experiment was essentially performed by Heldin et al. (EMB
OJ., 1988 7 1387-1393). Five micrograms of the cleaved PDGF-C protein in 10 microliters of sodium borate buffer was combined with Bolton-Hunter.
r) Radiolabeled to a specific activity of 4 × 10 ⁵ cpm / ng using reagents (Amersham). Various concentrations of radiolabeled cleaved PDGF-C, with or without added unlabeled protein, in binding buffer (PBS containing 1 mg / ml bovine serum albumin) were added to 24-well on ice for 90 minutes. Added to receptors expressing PAE-1 cells plated on culture dishes. After three washes with binding buffer, cell-bound ¹²⁵ I-labeled PDGF-C was added to 20 mM Tris-HC.
Extracted by lysis of cells in 1, pH 7.5, 10% glycerol, 1% Triton X-100. The amount of cell bound radioactivity was measured with a gamma counter. Non-specific binding was estimated in some experiments by including a 100-fold molar excess of truncated PDGF-C. All combined data are the average of three analyzes and 1
Experimental variability in experiments ranging from 0-15%. As seen in FIG. 22, truncated PDGF-C binds to cells that express the PDGF alpha receptor but not to the beta receptor. Binding was specific by radioactively labeled PDGF-C being quantitatively replaced by a 100-fold molar excess of unlabeled protein.

Example 8: Protease action on full -length PDGF-C To demonstrate that full-length PDGF-C can be activated by limited proteolysis to release the PDGF / VEGF homology domain from the CUB domain. The protein was digested by various proteases. For example, full-length PDGF-C is converted to 2-3 units of plasmin (Sig
1.5-4.5 in 20 mM Tris-HCl (pH 7.5) containing 1 mM CaCl ₂ , 1 mM MgCl ₂ and 0.01% Tween 20 using ma).
Digestion was performed at 37 ° C. for 3 hours with 3 units plasmin / ml. The released domain is
Substantially in its size, truncated PDGF previously produced in insect cells
-C type is supported. Plasmin-digested PDGF-C and undigested full-length PDGF-
C was applied to an SDS-PAGE gel under reducing conditions. After SDS-PAGE electrophoresis, each protein was transferred to a nitrocellulose filter, and the filters were transferred to residues 230-250 (residues GRKSRVV of the full-length protein located just N-terminal to the PDGF / VEGF homology domain.
Probed using a rabbit anti-peptide antiserum against DLNLLTEEVLYSC (SEQ ID NO: 37). The conjugated antibody was analyzed by enhanced chemiluminescence (ECL,
(Amersham). FIG. 23 shows an immunoblot of the 55 kDa undigested full length protein and the plasmin-producing 26-28 kDa species.

Example 9: Binding of plasmin-digested PDGF-C to PDGF alpha receptor To evaluate the interaction between plasmin-digested PDGF-C and PDGF alpha receptor, plasmin-digested PDGF-C expresses PDGF alpha receptor. porcine aortic endothelial -1 (PAE-1) were tested their ability to bind to cells (Erickson (Eriksson), etc., EMBO J, 1992 11 5
43-550). Receptor binding assays were performed using 30 ng / ml ¹²⁵
Using I-labeled cleaved PDGF-C, the procedure was similar to that of Example 7. As shown in FIG. 24, gradually higher concentrations of plasmin-digested PDGF-C effectively competed for competition for the PDGF alpha receptor. In contrast, the undigested full length P
DGF-C did not compete for receptor binding. These data indicate that full-length PDGF-C is a potential growth factor unable to interact with the PDGF alpha receptor, and that limited proteolysis that releases the C-terminal PDGF / VEGF homology domain indicates that active PDGF alpha Indicate that it is necessary to create a receptor ligand / agonist.

Example 10 Cloning and Expression of the Human PDGF-C CUB Domain A human PDGF-C 430 bp cDNA fragment encoding the expressed CUB domain (amino acid residues 23-159 of full length PDGF-C) was used using standard conditions and methods. And amplified by PCR using Deep Vent DNA polymerase (Biolabs). The forward primer used was 5′cg ggat cc cgaatccaccacctgagtag3 ′ (SEQ ID NO: 38). This primer is used for BamHI for inclone frame cloning.
It has a site (underlined). The reverse primer used was 5′ccg gaattc ctatgggtgatgggtgatgatgtttgtcatcatcgtcgtc.
gacaatgttgtaggtg 3 ′ (SEQ ID NO: 39). This primer has an EcoRI site (underlined) and a C-terminal 6x after the enterokinase site.
A sequence encoding a His tag. The amplified PCR fragment was then cloned into the pACgp67A transfer vector. Confirmation of the correct sequence of the expression construct, CUB-pACgp67A, was performed by automated nucleotide sequencing. These expression vectors were then co-transfected into BaculoGold linearized baculovirus DNA and Sf9 insect cells according to the manufacturer's (Pharmingen) protocol. Before starting large-scale protein production and protein purification,
Amplification was performed several times according to the manual (Pharmingen).

Sf9 cells adapted to serum-free medium were infected with the recombinant baculovirus in approximately 7 multiple infections. The medium containing the recombinant protein was collected 72 hours after infection and incubated with Ni-NTA-agarose beads (Qiagen) at 4 ° C. overnight. These beads were collected on a column and 300 mM NaC
After extensive washing with 50 mM sodium phosphate buffer containing 1 l (wash buffer), the bound proteins were eluted with a higher concentration of imidazole (100 mM to 400 mM) in the wash buffer. Eluted proteins were analyzed by SDS-PAGE using polyacrylamide gels under reducing and non-reducing conditions.

FIG. 25 shows the results obtained from Coomassie blue staining of the gel. The human PDGF-C CUB domain is a disulfide-linked homodimer with a molecular weight of about 55 KD under non-reducing conditions, whereas under reducing conditions there are two monomers of about 25 KD and 30 KD, respectively. I have. This heterogeneity is probably due to the two putative Ns present in the CUB domain at amino acid positions 25 and 55.
-By heterologous glycosylation at the linked glycosylation site. The protein marker lane is illustrated on the left side of the figure.

Example 11: Localization of PDGF-C transcripts in the developing mouse embryo To obtain insight into the biological function of PDGF-C, the mouse embryo PDGF
-C expression was localized by non-radioactive in situ hybridization in tissue sections from the head (FIGS. 26A-26S) and genitourinary tract (FIGS. 26T-26V) regions. This non-radioactive in situ hybridization protocol and PD
The GF-A and PDGF® alpha probes are described in Bostrom et al., Cell, 1996 85 863-8, incorporated herein by reference.
72). The PDGF-C probe is a mouse PDGF-C
Obtained from cDNA. The hybridization patterns illustrated in FIGS. 26A-26V are for E17.5-old embryos, and a similar pattern is shown for E. coli. 14,5
, E15.5 and E17.5. Although a sense probe was used as a control, no consistent hybridization pattern was obtained for the section.

FIG. 26A shows an anterior section of the oral cavity at the level of the tooth germ vesicle (t). The arrow is
The site of PDGF-C expression in the oral ectoderm is shown. Further, a tongue (to) is also shown. Figures 26B-D show PDGF- in developing tooth duct epithelial cells.
Shows C expression. Individual cells have this region (arrows in FIG. 26D) and
It is strongly labeled with the developing palatal ectoderm (right arrow in FIG. 26C).
FIG. 26E shows an anterior section of the eye, where PDGF-C expression is found in hair follicles (double arrow) and in developing eyelids. The retina (r) is also shown. FIG.
In F and 26G, PDGF-C expression is found on the outer root sheath of developing hair follicle epithelial cells. In FIG. 26H, PDGF-C expression is shown on developing eyelids. There is the appearance of individual strong PDGF-C positive cells in the developing orifice.
The lens (l) is also shown. In Figure 26I, PDGF in the developing lacrimal gland
-C expression is indicated by the arrow. In Figure 26J, P in the developing outer ear
DGF-C expression is illustrated. Expression is seen in the external auditory canal (left arrow) and in the epithelial fissure (e) separating the future pinna. Figures 26K and 26L show PDGF-C expression in the cochlea. Expression is seen in the semicircular canal (26K arrow).
There is a polarized distribution of PDGF-mRNA in epithelial cells near developing hair cells (arrow 26L). Figures 26M and 26N show PDGF-C expression in the oral cavity. Horizontal cross-sections show expression in oral tissue (arrows in 26M) and formed fissures between lower lip and gingival epithelium (arrows in 26N). Tooth germ spore (t
) And tongue (to) are also shown. FIGS. 260 and 26P show PDGF-C expression in the developing nostrils shown in horizontal section. PDGF-C expression is most pronounced prior to epithelial growth and canal proper formation. The developing nares (n) are also shown. Figures 26Q-26S show PDGF-C expression in the developing salivary glands and salivary gland ducts. FIGS. 26R and 26S show the mandibular gland and salivary gland (
sg) and the salivary gland duct (sd). Figures 26T-26V show PDGF-C expression in the urogenital tract. FIG. 26T shows PDGF-C expression in the mesoderm of the developing renal metanephros. FIG. 26U shows PDGF-C expression in the urethra (ua) and epithelial tissue around the developing penis. FIG. 26V shows PDGF-C expression in the developing ureter (u).

[0118] Example 12: The one PDGF-C, expressed the strongest PDGF-C expression site of PDGF-A and PDGFR- Alpha over in kidney during development is the kidney during development, development developing kidney In which PDGF-C, PDGF-A and PDGFR-alpha expression were examined. FIGS. 27A-27F show mRNA expression (DIC optical) of PDGF-C (FIGS. 27A and 27B), PDGF-A (FIGS. 27C and 27D), and PDGFR-alpha (FIGS. 27E and 27F) in E16.5 kidney. Shows the results of non-radioactive in situ hybridization showing blue staining in a non-stained background visualized using. The hatched white lines in FIGS. 27B, 27D and 27F indicate the contours of the cortical boundary. The bars in FIGS. 27A, 27C and 27E are 25
0 μm, and 50 μm in FIGS. 27B, 27D and 27F.

PDGF-C expression is found in metanephros mesenchyme (mm in FIG. 27A), which is located on each side of the ureteric buds (ub), undergoing epithelial transformation in preparation for duct development. The growing condensed mesenchyme (arrow in FIG. 27B) appears to be upregulated. PDGF-C expression remains at low levels in early tubular epithelial aggregates (arrow B), but is absent in mature glomeruli (gl) and tubule structures.

[0120] PDGF-A expression is not found in these aggregates, but is stronger at later stages of duct development (FIGS. 24C and 24D). PDGF-A is expressed in early tubular epithelial aggregates (arrow 27D), but as nephrons develop further, PDGF-A
-A expression becomes restricted to the developing loop of Henle (arrows in Figure 27D).
The strongest expression is found in the loop of Henle in the developing marrow (arrow in FIG. 27C).
Branched ureters (u) and ureteric buds (ub) are negative for PDGF-A.

Thus, the expression patterns of PDGF-C and PDGF-A in developing nephrons differ spatially and temporally from one another. PDGF-C is expressed at the earliest stages during nephron development (mesenchymal aggregates), and PDGF-A is expressed at the final stages (Henle snare formation).

PDGFR-alpha is expressed throughout the developing mesenchyme of the kidney (FIGS. 27E and 27F) and is therefore targetable by both PDGF-C and PDGF-A. PDGF-B expression is also found in the developing kidney, but it occurs only in vascular endothelial cells. PDGFR-beta expression occurs in perivascular mesenchyme, and its activation by PDGFR-beta is essential for recruitment of glomerular stromal cells to glomeruli.

These results indicate that PDGF-C expression occurs in a spatial relationship close to the site of PDGFR-alpha expression, which is different from the expression sites of PDGF-A and PDGF-B. This is because PDGF-C is in vivo and PDGFR-
It acts through the alpha, indicating that PDGF-A and PDGF-B may have functions that are not available.

The unique expression pattern of PDGF-C in the developing kidney is that of PDGF-A
Or -B has a different function as a PDGFR-alpha agonist from that of PDGFR-alpha knockout mice (FIGS. 28B and 28F).
)), The tissues of the 16.5 day old kidney from wild type (FIGS. 28A and 28C), P
DGF-A knockout (FIG. 28D) and PDGF-A / PDGF-B double knockout (FIG. 28E) mice were compared. The bars in FIGS. 28A and 28B are 250 m
m and 50 μm in FIGS. 28C-28F.

Heterozygous variants of PDGF-A, PDGF-B, and PDGFR-alpha (Bostrom et al., Cell, 1996 85 863-8).
73; Levine et al., Genes Dev. , 1994 8
1875-1887; Soriano et al., Development.
, 1997 124 2691-70) were bred as C57B16 / 129sv hybrids and crossed to produce homozygous mutant embryos. PDGF-A / PDG
FB heterozygous mutants were crossed to produce double PDGF-A / PDGF-B knockout embryos. High lethality of PDGF-A-/-embryos before E10 (Bostrom et al., Cell, 1996 85 863-873).
According to the percentage of double knockout E16.5 embryos obtained from those crosses,
It was 1/40 or less. Tissues of the kidney phenotype were confirmed against at least two embryos of each genotype, except for the PDGF-A / PDGF-B double knockout, where only one embryo was obtained.

Lack of interstitial mesenchyme in PDGFR-alpha-/-kidney cortex (arrows in Figure 28A and asterisk in Figure 28F), and interstitial mesenchyme in all other genotypes. It is interesting that the weave is present (stars in FIGS. 28C-E). The bifurcated urethra (u) and the mesenchyme of the metanephros (mm) and their epithelial derivatives appear to be normal in all variants. The abnormal glomeruli of PDGF-A / PDGF-B double knockout are:
It reflects that glomerular melangium cells do not recruit into glomerular bundles due to the lack of PDGF-B.

These results indicate that PDGFR-alpha knockout indicates that PDGF-A
It has a renal phenotype not seen in DGF-A / PDGF-B knockouts, thus indicating loss of signaling by PDGF-C. This phenotype consists of a significant loss of interstitial mesenchyme in the developing renal cortex. Thus, cells lost in PDGFR-alpha-/-kidneys are
Normally PDGFR-alpha-positive cells in the vicinity of the DGF-C expression site.

Bioassay for Determining PDGF-C Function PDGF-C is useful for the growth and / or migration, angiogenesis, and damage of connective tissue cells, fibroblasts, myofibroblasts, and glial cells PDG in relation to treatment
FA, PDGF-B, VEGF, VEGF-B, VEGF-C and / or V
An assay is performed to evaluate if EGF-D has similar activity. Further assays can be performed based on the results of receptor binding distribution studies.

I. Mitogenicity of PDGF-C on endothelial cells To test the mitogenic potential of PDGF-C on endothelial cells,
The -C polypeptide is introduced into cell culture medium containing 5% serum and applied to bovine aortic endothelial cells (BAE) grown in medium containing 10% serum. These BAEs are pre-seeded in 24-well dishes at a density of 10,000 cells / well before addition to PDGF-C. Three days after addition of the polypeptide, cells were dissociated with trypsin and counted. In experiments, purified VEGF is included as a positive control.

II. Assay of Endothelial Cell Function a) Endothelial Cell Proliferation An endothelial cell growth assay is described, for example, in Ferrara and Henzel, Nature, 1989 380 439-443, Gospodarovicz, Proc. Natl. Ac
ad. Sci. USA, 1989 86 7311-7315 and / or Claffey et al., Biochem. Biophys. Acta, 19
95 1246 1-9.

B) Cell Adhesion Assay The effect of PDGF-C on the adhesion of polymorphonuclear granulocytes to endothelial cells is tested.

C) Chemotaxis To test the effect of PDGF-C on chemotaxis, a standard Boyden chamber chemotaxis assay (Boyden chamber chemotaxis) was used.
assay).

D) Plasminogen activator assay Endothelial cells were purified from Pepper et al., Biochem. Biophys.
Res. Commun. The effect of PDGF-C on plasminogen activator and plasminogen activator inhibitor production is tested using the method of GF, 1991 181 902-906.

E) Endothelial cell migration assay The ability of PDGF-C to stimulate endothelial cells to migrate and form lumens was determined by Montesano et al., Proc. Natl. Acad. Sci. U
The assay is performed as described in SA, 1986 83 7297-7301. Alternatively, EMBO J. et al., Joukov et al. , 1996 15 290-
298, or a gelatinized membrane (Glaser (Glaser) in a modified Boyden chamber).
er) et al., Nature, 1980 288 483-484).

III. Angiogenesis Assay The ability of PDGF-C to induce a vascular response in the chorionic chorioallantoic membrane was determined by the evaluation of Leung et al., Science, 1989 246 1306-1309.
Test as described in. Or, Rustinejad
The rat corneal assay of Cell, 1989 56 345-355 can be used, a method that has been accepted as an assay for in vivo angiogenesis, and the results have been used in other in vivo systems. It can be easily transferred.

IV. Injury Treatment The ability of PDGF-C to stimulate injury treatment was assessed by Schilling.
Surgery, 1959 46 702-710.
unt) et al., test in the most clinically relevant model available, as used in Surgary, 1967 114 302-307.

V. A variety of in vitro and in vivo assays using specific cell populations of the hematopoietic system are known, and are outlined below. In particular, various in vitro mouse stem cells using a fluorescence activated cell sorter are particularly convenient.

A) Repopulated stem cells These are cells capable of repopulating the bone marrow of lethally exposed mice, including Lin ⁻ , Rh ^h1 , Ly-6A / E ⁺ , c-kit ⁺ Has a phenotype. These cells are tested for PDGF-C alone or by co-incubation with other factors, after which cell proliferation is measured by ³ H-thymidine incorporation.

B) Late Stage Stem Cells These are cells that have relatively low bone marrow repopulation potential but are capable of producing D13 CFU-S. These ^{cells, Lin -, Rh h1, Ly} -6A / E +,
Has c-kit ⁺ phenotype. PDGF-C is incubated with these cells for a period of time, injected into lethally irradiated recipients, and the number of D13 spleen colonies is counted.

C) Precursor-enhanced cells These respond to a single growth factor in vitro and produce Lin ⁻ , Rh ^h1 , L
Cells with y-6A / E ⁺ , c-kit ⁺ phenotype. This assay uses the PD
It is to examine whether GF-C can act directly on hematopoietic progenitor cells. PDGF-C is incubated with these cells in agar culture and colonies are counted after 7-14 days.

VI. Atherosclerosis Smooth muscle cells play an important role in the development or initiation of atherosclerosis, which requires that its phenotype change from a contractile state to a synthetic state. Macrophages, endothelial cells, T lymphocytes, and platelets all play a role in atherosclerotic plaque development by affecting smooth muscle cell growth and phenotypic changes. The in vitro assay using a modified Rose chamber, in which various cell types are seeded on both sides of coverslips, measures the growth rate and phenotypic change of smooth muscle cells in a multicellular environment, Used to evaluate the effect of PDGF-C on smooth muscle cells.

VII. Metastasis The ability of PDGF-C to inhibit metastasis is described, for example, in Cao et al. E
xp. Med. , 1995 182 2069-2077, using a Lewis lung cancer model.

VIII. Smooth Muscle Cell Migration The effect of PDGF-C on smooth muscle cell and other cell type migration has been described by Koyama, J. et al. Biol. Chem. , 1992 267 228
06-22812.

IX. Chemotaxis PDGF-C for chemotaxis of fibroblasts, monocytes, granulocytes, and other cells
Are described in Siegbahn et al. Clin. Invest
. , 1990 85 916-920.

X. PDGF-C in other cell types The effect of PDGF-C on the proliferation, differentiation and function of other cell types, such as hepatocytes, cardiac and other cells, endocrine cells, and osteoblasts, is demonstrated in vitro. It can be easily evaluated by a known method such as incorporation of ³ H-thymidine by culturing. PDGF-C expression in these and other tissues can be measured by methods such as Northern blotting and hybridization, or in situ hybridization.

XI. Structure of PDGF-C Variants and Analogs PDGF-C is a member of the PDGF family growth factor that shows a high degree of homology to other members of the PDGF family. PDGF-C contains eight conserved cysteine residues that are characteristic of this family of growth factors. These conserved cysteine residues form intrachain disulfide bonds that create cysteine knot structures characteristic of PDGF family growth factor members and interchain disulfide bonds that form protein dimers. PDGF-C interacts with the protein tyrosine kinase growth factor receptor.

Unlike proteins that have little or no knowledge of their protein structure and active site required for receptor binding and subsequent activity, the composition of active mutants of PDGF-C is a member of the PDGF family of growth factors. This is greatly facilitated by the fact that a lot is known about the active site and important amino acids.

For published articles disclosing the structure / activity relationships of members of the PDGF family of growth factors, see, for example, Oestman et al. Biol. Chem. , 1991 266 10073-10077;
J. Anderson et al. Biol. Chem. , 1992
267 11260-1266; Effner et al., EMBO. J
. , 1992 11 3921-3926; Flemming et al., Molecular and Cell Biol. , 1993 13 40
66-4076 and Anderson et al., Growth F.
actors, 1995 12 159-164; and for VEGF,
Kim (Kim), etc., Growth Factors, 1992 7 53-64
J. Petgens et al. Biol. Chem. , 1994 2
69 32879-32885 and Claffey et al., Bioc.
hem. Biophys. Acta, 1995 1246 1-9. From these publications, by virtue of the eight conserved cysteine residues, members of the PDGF family of growth factors exhibit characteristic knot folds and dimerization, which places the active receptor binding site. It is clear that three exposed loop regions are formed at each end of the dimerizing molecule, which can be predicted as:

Based on this information, one of skill in the art would be able to conserve the eight cysteine residues responsible for the knot fold configuration and dimerization, as well as for loop 1, loop 2 and loop 3 of the protein structure. By conserving amino acid substitutions conserved in the predicted receptor sequence of the region, or by making them only,
PDGF-C variants with a very high probability of retaining DGF-C activity can be constructed.

[0150] Desired mutant form at a specifically targeted site in the protein structure
Is considered a standard technique in the ability of protein chemists (Kunke
Kunkel et al., Methods in Enzymol. , 1987 154 367-382). Implementation of such site-directed mutagenesis with VEGF
Examples are described in Petgens et al. Biol. Chem. , 1994
 269 32879-32885 and Claffey et al., Bi
ochem. Biophys. Acta, 19951246 See 1-9
You. In fact, site-directed mutations are so common that they are
Kits for facilitation are commercially available (eg, Promega 1994).
-1995 catalog. , P142-145).

The activity of connective tissue cells, fibroblasts, myofibroblasts and glial cell proliferation and / or migration, endothelial cell proliferation, angiogenesis and / or injury healing activities of PDGF-C variants is well known. Can be easily confirmed by the screening method. For example, Claffey et al. (Biochem. Biophy)
s. Acta, 1995 1461 1-9). Similar methods can be used for the endothelial cell mitogenesis assay. Similarly, the effects of PDGF-C on proliferation, cell differentiation, and human mutation of other cell types can be tested using well-known methods.

The foregoing description and specific examples have been set forth merely to illustrate the invention and are not limiting. The present invention contemplates all such modifications within the scope of the accompanying clones and their equivalents, as those skilled in the art will envision such modifications of the disclosed embodiments which include the spirit and essence of the invention. Must be widely interpreted as including.

[Sequence list]

[Brief description of the drawings]

FIG. 1 (SEQ ID NO: 2) shows the complete nucleotide sequence (2108 bp) of the cDNA encoding human PDGF-C (hPDGF-C).

FIG. 2 (SEQ ID NO: 3) shows full length hPDGF-C consisting of 345 amino acid residues
(A translation site of the cDNA corresponds to nucleotides 37 to 1071 in FIG. 1)

FIG. 3 (SEQ ID NO: 4) shows a cDNA encoding a fragment of human PDGF-C (hPDFG-C) (1536 bp)

FIG. 4 (SEQ ID NO: 5) shows the deduced amino acid sequence of a fragment of hPDGF-C (translation of nucleotides 3-956 of the nucleotide sequence of FIG. 3).

FIG. 5 (SEQ ID NO: 6) shows the nucleotide sequence of mouse PDGF-C (mPDGF-C) cDNA.

FIG. 6 (SEQ ID NO: 7) shows the deduced amino acid sequence of the fragment of mPDGF-C (the translated portion of the cDNA corresponding to nucleotides 196-1233 in FIG. 5).

FIG. 7 shows the amino acid sequence of hPDGF-C in FIG. 2 (SEQ ID NO: 3) and FIG. 6 (SEQ ID NO: 7).
FIG. 7 shows a comparative sequence alignment with the mPDGF-C amino acid sequence

FIG. 8: Signal sequence (hatched box) and N-terminal C1r / C1s / fetal sea urchin Ueg
f / bone morphogenetic protein 1 (CUB) domain and C-terminal PDGF / VEGF
The figure which shows the schematic structure of mPDGF-C provided with a homology domain (open box)

FIG. 9 shows comparative sequence alignments of the PDGF / VEGF-homology domains of human and mouse PDGF-C with other members of the VEGF / PDGF family of growth factors (SEQ ID NOs: 8-17, respectively).

FIG. 10 is a diagram showing a phylogenetic tree of several growth factors belonging to the VEGF / PDGF family.

FIG. 11. CUB domain present in human and mouse PDGF-C (SEQ ID NOs: 18 and 19, respectively) and another CUB domain present in human bone morphogenetic protein 1 (hBMP-1,3 CUB domain CUB1-3) (Each sequence ID No. 20
-22) and human neuropilin-1 (2 CUB domain) (SEQ ID NOS: 22 and 24, respectively).

FIG. 12 shows Northern blot analysis of PDGF-C transcript expression in multiple human mRNA tissues.

FIG. 13 shows the regulation of PDGF-C mRNA expression by hypoxia.

FIG. 14 shows the expression of PDGF-C in a human tumor cell line.

FIG. 15 shows the results of immunoblot detection of full-length human PDGF-C in transfected COS-1 cells.

FIG. 16 shows the isolation and partial characterization of full-length PDGF-C.

FIG. 17 shows a truncated human PDGF containing only the PDGF / VEGF homology domain.
Diagram showing isolation and partial characterization of -C

FIG. 18 provides a standard curve for binding of labeled PDGF-BB homodimers to PAE-1 cells expressing PDGF alpha receptor.

FIG. 19 provides a graph showing suppression of binding of labeled PDGF-BB to PAE-1 cells expressing PDGF alpha receptor by increasing the amount of purified full-length and truncated PDGF-C protein.

FIG. 20 shows the effect of full-length and truncated PDGF-CC homodimers on PDGF alpha receptor phosphorylation.

FIG. 21 shows the mitogenic activity of full-length and truncated PDGF-CC homodimers on fibroblasts.

FIG. 22 graphically provides the results of a binding assay of truncated PDGF-C to the PDGF receptor.

FIG. 23 shows an immunoblot of undigested full-length PDGF-C protein and plasmin-producing 26-28 kDa species.

FIG. 24 graphically provides the results of a competitive binding assay of full-length PDGF-C and truncated PDGF-C to the PDGF-alpha receptor.

FIG. 25: SDS-PAG of human PDGF-CUB domain under reducing and non-reducing conditions
Diagram showing analysis by E

FIG. 26 shows PDGF-C expression in developing mouse embryos.

FIG. 27 shows PDGF-C, PDGF-A and PDGFR-alpha expression in the developing kidney.

28A-28F show wild-type (FIGS. 28A and 28C), PDGFR-alpha-/-(FIGS. 28B and 28F, PDGF-A-/-(FIG. 28D) and PDG
FIG. 28E is a view showing a histological image of E16.5 kidney from FA / PDGF-B double-/-(FIG. 28E) kidney.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61P 1/16 A61P 17/02 4C086 11/00 35/00 4H045 13/12 43/00 105 17/02 C07K 14/49 35/00 14/71 43/00 105 16/22 C07K 14/49 C12N 1/15 14/71 1/19 16/22 1/21 C12N 1/15 C12P 21/02 H 1/19 C12Q 1 / 68 A 1/21 C12P 21/08 5/06 C12N 15/00 ZNAA 5/10 5/00 B C12P 21/02 E C12Q 1/68 A61K 37/02 // C12P 21/08 37/24 (31) Priority claim number 60/110, 749 (32) Priority date December 3, 1998 (1998.12.3) (33) Priority claim country United States (US) (31) Priority claim number 60/113, 002 (32) Priority date December 18, 1998 (December 18, 1998) (33) Priority claiming country United States ( (US) (31) Priority claim number 60 / 135,426 (32) Priority date May 21, 1999 (May 21, 1999) (33) Priority claim country United States (US) (31) Priority claim No. 60 / 144,022 (32) Priority date July 15, 1999 (July 15, 1999) (33) Priority country United States (US) (81) Designated country EP (AT, BE, CH, CY) , DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW) , ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, SD, SL, SZ, TZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AU, BA, BB, BG, BR, CA, CN, CU, CZ, EE, GD, HR, HU, ID, IL, IN, I S, JP, KP, KR, LC, LK, LR, LT, LV, MG, MK, MN, MX, NO, NZ, PL, RO, RU, SG, SI, SK, SL, TR, TT, UA (71) Applicant 605 THIRD AVENUE, NEW YORK, NEW YORK 10158, UNITED STATES OF AM ERICA (72) Inventor Ericsson, Wolf Sweden Es-17177 Stockholm Doctor Slingen 12 Di Vicks Institut for Cancer Research Karolinska Institute (72) Inventor Arse, Karin Sweden S-17177 Stockholm Doctorslingen 12 Di Box 240 Ludwig Institut for Cancer Research Karolin Ka Institut (72) Inventor Li, Shri Sweden S-17177 Stockholm Doctor Slingen 12di Box 240 Ludwig Institute for Cancer Research Karolinska Institut (72) Inventor Ponten, Annika Sweden S-17177 Stockholm Doctorslingen 12 dibox 240 Ludwig Institute for Cancer Research Karolinska Institute (72) Inventor Outera, Marko Finland FFI-00710 Helsinki Viikinkarli 6. Within Helsinki University Licensing Limited (72) Inventor Alitaro, Cali Finland FFIN-00710 Helsinki Viikincali In Helsinki University Licensing Limited (72) Inventor Estmann, Arne Sweden S-17177 Stockholm Doctorslingen 12 di Box 240 240 Ludwig Institute for Cancer Research Karolinska Institute (72) Inventor Heldin, Karl-Henrik Sweden S-17177 Stockholm Doctor Slingen 12di Box 240 Ludwig Institute for Cancer Research Karolinska Institute (72) Inventor Betscholz, Christer Sweden S- 40530 Goeborg Box 440 Goeborg University Department of Biochemistry F-term (reference) 4B024 AA01 AA1 2 BA36 CA04 HA14 4B063 QA01 QA08 QA19 QQ02 QQ53 QQ58 QR32. MA04 NA14 ZA59 ZA75 ZA81 ZA89 ZB21 ZB26 4H045 AA10 AA11 AA20 AA30 BA10 CA40 DA20 DA50 DA76 EA28 EA51 FA74

Claims (74)

[Claims] 1. An isolated nucleic acid molecule having a polynucleotide sequence having at least 85% identity to the sequence of FIG. 1, 3 or 5 (SEQ ID NOs: 2, 4 and 6, respectively). 2. The isolated nucleic acid molecule of claim 1, wherein said sequence identity is at least 90%. 3. The isolated nucleic acid molecule of claim 1, wherein said sequence identity is at least 95%. 4. The isolated nucleic acid molecule of claim 1, wherein said nucleic acid is a cDNA. 5. The isolated nucleic acid molecule of claim 1, wherein said nucleic acid is a mammalian polynucleotide. 6. The isolated nucleic acid molecule of claim 5, wherein said nucleic acid is a mouse polynucleotide. 7. The isolated nucleic acid molecule of claim 6, having the sequence of FIG. 5 (SEQ ID NO: 6). 8. The isolated nucleic acid molecule of claim 5, wherein said nucleic acid is a human polynucleotide. 9. The isolated nucleic acid molecule of claim 8, having the sequence of FIG. 1 or 3 (SEQ ID NOs: 2 and 4, respectively). 10. An amino acid sequence having at least 85% identity with the amino acid sequence of FIG. 2 (SEQ ID NO: 3) or the amino acid sequence of FIG. 4 (SEQ ID NO: 5),
Alternatively, an isolated nucleic acid molecule encoding a polypeptide molecule encoding a fragment or analog thereof having PDGF-C biological activity. 11. The isolated nucleic acid molecule of claim 10, wherein said amino acid sequence identity is at least 90%. 12. The isolated nucleic acid molecule of claim 10, wherein said amino acid sequence identity is at least 95%. 13. An isolated nucleic acid molecule encoding a polypeptide having the amino acid sequence PXCXXVXRCGGXXXCC (SEQ ID NO: 1). 14. The vector comprising the nucleic acid of claim 1, wherein said nucleic acid is operably linked to a promoter sequence. 15. The vector of claim 14, wherein said vector is a eukaryotic vector. 16. The vector of claim 14, wherein said vector is a prokaryotic vector. 17. The vector of claim 14, wherein said vector is a plasmid. 18. The vector of claim 14, wherein said vector is a baculovirus vector. 19. an amino acid sequence having at least 85% identity to the amino acid sequence of FIG. 2 (SEQ ID NO: 3) or the amino acid sequence of FIG. 6 (SEQ ID NO: 7);
Alternatively, a method for making a vector expressing a polypeptide having a fragment or analog thereof having PDGF-C biological activity, wherein the method comprises:
14. A method for producing a vector, comprising the step of introducing the isolated nucleic acid of claim 10 or 13 into the vector in a state operably linked to a promoter. 20. A host cell transformed or transfected with the vector of claim 14. 21. The host cell of claim 20, wherein said host cell is a eukaryotic cell. 22. The host cell of claim 20, wherein said host cell is a COS cell. 23. The host cell of claim 20, wherein said host cell is a prokaryotic cell. 24. The host cell of claim 20, wherein said host cell is a 293EBNA cell. 25. The host cell of claim 20, wherein said host cell is an insect cell. 26. A host cell transformed or transfected with the vector comprising the nucleic acid molecule of claim 1, wherein the host cell is the amino acid sequence of FIG. 2 (SEQ ID NO: 3) or the amino acid sequence of FIG. Operably linked to a promoter to express a polypeptide having an amino acid sequence having at least 85% identity to (SEQ ID NO: 7), or a fragment or analog thereof having PDGF-C biological activity. A host cell transformed or transfected with a vector comprising the nucleic acid molecule of claim 1. 27. an amino acid sequence having at least 85% identity to the amino acid sequence of FIG. 2 (SEQ ID NO: 3) or the amino acid sequence of FIG. 6 (SEQ ID NO: 7);
Alternatively, an isolated polypeptide having a fragment or analog thereof having PDGF-C biological activity. 28. The polypeptide of claim 2, wherein said polypeptide is a mouse polypeptide.
7. The isolated polypeptide of 7. 29. The polypeptide of claim 27, wherein said polypeptide is a human polypeptide.
Isolated polypeptide. 30. The polypeptide of claim 27, wherein the polypeptide has the ability to stimulate and / or enhance proliferation and / or differentiation and / or growth and / or migration of cells that express the PDGF-C receptor. An isolated polypeptide. 31. FIG. 1, 3 or 5 (sequence identification number 2, 4 or 6 respectively)
An isolated polypeptide produced by the expression of a polynucleotide having a polynucleotide sequence having at least 85% identity to a polynucleotide or a polynucleotide that hybridizes under stringent conditions to at least one of the above DNA sequences. 32. An isolated polypeptide having the characteristic sequence PXCXXVXRCGGXXXCC (SEQ ID NO: 1). 33. An isolated polypeptide dimer having the polypeptide of claim 27. 34. The isolated polypeptide dimer of claim 33, wherein said polypeptide dimer is a homodimer of said polypeptide. 35. The polypeptide dimer, wherein the polypeptide and VE
GF, VEGF-B, VEGF-C, VEGF-D, PDGF-A, PDGF-
34. The isolated polypeptide dimer of claim 33, which is a heterodimer with B or PlGF. 36. The isolated polypeptide dimer of claim 33, wherein said polypeptide dimer is a disulfide-linked dimer. 37. An effective cell growth promoting amount of the polypeptide of claim 27, 31 or 32, and VEGF, VEGF-B, VEGF-C, VEGF-D.
, PDGF-A, PDGF-B or PlGF and at least one other growth factor. 38. The pharmaceutical composition of claim 37, further comprising heparin. 39. A pharmaceutical composition comprising an effective cell growth promoting amount of the isolated polypeptide of claim 27, 31 or 32 and at least one pharmaceutical carrier or diluent. 40. A pharmaceutical composition comprising a PDGF receptor stimulating amount of the isolated polypeptide of claim 27, 31 or 32 and at least one pharmaceutical carrier or diluent. 41. An effective connective tissue or injury treatment stimulating amount.
A pharmaceutical composition comprising one or the isolated polypeptide of claim 32 and at least one pharmaceutical carrier or diluent. 42. A means for amplifying the polynucleotide of claim 1 in a test sample, said means having at least one pair of primers complementary to the nucleic acid of claim 1. Means for amplifying the polynucleotide of claim 1. 43. A means for amplifying the polynucleotide of claim 1 in a test sample, said means comprising a polymerase and at least one pair of primers complementary to the nucleic acid of claim 1. 2. A means for amplifying the polynucleotide of claim 1 in a test sample, wherein the polynucleotide is amplified by a polymerase chain reaction to facilitate sequence comparison between the polynucleotide and the nucleic acid of claim 1. 44. An antibody which specifically reacts with the polynucleotide according to claim 27, 31 or 32. 45. The antibody of claim 44, wherein said antibody is a polyclonal antibody. 46. The antibody, wherein the antibody is a monoclonal antibody or F (ab ′) ₂ ,
45. The antibody of claim 44 which is an F (ab '), F (ab) fragment or a chimeric antibody. 47. The antibody of claim 45, wherein said antibody is labeled with a detectable label.
Or 46 antibodies. 48. The detectable label is a radioactive isotope.
7. Antibody. 49. A method of making the polypeptide of claim 27, 31 or 32, wherein the polypeptide is operably linked to a promoter sequence such that the nucleic acid sequence encoding the polypeptide is expressed. Culturing a host cell transformed or transfected with a vector having a polynucleotide encoding the polypeptide, and the polypeptide from the host cell or from a growth medium in which the host cell is cultured. 33. A method for producing the polypeptide of claim 27, 31 or 32, comprising the step of isolating. 50. The method according to claim 27, 31 or 3 for a mammal.
A method for stimulating the treatment of connective tissue growth or damage in said mammal, comprising the step of administering an effective amount of the second polypeptide. 51. A method for producing an active truncated form of PDGF-C, comprising a step of expressing an expression vector having a polynucleotide encoding the polypeptide of claim 69. 52. A method for regulating the receptor binding specificity of PDGF-C, comprising the steps of: expressing an expression vector having a polynucleotide encoding the polypeptide of claim 27, 31 or 32; Supplying the at least one enzyme that processes the expressed polypeptide in a proteolytic amount to produce the active-cleavable PDGF-C. 53. A method for selectively activating a polypeptide having growth factor activity, comprising: a polynucleotide encoding a polypeptide having growth factor activity; a CUB domain; the polypeptide and the CUB domain; Expressing an expression vector having a proteolytic site between the two, and providing the proteolytic amount of at least one enzyme for processing the expressed polypeptide to produce the active polypeptide having a growth factor activity. Having,
A method for selectively activating a polypeptide having growth factor activity. 54. The isolated polypeptide of claim 27, 31 or 32, having a proteolytic site having the amino acid sequence RKSR or a structurally conserved amino acid sequence thereof. 55. The isolated nucleic acid molecule of claim 10, which encodes a polypeptide having a proteolytic site having the amino acid sequence RKSR or a structurally conserved amino acid sequence thereof. 56. VEGF, VEGF-B, VEGF-C, VEGF-D,
An active monomer of PDGF-C, PDGF-A, PDGF-B or PlGF;
An isolated heterodimer having an active monomer of PDGF-C bound to a UB domain. 57. A monomer bound to PDGF-C and bound to the CUB domain.
VEGF, VEGF-B, VEGF-C, VEGF-D, PDGF-C, PDG
Or an activating monomer of FA, PDGF-B or PlGF. 58. The isolated heterodimer of claim 56, further comprising a proteolytic site between said active monomer and said CUB domain binding. 59. The isolated heterodimer of claim 57, further comprising a proteolytic site between said active monomer and said CUB domain binding. 60. FIG. 1, 3 or 5 (sequence identification number 2, 4 or 6 respectively)
Or an isolated polypeptide having a polynucleotide that hybridizes under stringent conditions to at least one of the above DNA sequences. 61. The method according to claim 27, 31 or 3 for a mammal.
2. A method for promoting fibroblast mitosis in said mammal, comprising the step of administering an effective fibroblast mitosis amount of the polypeptide of item 2 above. 62. The method according to claim 27, 31 or 3 for a mammal.
2. A method for inducing PDGF alpha receptor activity in said mammal, comprising administering the polypeptide of (2) in a PDGF alpha receptor stimulating amount. 63. A method for suppressing tumor growth of a PDGF-C-expressing tumor in a mammal, comprising the step of administering to the mammal a PDGF-C inhibitory amount of a PDGF-C antagonist. 64. A method for identifying a specific type of human tumor, comprising the steps of taking a sample of said tumor and testing for expression of PDGF-C. how to. 65. The specific type of tumor is choriocarcinoma, Wilms tumor,
65. The method of claim 64, wherein the method is selected from the group consisting of myelomegaloblast leukemia, lung cancer, and erythroleukemia cells. 66. A method for identifying a PDGF-C antagonist, comprising: mixing a substantially purified preparation of activated truncated PDGF-C with a test agent; and A method for identifying a PDGF-C antagonist, comprising monitoring inhibition of PDGF-C biological activity. 67. A method for identifying a PDGF-C antagonist, comprising mixing a substantially purified preparation of full-length PDGF-C with a test agent, and removing the PDGF-C from the PDGF-C by any suitable means. A method of identifying a PDGF-C antagonist, comprising the step of monitoring the inhibition of cleavage of the CUB domain of the present invention. 68. The isolated polypeptide of claim 27, wherein said cells are selected from the group consisting of endothelial cells, connective tissue cells, myofibroblasts and glial cells. 69. A vector expressing a polypeptide having an amino acid sequence having at least 85% identity to amino acid residues 230-345 of FIG. 2 (SEQ ID NO: 3) or FIG. 6 (SEQ ID NO: 7). Figure 2 (SEQ ID NO: 3) or Figure 6 (SEQ ID NO: 3) comprising the step of introducing an isolated nucleic acid molecule encoding the amino acid residue into the vector in operable linkage with a promoter. 7
A) expressing a polypeptide having an amino acid sequence having at least 85% identity to amino acid residues 230 to 345); 70. The monoclonal antibody according to claim 46, wherein the monoclonal antibody is a humanized antibody.
Antibodies. 71. A method for producing activated truncated PDGF-C, comprising the steps of: expressing an expression vector having a polynucleotide encoding the polypeptide of claim 27, claim 31, or claim 32; Providing at least one enzyme for processing a peptide in a proteolytic amount to produce the activated truncated PDGF-C.
How to make. 72. A method for suppressing tissue remodeling in tumor cell invasion into a normal population of cells, comprising the step of administering a PDGF-C inhibitory amount of a PDGF-C antagonist to a mammal. 73. A method of treating a fibrotic condition in a mammal in need thereof, comprising administering to said mammal a PDGF-C inhibitory amount of a PDGF-C antagonist. A method of treating a fibrotic condition in a mammal in need thereof. 74. The method of claim 73, wherein said fibrotic condition is found in lung, kidney or liver.