CN1318100A - New human hepatoma-derived growth factor encoding sequence and polypeptide encoded by such DNA sequence and producing method thereof - Google Patents

Abstract

The invention provides a cDNA sequence of a new type II human hepatoma derived growth factor (HDGF2). The protein encoded by such sequence is a homology of type I HDGF. The present invention also relates to peptides encoded by the nucleotide sequences, to uses to these polynucleotides and the polypeptides, and methods for producing the said polynucleotides and the polypeptides.

Description

New human hepatoma-derived growth factor encoding sequence and polypeptide encoded by such DNA sequence and producing method thereof

New human hepatome derivative growth factor coded sequence,

Its polypeptide encoded and preparation method invention field

The present invention relates to genetic engineering field, in particular it relates to a kind of new human gene nucleotide sequence.It is more particularly related to the cDNA sequences of new II types human hepatome derivative growth factor (HDGF2), the albumen is I types HDGF homologue.The invention further relates to the production method background technologies by the nucleotide sequence coded polypeptide, the application of these polynucleotides and polypeptide, and the polynucleotides and the polypeptide

Research is it has been shown that the regulation of cell growth is realized by a series of cascade reactions triggered after the film surface receptor effect special with it of various cell factors.In tumour cell, the out of control of some cascade reactions causes cell to continue to multiply.In liver cancer cells, it has been found that some autocrines and the paracrine cell factor (Proc. Natl. Acad. Sci. 83:2448-2452, 1986； Proc. Natl. Acad. Sci. 86:7432-7436, 1989； Cell 61 : 1137-1146, 1990).Hepatome derivative growth factor (HDGF) is the cell factor found in the human liver cancer cell strain HuH-7 of free serum culture, and it has heparin affinity and the DNA of Swiss 3T3 cells can be stimulated to synthesize (J. Biol. Chem. 269 (40):25143-25149, 1994).

Nakamura in 1989 et al. partial purification and identifies HDGF (Clin. Chim. Acta. 183 from HuH-7 cells first:273-284,1989), the experimental group in 1994 has completely cloned HDGF cDNA sequence again（J. Biol. Chem. 269(40):25143-25149,1994), the experimental group in 1997 have found HDGF homologue in mouse and be found that another two member HRP-1, HRP-2 of the gene family, and they all have the amino terminal sequence of 98 amino acid long quite guarded（Biochem. Biophys. Res. Commun. 238:26-32, 1997).Before the present invention comes forth, still nobody is disclosed another mankind HDGF family members human hepatoma-derived growth factor 2 being related in the application.Summary of the invention

It is an object of the present invention to provide a kind of new polynucleotide sequence, polynucleotide sequence coding HDGF homologous proteins, HDGF homologous genes of the invention are named as human hepatoma-derived growth factor 2.

It is a further object to provide a kind of new albumen, the albumen is named as human hepatoma-derived growth factor 2.

It is also another object of the present invention to provide a kind of method of the described new albumen of human hepatoma-derived growth factor 2 of utilization recombinant technique production.

Present invention also offers the application of this gene order of human hepatoma-derived growth factor 2 and albumen. In one aspect of the invention there is provided a kind of DNA molecular isolated, it includes：The nucleotide sequence of polypeptide of the coding with the protein active of human hepatoma-derived growth factor 2, described nucleotide sequence and SEQ ID NO:Shown in 3 from the nucleotides sequence of 121-732, nucleotides at least 70% homology；Or described nucleotide sequence can under medium stringency conditions with SEQ ID NO:From the nucleotide sequence hybridization of 121-732, nucleotides in 3.It is preferred that the described polypeptide of sequential coding one, the polypeptide has SEQ ID NO:Sequence shown in 4.More preferably, the sequence has SEQ ID NO:From the nucleotide sequence of 121-732, nucleotides in 3.

In another aspect of this invention there is provided a kind of HDGF2 polypeptides of separation, it includes：With SEQ ID NO:The polypeptide of 4 amino acid sequences or its active fragment, or its reactive derivative.It is preferred that the polypeptide is with SEQ ID NO:The polypeptide of 4 sequences.

In another aspect of this invention there is provided a kind of carrier, it contains the above-mentioned DNA. isolated

There is provided a kind of host cell of the carrier conversion in another aspect of this invention.

In another aspect of this invention there is provided a kind of method for producing the polypeptide with HDGF2 protein actives, this method includes：

(a) nucleotide sequence for encoding the polypeptide with HDGF2 protein actives is operably coupled to expression regulation sequence, forms HDGF2 protein expression vectors, described nucleotide sequence and SEQ ID NO:Shown in 3 from the nucleotides sequence of 121-732, nucleotides at least 70% homology；

(b) expression vector in step (a) is transferred to host cell, forms the recombinant cell of HDGF2 albumen；

(c) under conditions of expression HDGF2 polypeptides are adapted to, the recombinant cell in incubation step (b)；(d) polypeptide with HDGF2 protein actives is isolated.

In one embodiment of the invention, the polynucleotides total length of separation of the invention is 1024 nucleotides, and its detailed sequence is shown in SEQ ID NO:3, wherein open reading frame is located at 121-732 nucleotides.

In the present invention, " separation ", " purifying " or " substantially pure " DNA refer to, the DNA or fragment are separated from the sequence of its both sides is located under native state, also refer to the DNA or fragment to separate with the component under native state with nucleic acid, and with being separated in cell with its protein.

In the present invention, term " HDGF2 albumen (or polypeptide) coded sequence " refers to the nucleotide sequence of polypeptide of the coding with HDGF2 protein actives, such as SEQ ID NO:121-732 nucleotide sequences and its degenerate sequence in 3.The degenerate sequence refers to, positioned at SEQ ID NO:In 121-732 nucleotides of encoder block of 3 sequences, have one or more codons be encoded after the degenerate codon of same amino acid replaces produce sequence, due to the degeneracy of codon, thus with SEQ ID N 〇：The degenerate sequence of 121-732 nucleotide sequence homologies as little as about 70% can also encode out SEQ ID NO in 3:Sequence described in 4.The term also includes can be under medium stringency conditions, more preferably, with SEQ ID NO under high stringency conditions:From the nucleotides sequence of 121-732, nucleotides in 3 Arrange the nucleotide sequence of hybridization.In addition, the term also includes and SEQ ID NO:From homology at least 70 % of the nucleotide sequence of 121-732, nucleotides in 3, preferably at least 80 %, more preferably at least 90 % nucleotide sequence.

The term also includes that albumen, SEQ ID NO with the identical function of human hepatoma-derived growth factor 2 can be encoded:The variant form of open reading frame sequence in 3.These variant forms include (but being not limited to)：Several (are usually 1-90, preferably 1-60, more preferably 1-20, most preferably 1-10) missing of nucleotides, insertion and/or replace, and several in the addition of 5 and/or 3 ends (is usually within 60, within preferably 30, more preferably within 10, most preferably within 5) nucleotides.

In the present invention, " substantially pure " protein or polypeptide refer to that it at least accounts for sample total material at least 20%, preferably at least 50%, more preferably at least 80%, most preferably at least 90% (based on dry weight or weight in wet base).Purity can be measured with any suitable method, and the purity of polypeptide is such as measured with column chromatography, PAGE or HPLC methods.Substantially pure polypeptide is substantially free of its adjoint component under native state.

In the present invention, term " HDGF2 polypeptides " refers to the SEQ ID NO with HDGF2 protein actives:The polypeptide of 4 sequences.The term also includes having and the identical function of human hepatoma-derived growth factor 2, SEQ ID NO:The variant form of 4 sequences.These variant forms include (but being not limited to)：Several (are usually 1-50, preferably 1-30, more preferably 1-20, most preferably 1-10) amino acid lacks, inserts people and/or substitution, and it (is usually within 20 to add one or several in C-terminal and/or N-terminal, within preferably 10, more preferably within 5) amino acid.For example, in the art, when being replaced with similar nature or similar amino acid, will not generally change the function of protein.Again such as, the function of protein will not generally also be changed by adding one or several amino acid in C-terminal and/or N-terminal.The term also includes the active fragment and reactive derivative of HDGF2 albumen.

The variant form of the polypeptide includes：Homologous sequence, allelic variant, natural mutation, induced mutants, many peptide or proteins that can be obtained under high or low stringency conditions with the albumen coded by the DNA of HDGF2 DNA hybridization and using the antiserum of anti-HDGF2 polypeptides.Present invention also offers other polypeptides, the fusion protein such as comprising HDGF2 polypeptides or its fragment.In addition to the almost polypeptide of total length, present invention includes the soluble fragments of HDGF2 polypeptides.Generally, the fragment has at least about 10 continuous amino acids of HDGF2 peptide sequences, typically at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, most preferably at least about 100 continuous amino acids.

Invention also provides the analog of HDGF2 albumen or polypeptide.The difference of these analogs and natural HDGF2 polypeptides can be difference on amino acid sequence or not influence the difference on the modified forms of sequence, or have both at the same time.These polypeptides include natural or induction genetic variant.Induction variant can be obtained by various technologies, such as by radiating or exposed to mutagens producing random mutagenesis, can also by site-directed mutagenesis or The technology of other known molecular biology.Analog also includes the analog with the residue (such as D- amino acid) different from natural L-amino acids, and the analog with non-naturally occurring or synthesis amino acid (such as, Y-amino acid).It should be understood that the polypeptide of the present invention is not limited to the above-mentioned representational polypeptide enumerated.

Modification (not changing primary structure generally) form includes：Chemically derived the form such as acetylation or carboxylated of inner or in vitro polypeptide.Modification also includes glycosylation, and such as those carry out polypeptide that is glycosylation modified and producing in the synthesis and processing of polypeptide or in progressive procedure of processing.This modification can be by the way that polypeptide be completed exposed to the glycosylated enzyme (glycosylase or deglycosylating enzyme of such as mammal) of progress.Modified forms also include the sequence with phosphorylated amino acid residue (such as phosphotyrosine, phosphoserine, phosphothreonine).Also include being modified improving its anti-proteolysis performance or optimizing the polypeptide of solubility property.

Present invention additionally comprises the antisense sequences of HDGF2 polypeptid coding sequences.This antisense sequences can be used for the expression for suppressing intracellular HDGF2.

Present invention additionally comprises the nucleic acid molecules that can be used as probe and primer, the molecule generally has the 8- 100 of HDGF2 polypeptid coding sequences, preferably 15-50 continuous nucleotide.The probe can be used for the nucleic acid molecules with the presence or absence of coding HDGF2 in detection sample.

Present invention additionally comprises the method for detection HDGF2 nucleotide sequences, it includes being hybridized with above-mentioned probe and sample, and then whether detection probe there occurs combination.It is preferred that the sample is the product after PCR amplifications, wherein pcr amplification primer thing corresponds to the coded sequence of HDGF2 polypeptides, and can be located at the both sides or centre of the coded sequence.Primer length is generally 20-50 nucleotides,

In the present invention, various carriers known in the art, such as commercially available carrier be can select.

In the present invention, term " host cell " includes prokaryotic and eukaryotic.The example of conventional prokaryotic host cell includes Escherichia coli, hay bacillus etc..Conventional eukaryotic host cell includes yeast cells, insect cell and mammalian cell.It is preferred that the host cell is eukaryotic, such as Chinese hamster ovary celI, COS cells.

On the other hand, there is specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody present invention additionally comprises the polypeptide to HDGF2 DNA or its fragment coding.Here, " specificity " refers to that antibody can be incorporated into HDGF2 gene outcomes or fragment it is preferred that referring to those can be combined but nonrecognition and the antibody for being incorporated into other non related antigen molecules with HDGF2 gene outcomes or fragment.Antibody, which includes those, in the present invention can be combined and suppress the molecule of HDGF2 albumen, and the antibody of HDGF2 protein functions is also had no effect on including those.Present invention additionally comprises the antibody that those can be combined with the HDGF2 gene outcomes of modification or unmodified form.

The present invention not only includes complete monoclonal or polyclonal antibody, but also including having immunocompetent antibody fragment, such as Fab' or (Fab)₂Fragment；Heavy chain of antibody；Antibody light chain；Genetically engineered Single Chain Fv Molecule A (Ladner et al., United States Patent (USP) No. 4,946,778);Or chimeric antibody, such as have mouse antibody binding specificity but Still retain the antibody of the antibody moiety from people.

The antibody of the present invention can be prepared by various technologies known to a person skilled in the art.For example, purifying HDGF2 gene outcomes or its there is antigenic fragment, animal can be applied to induce the generation of polyclonal antibody.Similar, expressing HDGF2 or its, there is the cell of antigenic fragment can be used to immune animal to produce antibody.The antibody of the present invention can also be monoclonal antibody.Such monoclonal antibody can be prepared using hybridoma technology（See Kohler et al., Nature 256;495, 1975 ;Kohler et al., Eur. J.Immunol. 6:5 1 1 , 1976;Kohler et al., Eur.J.Immunol. 6:292, 1976;Hammerling et al., In Monoclonal Antibodies and T Cell Hybridomas, Elsevier, N.Y., 1981).The antibody of the present invention includes that the antibody of HDGF2 functions can be blocked and does not influence the antibody of HDGF2 functions.Each antibody-like of the present invention can utilize fragment or the functional areas of HDGF2 gene outcomes, be obtained by common immunological techniques.These fragments or functional areas can prepare or utilize Peptide synthesizer synthesis using recombination method.The antibody combined with the unmodified form of HDGF2 gene outcomes can be immunized animal with the gene outcome of production in prokaryotic (such as ￡ Co/ /) and produce；The antibody (such as the albumen or polypeptide of glycosylation or phosphorylation) combined with posttranslational modification form, can be immunized animal with the gene outcome produced in eukaryotic (such as yeast or insect cell) and obtain.

The nucleotides full length sequence of human hepatoma-derived growth factor 2 or its fragment of the present invention can generally be obtained with PCR TRAPs, recombination method or artificial synthesized method, for PCR TRAPs, can be according to relevant nucleotide sequence disclosed in this invention, especially open reading frame sequence designs primer, and obtain relevant sequence as template, amplification with commercially available cDNA storehouses or the cDNA storehouses as prepared by conventional method well known by persons skilled in the art.Say very little when sequence is longer, it is often necessary to carry out twice or multiple PCR is expanded, the fragment for then again amplifying each time is stitched together by proper order.

Once obtain relevant sequence, it is possible to obtain relevant sequence in large quantity with recombination method.This is typically clone people carrier, then is transferred to cell, then by conventional method from the host cell after propagation it is isolated about sequence.

In addition, relevant sequence can be also synthesized with artificial synthesized method, when especially fragment length is shorter.Generally, by first synthesizing multiple small fragments, sequence very long fragment can be obtained by being then attached again.At present, it is already possible to encode the DNA sequences of albumen of the present invention (or its fragment, or derivatives thereof) by chemical synthesis completely.Mutation can also be induced one in protein sequence of the present invention by chemical synthesis.

In addition to being produced with recombination method, the fragment of albumen of the present invention also can use solid phase technique, be produced by direct synthetic peptide（Stewart et al.,（1969) Solid-Phase Peptide Synthesis, WH Freeman Co., San Francisco; Merrifield J. ( 1963) J. Am Chem. Soc 85 :2 149-2154) synthetic protein can be carried out by hand or automatically in vitro.For example, peptide can be automatically synthesized with Applied Biosystems 43 1A types peptide synthesizers (Foster City, CA).Each fragment of chemical synthesis albumen of the present invention can be distinguished, then chemically connected to produce the molecule of total length. The coded sequence of albumen of the present invention can be additionally used in the assignment of genes gene mapping.For example, passing through fluorescence in situ hybridization technique

(FISH), the chromosome of cDNA clone and metaphase are hybridized, chromosome mapping can be carried out exactly.The technology can use the cDNA for being as short as about 500bp;It can also use long to about 2000bp or longer cDNA.For the technology, reference can be made to Verma et al., Human Chromosomes: A Manual of 'Basic Techniques, Pergamon Press, New York( 1988).Once a sequence is located in some exact position on chromosome, by can be associated with genetic map data by the physical location of sequence on chromosome.These genetic map datas can be obtained, for example, (can be obtained by Mendel (Mendelian) people genetic database by Johns Hopkins University Welch Medical Library on the net).Then, gene and the correlation being positioned between the disease of same chromosomal region are identified by linkage analysis.

Then, it is necessary to determine the difference in terms of the cDNA or genome sequence between diseased individuals and healthy individuals.If a certain mutation is present in part or all of diseased individuals but is not present in normal individual, then the mutation may be exactly the pathogenic factor of the disease.

Using albumen of the present invention, by various conventional screening assays, the material interacted with HDGF2, such as acceptor, inhibitor or antagonist can be filtered out.

Albumen and its antibody of the present invention, inhibitor, antagonist or acceptor etc., when being administered (administration) in the treatment, it is possible to provide different effects.Generally, these materials can be formulated in nontoxic, inert and pharmaceutically acceptable aqueous carrier medium, wherein pH is typically about 5-8, and preferably pH is about 6-8, although pH value can be varied from the property that is formulated material and illness to be treated.The pharmaceutical composition prepared can be administered by conventional route, including (but being not limited to)：Intramuscular, intraperitoneal, subcutaneous, intracutaneous or local administration.

By taking the albumen of human hepatoma-derived growth factor 2 of the present invention as an example, it can be combined with suitable pharmaceutically acceptable carrier.This kind of pharmaceutical composition contains the protein and pharmaceutically acceptable carrier or excipient of therapeutically effective amount.This kind of carrier includes (but being not limited to)：Salt solution, buffer solution, glucose, water, glycerine, ethanol, and combinations thereof.Pharmaceutical preparation should match with administering mode.The albumen of human hepatoma-derived growth factor 2 of the present invention can be made into injection form, and such as aqueous solution with physiological saline or containing glucose and other assistant agents is prepared by conventional method.The pharmaceutical composition of such as tablet and capsule etc, can be prepared by conventional method.Pharmaceutical composition such as injection, solution, tablet and capsule are preferably aseptically manufactured.The dosage of active component is therapeutically effective amount, such as the daily mg/kg body weight of about 1 microgram/kg body weight-about 5.In addition, the polypeptide of the present invention can be also used together with other therapeutic agents.

When the polypeptide of human hepatoma-derived growth factor 2 of the present invention is used as medicine, the polypeptide for the treatment of effective dose can be applied to mammal, the wherein treatment effective dose typically at least about 10 micrograms/kg body weight, and 8 mg/kg body weight are in most cases no more than about, preferably the dosage is about 10 micrograms/kg body weight-about 1 mg/kg body weight.Certainly, specific dosage is also contemplated that the factors such as method of administration, patient health situation, within the scope of these are all skilled practitioners technical ability.Brief description

In the accompanying drawings, Fig. 1 is the Homology search figure of HDGF2 of the present invention and mouse HDGF2 nucleotide sequence.Wherein, identical nucleotides is with " marking.

Fig. 2 is the Homology search figure of HDGF2 of the present invention and mouse HDGF2 amino acid sequence.Wherein, identical amino acid is with " marking, similar amino acid is marked with " ".In an example of the present invention, the cDNA nucleotide sequences of human hepatoma-derived growth factor 2 are so obtained, with Human Testis λ gtl lcDNA libraries（Purchased from Clontech companies）For template, synthesis forward primer A1:5'- ACCGCTCGTCCGCCCGGCTTGAG-3' and reversely bow I things A2:5'- GATCCTAGACATGTATAAGTCTGCG C-3', enter performing PCR, and 1024bp purpose fragment is obtained respectively.SEQ ID NO are obtained after sequencing:3 full length cDNA sequence.

Hepatome derivative growth factor (HDGF) is the heparin-binding protein being separated to from the hepatoma cell strain HuH-7 of people, it has the activity of stimulating cellular growth, can promote growth (the J. Biol. Chem. 269 (40) of fibroblast and some liver cancer cells:25143-25149, 1994).It has expression (J. Biol. Chem. 269 (40) in each tissue such as the heart of people, brain, lung, liver and various JEG-3s:25143-25149, 1994).The expression pattern of known each member of HDGF families is different, but they have the enrichment of very high level in spermary, and their 5 non-translational regions have GC ratios (the Biochem. Biophys. Res. Commun. 238 higher than 70%:26-32,1997), thus may have critical function, and and DNA methylation, chromatin conformation and translational control correlation (J. Cell. Biol. 115 in male sex-cell growth course:887-903, 1990； Cell 62:503-514 , 1990).Although HDGF albumen is primarily present in cytoplasm（J. Biol. Chem. 269(40):25143-25149,1994), but all containing a potential nuclear localization signal (NLS) in the amino acid sequence of the family member, and all no signal peptide orders, point out them to be worked possibly as nucleoprotein.In addition, the acidic amino acid tail and the HMG- 1/-2 very high homologies of HMG families of HDGF C-terminal, and this section of sequence is known to be histone calmodulin binding domain CaM (Biochemistry 29 in HMG- 1/-2:4419-4423, 1990).Very possible HDGF plays activity (the Biochem. Biophys. Res. Commun. 238 of its stimulating cellular growth after internalization as transcription factor:26-32, 1997).HDGF mitogen activity makes it there is great application value (Clin. Chim. Acta. 183 in the treatment of acute malignant hepatitis and hepatic injury:273-284,1989) researchs show that many fibroblast growth factors can be widely applied for the development (Blood 91 (10) of the defective disease of the vascularization such as ischemic disorders and atherosclerosis aspect and nerve cell:3527-3561 , 1998； Ann. N. Y. Acad. Sci. 545:240-252, 1998). With reference to specific embodiment, the present invention is expanded on further.It should be understood that these embodiments are only illustrative of the invention and is not intended to limit the scope of the invention.The experimental method of unreceipted actual conditions in the following example, generally according to normal condition such as Sambrook et al., molecular cloning：Laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) described in condition, or build according to manufacturer the condition of i justice.

Embodiment

Embodiment 1

The clone of HDGF2 cDNA sequence and measure

1. primer is expanded

With Human Testis λ gtl lcDNA libraries（Purchased from Clontech companies）For template, oligonucleotides A1 is used: 5'-

ACCGCTCGTCCGCCCGGCTTGAG-3' (SEQ ID NO:1) it is forward primer, oligonucleotides A2: 5*-GATCCTAGACATGTATAAGTCTGCGC-3' (SEQ ID NO:2) it is reverse primer, enters performing PCR, PCR conditions are 93 ' C 4 minutes, therewith with 93 ' C 1 minute, 68.5 ' C 1 minute and 72.C carries out 35 circulations for 1 minute, and last 72'C extends 5 minutes.The PCR fragment that electrophoresis detection is obtained, the purpose fragment for being 1024bp.

2. the sequencing of PCR primer

The pcr amplification product being obtained as described above is connected with pGEM-T carriers (Promega), convert Escherichia coli JM103, plasmid is extracted with QIAprep Plasmid kits (QIAGEN), with double-strand nested type missing kit (Pharmacia) to insert people's fragment be oriented series of deletions, then Deleting mutants are carried out with PCR Rapid identification and

TM

Sequence.The Deleting mutants truncated successively are sequenced with SequiTherm EXCEL DNA sequencing kits (Epicentre Technologies), finally with computer software splicing order, full length cDNA sequence is obtained, common 1024bp, detailed sequence is shown in SEQ ID NO:3, wherein open reading frame is located at 121-732 nucleotides.

Full length cDNA sequence according to obtaining derives HDGF2 amino acid sequence, totally 203 amino acid residues, and its amino acid sequence refers to SEQ ID NO: 4.Embodiment 2

Homology search

Employment HDGF2 full length cDNA sequence and its encoding proteins carries out nucleic acid and albumen homology retrieval in Non-redundant GenBank+ EMBL+DDBJ+PDB databases and Non-redundant GenBank CDS translations+PDB ÷ SwissProt+Spupdate+PIR databases with BLAST.As a result find that (dbjlD63707 | MUSHDGF) gene and its encoding proteins have high homology with mouse HDGF for they, use PCGENE comparisons find that their homogeneity in nucleic acid level have reached 68.7%, and the homogeneity on protein level has reached 53.7%, and also 9.4% amino acid is similar (Fig. 1 and Fig. 2).Particularly in the conservative amino terminal being made up of 98 amino acid, 90 % are up to mouse HDGF homology.In addition, human hepatoma-derived growth factor 2 and another mouse HDGF gene（Dbj | D63850 | D63850) and the HDGF genes (dbj | D 1,643 1 | HUMHDGF) of another person also have certain homology.These above-mentioned genes are considered to constitute one-individual family, it is possible to speculate the function of human hepatoma-derived growth factor 2 from the function of these known genes or albumen.

Hepatome derivative growth factor (HDGF) is the heparin-binding protein being separated to from the hepatoma cell strain HuH-7 of people, it has the activity of stimulating cellular growth, can promote growth (the J. Biol. Chem. 269 (40) of fibroblast and some liver cancer cells:25143-25149, 1994).Although HDGF is initially found in liver cancer cells, Northern hybridization analysis shows that it has expression in each tissue such as the heart of people, brain, lung, liver and various JEG-3s.It whether there is differential expression in normal cell and tumour cell, also need further experiment to prove (J. Biol. Chem. 269 (40):25143-25149, 1994).With going deep into for research, effects of the HDGF in liver cancer cells and its influence to liver cancer treatment also can be constantly revealed.The expression pattern of each member is different known to HDGF families, but they have an enrichment of very high level in spermary, and 5 non-translational regions of these genes have GC ratios (Biochem. Biophys. Res. Commun. 238 higher than 70%:26-32,1997), the gene of this feature and some specifically expressings in spermary or embryonic development is similar, thus they may have critical function in male sex-cell growth course, and and DNA methylation, chromatin conformation and translational control correlation (J. Cell. Biol. 1 15:887-903, 1990； Cell 62:503-514, 1990),

Fluorescence immunoassay experiment shows that HDGF albumen is primarily present in cytoplasm (J. Biol. Chem. 269 (40):25 143-25149,1994), but all containing one section of basic region in the amino acid sequence of the family member --- a potential nuclear localization signal (NLS), and all no signal peptide orders, point out them to be worked possibly as nucleoprotein.Fibroblast growth factor (FGF) must rely on this segment signal region, be allowed to be positioned in core and play the activity of its mitogen.In addition, the acidic amino acid tail and the HMG- 1/-2 very high homologies of HMG families of HDGF C-terminal, and this section of sequence is known to be histone calmodulin binding domain CaM (Biochemistry 29 in HMG- 1/-2:4419-4423 , 1990).Summary phenomenon, it is more likely that HDGF plays activity (the Biochem. Biophys. Res. Commun. 238 of its stimulating cellular growth after internalization as transcription factor:26- 32, 1997).The HDGF2 of the present invention similarly has similar activity.

HDGF mitogen activity makes it there is great application value (Clin. Chim. Acta. 183 in the treatment of acute malignant hepatitis and hepatic injury:273-284, 1989).Research shows, many fibroblast growth factors have the ability for promoting epithelial cell growth, can be widely applied for the development (Blood 91 (10) of the defective disease of the vascularization such as ischemic disorders and atherosclerosis aspect and nerve cell:3527- 3561 , 1998; Ann. N. Y. Acad. Sci. 545:240-252, 1998).I types HDGF and HDGF2 of the present invention The application in terms of fibroblast growth activity is facilitated still await further research.

The HDGF2 of the present invention as family's a member except that can be used for further functional study, it may also be used for fusion protein is produced together with other albumen, such as fusion protein is produced together with immunoglobulin.In addition, HDGF2 of the present invention can also be merged or be exchanged fragment with other members of the family, to produce new albumen, such as be swapped the N-terminal of HDGF2 of the present invention N-terminal and I types HDGF or mouse HDGF, with produce it is new ' property is higher or albumen with new features

For HDGF2 of the present invention antibody, other members for screening the family, or for affinity purification GAP-associated protein GAP (other members of such as family).Embodiment 3

Expression of the HDGF2 in Escherichia coli

In this embodiment, the cDNA sequence for encoding HDGF2 is expanded with the PCR Oligonucleolide primers at the 5' and 3' ends corresponding to the DNA sequence dna, obtains HDGF2 cDNA and be used as Insert Fragment.

The 5' Oligonucleolide primers sequences that use are in PCR reactions：

5 -CCACGGATCCATGGCGCGTCCGCGGCCCC-3'(SEQ ID NO: 5)

The primer contains the restriction enzyme site of BamHI restriction enzymes, is 19 nucleotides by the HDGF2 coded sequences initiation codon after the restriction enzyme site；

3' ends primer sequence is：

5 -ATCCGTCGACTTAGGTCCCTTCACTGGTT-3 (SEQ ID NO:6) primer contains the partial coding sequence of the restriction enzyme site of Sail restriction enzymes, translation termination and HDGF2.

The restriction enzyme digestion sites that the restriction enzyme site of restriction enzyme on primer corresponds on bacterial expression vector pQE-9 (Qiagen Inc., Chatsworth, CA), plasmid vector coding antibiotic resistance (Am_pR), bacterial origin of replication (ori), an IPTG- is adjustable promoter/operator (P/0), a ribosome bind site (RBS), a 6- histidine marks thing (6-His) and restriction enzyme cloning site.

With BamHI and Sail digestion pQE-9 carriers and Insert Fragment, Insert Fragment is then connected to pQE-9 carriers and keeps open reading frame to be originated in bacterium RBS.Then Qiagen is purchased from connection mixture conversion, trade name M15/rep^ ￡ .co//bacterial strain, M15/rep4 contains the plasmid pREP4 of multicopy, it is expressed lacl repressors and carries kalamycin resistance (Kan screens transformant on the LB culture dishes containing Amp and Kan, extract plasmid, Insert Fragment size and direction are identified with Pstl digestions, and sequence verification HDGF2 cDNA fragments have been correctly inserted into carrier.

The incubated overnight in the LB fluid nutrient mediums for adding Α Γ η ρ (100 μ g/ml) and Kan (25 μ g/ml)（Ο Ν) Positive transformant clone containing required construction.(0/N) culture is with 1 overnight: 100-1：250 dilution rate dilution, is then seeded into large volume culture base, culture cell growth to 600 optical density (OD_6QQ) be 0.4-0.6 when, add IPTG (" isopropylthio-β-D- galactosides "）To final concentration of lmM.By inactivating lacl repressors, IPTG inductions, which start P/0, causes gene expression dose to improve.Continue to cultivate cell 3-4 hours, then centrifugation (6000-g, 20 minutes).Ultrasonic degradation culture, collects cell pyrolysis liquid and is diluted in 6M guanidine hydrochloride.After clarification, by under conditions of the albumen of label containing 6-His can be made to combine closely, the HDGF2 of dissolving is purified from solution with nickel-chelating column chromatography, protein precipitation can be denatured with several method from guanidine hydrochloride by eluting HDGF2. from post with 6M guanidine hydrochlorides (pH5.0).Either guanidine hydrochloride being removed using dialysis step or purifying protein being isolated from nickel-chelate column, albumen after purification can be incorporated into second post, there is the linear guanidine hydrochloride gradient successively decreased in the post.The protein denaturation when being attached to the post, is then eluted with guanidine hydrochloride (pH5.0).Finally, by solvable protein to being dialysed containing PBS, then protein is stored in the storage liquid of final concentration of 10% (w/v) glycerine.

Electrophoresis is carried out with 12% SDS-PAGE glue, the molecular size range for identifying expressing protein is about 23KDa.In addition, the amino acid of each 10 amino acid lengths of the N-terminal and C-terminal of expressing protein is sequenced with conventional method, find and SEQ ID NO:The 4 consistent embodiments 4 of sequence

HDGF2 is in eukaryotic (Chinese hamster ovary celI strain）In expression

In this embodiment, the cDNA sequence for encoding HDGF2 is expanded with the PCR Oligonucleolide primers at the 5' and 3' ends corresponding to the DNA sequence dna, obtains HDGF2 cDNA and be used as slotting people's fragment.

The 5' Oligonucleolide primers sequences that use are in PCR reactions：

5 -CCCTAAGCTTATGGCGCGTCCGCGGCCCC-3'(SEQ ID NO: 7)

The primer contains the restriction enzyme site of Hindlll restriction enzymes, is 19 nucleotides by the HDGF2 coded sequences initiation codon after the restriction enzyme site；

3' ends primer sequence is：

5 - TTTCGGATCCTTAGGTCCCTTCACTGGTT-3 (SEQ ID NO: 8)

The primer contains the partial coding sequence of the restriction enzyme site of BamHI restriction enzymes, translation termination and HDGF2.

The restriction enzyme digestion sites that the restriction enzyme site of restriction enzyme on primer corresponds on expressing cho cell carrier pcDNA3, plasmid vector coding antibiotic resistance (Amp^fAnd Ne₀R), phage origin of replication (fl ο), virus origin of replication (SV40 ori), T7 promoters, a viral promotors (P-CMV), a Sp6 promoter, a SV40 promoter, a SV40 tailing signal and corresponding polyA Sequentially, a BGH tailing signal and corresponding polyA orders.

With Hindlll and BamHI digestion pcDNA3 carriers and Insert Fragment, Insert Fragment is then connected to pcDNA3 carriers.Then with connection mixture conversion ￡ .^ // 0,115 0_[Bacterial strain.Transformant is screened on the LB culture dishes containing Amp, incubated overnight (0/N) contains the clone of required construction in the LB fluid nutrient mediums for adding Α π ι ρ (100 μ g/ml).Plasmid is extracted, Insert Fragment size and direction is identified with Pstl digestions, and be sequenced-verify HDGF2 cDNA fragments being correctly inserted into carrier,

Plasmid transfection Chinese hamster ovary celI is to use lipofection, is carried out with Lipofectin kits (GiBco Life).After transfection 48 hours, pressurize and screen through the lasting G418 of 2-3 weeks, collect cell and cell conditioned medium determines expressing protein enzyme activity.Remove G418, continuous passage culture；To mixing clone cell Method of Limited Dilution, cell subclone of the selection with compared with high protein activity.The above-mentioned positive of mass propgation is subcloned according to a conventional method.After 48 hours, start to collect cell and supernatant, with ultrasonic degradation method smudge cells, with containing 0.05 °/.Triton 50mMTris-HCl (pH7.6) solution is equilibrium liquid and eluent, and the Peak Activity of above-mentioned albumen is collected with the Superdex G-75 posts through pre-equilibration.The DEAE-Sepharose posts balanced again with 50mMTris HCl (pH8.0), gradient elution is carried out by eluent of 50mMTds HCl (pH8.0) solution of the NaCl containing 0-1M, collects the Peak Activity of above-mentioned albumen.Then it is that dialyzate is dialysed to expressing protein solution with PBS (pH7.4).Finally freeze and preserve.

Electrophoresis is carried out with 12% SDS-PAGE glue, the molecular size range for identifying expressing protein is 23KDa.In addition, the amino acid of each 10 amino acid lengths of the N-terminal and C-terminal of expressing protein is sequenced with conventional method, find and SEQ ID NO:4 sequence is consistent.Embodiment 5

Prepare antibody

The recombinant protein that embodiment 3 and 4 is obtained is used for that animal is immunized to produce antibody, specific as follows.Recombinant molecule is standby after being separated with chromatography.Also it can be separated with PAGE gel electrophoresis, electrophoretic band is cut from gel, and with isometric complete Freimd s adjuvant emulsions.The albumen emulsified with the μ g/0.2ml of 50- 100, intraperitoneal injection is carried out to mouse.After 14 days, with the same antigen of non-fully Freund s adjuvant emulsions, intraperitoneal injection is carried out with booster immunization with 50-100 μ g/0.2ml dosage to mouse.A booster immunization was carried out every 14 days, is at least carried out three times.The ability that the sero-fast idiosyncrasy activity obtained precipitates HDGF2 gene translation products with it in vitro is assessed.

All documents referred in the present invention are all incorporated as reference in this application, are individually recited just as each document as with reference to such.In addition, it is to be understood that after the above-mentioned instruction content of the present invention has been read, those skilled in the art can make various changes or modifications to the present invention, and these equivalent form of values equally fall within the application appended claims limited range. Sequence table

(1) general information:

(ii) denomination of invention：New human hepatome derivative growth factor coded sequence, the polypeptide of its coding and preparation method

(iii) sequence number： 8

(2)SEQ ID NO:1 information

(i) sequence signature

(A) length：23 bases

(B) type：Nucleic acid

(C) chain：It is single-stranded

(D) topological structure：Linearly

(ii) molecule type：Oligonucleotides

(xi) sequence description： SEQ ID NO: 1

ACCGCTCGTC CGCCCGGCTT GAG

(2)SEQ ID NO:2 information

(i) sequence signature

(A) length：26 bases

(B) type：Nucleic acid

(C) chain：It is single-stranded

(D) topological structure：Linearly

(ii) molecule type：Oligonucleotides

(xi) sequence description： SEQ ID NO: 2

GATCCTAGAC ATGTATAAGT CTGCGC

(2)SEQ ID NO:3 information：

(i) sequence signature

(A) length： 1024bp (B) type：Nucleic acid

(C) chain：Double-strand

(D) topological structure：Linearly

(ii) molecule type： cDNA

(xi) sequence description： SEQ ID NO: 3

1 ACCGCTCGTC CGCCCGGCTT GAGGCCCGCG GGGAGCGCGC GCAATTCGTC GGCCCGCGGG

61 GGGGCGGCCT CCCGGCATCT TCGCGGCGAC CAAGGACTAC CAGGAAGGGG AGCGGCTGGG

121 ATGGCGCGTC CGCGGCCCCG CGAGTACAAA GCGGGCGACC TGGTCTTCGC CAAGATGAAG

181 GGCTACCCGC ACTGGCCGGC CCGGATTGAT GAACTCCCAG AGGGCGCTGT GAAGCCTCCA

241 GCAAACAAGT ATCCTATCTT CTTrTTTGGC ACCCATGAAA CTGCA Ji TCT AGGTCCCAAA

301 GACCTTTTTC CATATAAGGA GTACAAAGAC AAGTTTGGAA AGTCAAACAA ACGGAAAGGA

361 Ji TAACGAAG GATTGTGGGA AATAGAAAAT AACCCAGGAG TAAAG Ji TAC TGGCTACCAG

421 GCAA Ji CAGC AACAGAGCTC TTCAGAAACT GAGGGAGAAG GTGGAAATAC TGCAGATGCA

481 AGCAGTGAGG AAGAAGGTGA TAGAGTAGAA GAAGATGGAA AAGGCAAAAG AAAGAATGAA

541 AAAGCAGGCT CAAAACGGAA AAAGTCATAT AC Ji CAAAGA AATCCTCTAA ACAGTCCCGG

601 AAATCTCCAG GAGATGAAGA TGACAAAGAC TGCAAAGAAG AGGAAAACAA AAGCAGCTCT

661 GAGGGTGGAG ATGCGGGCAA CGACACAAGA AACACAACTT CAGACTTGCA GAAAACCAGT

721 GAAGGGACCT AACTACCATA ATGAATGCTG CATATTAAGA GAAACCACAA GAAGG Jis ATA

781 TGTTTGGTTG TCTAATATTC Ji GGAT Ji GA TATGAACCAA CACATAGTCC TTGTTGTCAT

841 TGACAGAACC CCAG Ji TGTA TGTACATTAT TCATATTCCT CTCTGTTGTG Jis TCGGGGGG

901 AAAAGACA1T TTAGCCTTTT TTAAAAGTTA CTGATTTAAT Ji CATG Ji AT TTGGTTGCAT

961 GAAGTTGCCC TTAACCACTA AGGATTATCA AGA Ji Ji TGC GCAGACTTAT ACATGTCTAG

1021 GATC

(2)SEQ ID NO:4 information：

(i) sequence signature

(A) length：203 amino acid

(B) type：Amino acid

(D) topological structure：Linearly

(H) molecule type：Polypeptide

(xi) sequence description： SEQ ID NO: 4 1 Met Ala Arg Pro Arg Pro Arg Glu Tyr Lys Ala Gly Asp Leu Val

16 Phe Ala Lys Met Lys Gly Tyr Pro His Trp Pro Ala Arg lie Asp

31 Glu Leu Pro Glu Gly Ala Val Lys Pro Pro Ala Asn Lys Tyr Pro

46 He Phe Phe Phe Gly Thr His Glu Thr Ala Phe Leu Gly Pro Lys

61 Asp Leu Phe Pro Tyr Lys Glu Tyr Lys Asp Lys Phe Gly Lys Ser

76 Asn Lys Arg Lys Gly Phe Asn Glu Gly Leu Trp Glu lie Glu Asn

91 Asn Pro Gly Val Lys Phe Thr Gly Tyr Gin Ala He Gin Gin Gin

106 Ser Ser Ser Glu Thr Glu Gly Glu Gly Gly Asn Thr Ala Asp Ala

121 Ser Ser Glu Glu Glu Gly Asp Arg Val Glu Glu Asp Gly Lys Gly

136 Lys Arg Lys Asn Glu Lys Ala Gly Ser Lys Arg Lys Lys Ser T r

151 Th「 Ser Lys Lys Ser Ser Lys Gin Ser Arg Lys Ser Pro Gly Asp

166 Glu Asp Asp Lys Asp Cys Lys Glu Glu Glu Asn Lys Ser Ser Ser

181 Glu Gly Gly Asp Ala Gly Asn Asp Th「 Arg Asn Thr Thr Ser Asp

196 Leu Gin Lys Th「 Ser Glu Gly Thr

(2)SEQ ID NO:5 information

(i) sequence signature

(A) length：29 bases

(B) type:Nucleic acid

(C) chain：It is single-stranded

(D) topological structure：Linearly

(ii) molecule type：Oligonucleotides

(xi) sequence description： SEQ ID NO: 5

CCACGGATCC ATGGCGCGTC CGCGGCCCC

(2)SEQ IDNO:6 information

(i) sequence signature

(A) length：29 bases

(B) type：Nucleic acid

(C) chain:It is single-stranded

(D) topological structure：Linearly

(Π) molecule type：Oligonucleotides

- !5 - (xi) sequence description： SEQ ID NO: 6

ATCCGTCGAC TTAGGTCCCT TCACTGGTT

(2)SEQ ID NO:7 information

(i) sequence signature

(A) length：29 bases

(B) type：Nucleic acid

(C) chain：It is single-stranded

(D) topological structure：Linearly

(Π) molecule type：Oligonucleotides

(xi) sequence description： SEQ ID NO: 7

CCCTAAGCTT ATGGCGCGTC CGCGGCCCC

(2)SEQ ID NO:8 information

(i) sequence signature

(A) length：29 bases

(B) type：Nucleic acid

(C) chain：It is single-stranded

(D) topological structure：Linearly

(Π) molecule type：Oligonucleotides

(xi) sequence description： SEQ ID NO: 8

TTTCGGATCC TTAGGTCCCT TCACTGGTT

Claims (1)

1. Claims

   1. a kind of DNA molecular isolated, it is characterised in that it includes：The nucleotide sequence of polypeptide of the coding with the protein active of human hepatoma-derived growth factor 2,

   Described nucleotide sequence and SEQ ID NO:There is from the bad Jl of nucleotides sequence of 121-732, nucleotides at least 70% homology in 3；Or

   Described nucleotide sequence can under medium stringency conditions with SEQ ID NO:From the nucleotide sequence hybridization of 121-732, nucleotides in 3.

   2. DNA molecular as claimed in claim 1, it is characterised in that the described polypeptide of sequential coding one, the polypeptide has SEQ ID NO:Sequence shown in 4.

   3. DNA molecular as claimed in claim 1, it is characterised in that the sequence has SEQ ID NO:The sequence of 3 nucleotides 121-732.

   4. the HDGF2 polypeptides of a kind of separation, it is characterised in that it includes：With SEQ ID NO:The polypeptide of 4 amino acid sequences or its active fragment, or its reactive derivative.

   5. polypeptide as claimed in claim 4, it is characterised in that the polypeptide is with SEQ ID NO:The polypeptide of 4 sequences.

   6.-kind of carrier, it is characterised in that it contains the DNA described in claim 1.

   7.-kind of the host cell converted with carrier described in claim 6.

   8. host cell as claimed in claim 7, it is characterised in that the cell is Escherichia coli.

   9. host cell as claimed in claim 7, it is characterised in that the cell is eukaryotic.

   10.-kind of the method for producing the polypeptide with HDGF2 protein actives, it is characterised in that this method includes：

   (_a)The nucleotide sequence for encoding the polypeptide with HDGF2 protein actives is operably coupled to expression regulation sequence, HDGF2 protein expression vectors, described nucleotide sequence and SEQ ID NO is formed:Shown in 3 from the nucleotides sequence of 121-732, nucleotides at least 70% homology；

   (b) expression vector in step (a) is transferred to host cell, forms the recombinant cell of HDGF2 albumen；

   (c) under conditions of expression HDGF2 polypeptides are adapted to, the recombinant cell in incubation step (b)；

   (d) polypeptide with HDGF2 protein actives is isolated.

   1 1. methods as claimed in claim 10, it is characterised in that the sequence is SEQ ID NO:From 121-732 of nucleotides in 3

   12.-kind of the antibody that can be specifically bound with the HDGF2 polypeptides described in claim 4.

   13.-kind of nucleic acid molecule, it is characterised in that it is the antisense sequences of DNA molecular described in claim 1.

   14. a kind of probe molecule, it is characterised in that it contains 100 continuous nucleotides of about 8- in DNA molecular described in claim 1.