CN1318101A - New human growth differentiation factor encoding sequence and polypeptide encoded by such DNA sequence and producing method thereof - Google Patents
New human growth differentiation factor encoding sequence and polypeptide encoded by such DNA sequence and producing method thereof Download PDFInfo
- Publication number
- CN1318101A CN1318101A CN 99811046 CN99811046A CN1318101A CN 1318101 A CN1318101 A CN 1318101A CN 99811046 CN99811046 CN 99811046 CN 99811046 A CN99811046 A CN 99811046A CN 1318101 A CN1318101 A CN 1318101A
- Authority
- CN
- China
- Prior art keywords
- hgdf3
- sequence
- polypeptide
- seq
- nucleotides
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The invention provides a cDNA sequence of a new human growth differentiation factor (hGDF3-2). The protein encoded by such sequence is a splice variant of hGDF3. The present invention also relates to peptides encoded by the nucleotide sequences, to uses of these polynucleotides and polypeptides, and methods for producing the said polynucleotides and polypeptides.
Description
The sub- coded sequence of new human growth and differentiation factor 7, the polypeptide of its coding and preparation method invention field
The present invention relates to genetic engineering field, in particular it relates to which a kind of new people's gene nucleotides sequence is bad1H is it is more particularly related to which a kind of cDNA sequence of new human growth and differentiation factor 7 (hGDF3-2), the albumen is hGl^3 variation spliced body.The invention further relates to the production method by the nucleotide sequence coded polypeptide, the application of these polynucleotides and polypeptide, and the polynucleotides and the polypeptide.Background technology
TGF P (transforming growth factor- β, TGF- β) is the protein with a variety of bio-regulating activities found before about 15 years using biochemical method.Thereafter soon, it has been found that TGF- e, which represent a class, has the growth factor of wide variety of functions.In different biologies, these factors all play important adjustment effect (Handbook of Experimental Pharmacology in terms of occurring including cell growth, differentiation and tissue morphology, 1990, Vol.95, pp419-475, Springer Verlag, Geidelberg).TGF- β constitute a superfamily with these related proteins, and the family is named as TGF- P superfamilies.So far, TGF ^ superfamilies have included the members different more than 30.Four principal home races (Proc Soc Exp Biol Med, 1997,214 (l), 27-40) are may be roughly divided into again in TGF- beta superfamilies, they are:(1) mullerian inhibitory substance MIS families(Mullerian inhibitory substance family) --- MIS albumen can adjust the degeneration of accessory urinary duct in male embryo;(2) Inhibin/Activin family (inhibin/activin family) --- inhibin can suppress pituitary cell release follicle-stimulating hormone (FSH), and activin can then stimulate the release of follicle-stimulating hormone (FSH);(3) Vg- associated families --- including bone morphogenic protein BMP-2, the dorsalin-l differentiation of nerve channel (albumen adjust), growth and differentiation factor GDF-1, DPP, the Vgl of xenopous laevis and its homologue Vgr- 1 in mouse etc.;(4) TGF- 'beta ' families --- including TGF- (3 five kinds of isomers (TGF- β 1-5).
TGF- Ρ carry out quite varied and deep people as the representative in the superfamily to its research.Research to its function shows, the strong endogenous mediator that TGF- P wounded tissues are repaired, it by wounded tissue to chemotaxis, angiogenesis and extracellular matrix (ECM) deposit stimulation and function (CHn Immunol Immunopathol, 1997,83 (1), 25-30).TGF- P also have adjustment effect (Bioessays, 1997,19 (7), 581-591) to the growth and differentiation of various kinds of cell, and this regulation can be positive regulator or negative regulator.Existing most of evidences show that TGF- β are to play its regulating and controlling effect in the G1 phases of cell cycle.In addition, also report claims TGF- β to induce the death of some sensitive cells, and these cells include liver cancer cells, medullary system and bone system cell etc..Experiment in vitro also found that differentiation of the TGF- β to various kinds of cell strain has regulating and controlling effect, although not clear to its mechanism of action.The regulating and controlling effect of TGF- β cell growths differentiation naturally makes one to associate its protective action in chemotherapy
And the possible application in oncotherapy, about report existing a great deal of (the Clin Immunol Immunopathol, 1997,83 (1), 25-30 in terms of these; Bioessays, 1997,19(7),581-591)„
In a variety of species TGF- P family members are all had found in (such as xenopous laevis, chicken, mouse, pig, ox).(3 (- l, -2, -3) are cloned the TGF- of people in the later stage eighties.Wherein, TGF- β 1 are to be equal to complete within 1985 sequencing (Nature by Derynck R, 1985,316 (6030), 701-705), it is auspicious to find that tool functional TGF- P are processed by a precursor more much longer than maturation protein is clipped in fact by the analysis of the coded sequence to TGF- P 1.This characteristic was found to be a general character of TGF- beta superfamilies later.Fourth 0- 02 and fourth 03 nucleotide sequence is then that Madisen L etc. and ten Dijke P et al. measured (Proc Natl Acad Sci U S A, 1988,85 (13), 4715-4719 in 1988;DNA, 1988,7 (1), 1-8) had found by Homology search, the homologous degree of TGF- P 2 and TGF- β 3 and TGF- β 1 amino acid has reached 70%-80%.
Since the nineties, as continuing to develop for cloning and sequencing gene technology is perfect, more and more TGF- beta superfamily members are cloned.1993, the title that publishes thesis such as Alexandra^ was found that a new TGF- P superfamily member mouse growths differentiation factor 3, GDF- 3 (growth/differentiation factor 3) (J.Biol. Chem.,
1993,268 (5), 3444-3449) compared with other members in TGF- beta superfamilies, the albumen and their homology are not very high, but it has the distinctive conserved sequence of TGF- beta superfamilies.Specifically, it lacks the 4th in seven Conserved cysteines of the superfamily, and this may imply that it has certain special property.
Homologues of the GDF-3 in people was cloned (Oncogene, 1998,16,95-103) in 1998, and the albumen shows high homology with mouse GDF-3, thus is named as hGDF3.It should be noted, however, that hGDF3 length is much shorter compared with GDF-3.This is mainly due to its aminoterminal nearly 50 residues fewer than GDF-3, and corresponding to having lacked two residues at mouse GDF-303128 and 248.This change is probably that, because hGDF3 genes have variable sheer, or the gene is changed in evolution according to conjecture.
But before making the present invention, also nobody isolates or is disclosed human growth and differentiation factor 73 of other forms.Summary of the invention
It is an object of the present invention to provide a kind of new polynucleotide sequence, the sub- hGDF3 of a polynucleotide sequence coding human growth and differentiation factor 7 variation shear protein, the variation spliced body of hGDF3 genes of the invention is named as hGDF3-2.
It is a further object to provide a kind of new albumen, the albumen is named as hGDF3-2.
It is also another object of the present invention to provide a kind of method of the described new people's hGDF3-2 albumen of utilization recombinant technique production.
Present invention also offers the application of this people hGDF3-2 nucleotide sequences and albumen.
In one aspect of the invention there is provided a kind of DNA molecular isolated, it includes:The nucleotide sequence of polypeptide of the coding with people's hGDF3-2 protein actives, described nucleotide sequence and SEQ ID NO:Shown in 5 from nucleotides 14- 1 105 nucleotides sequence at least 70% homology;Or described nucleotide sequence can under medium stringency conditions with SEQ ID NO:From nucleotides 14-1 105 nucleotide sequence hybridization in 5.It is preferred that the described polypeptide of sequential coding one, the polypeptide has SEQ ID NO:Sequence shown in 6.More preferably, the sequence has SE (^ ID NO:From nucleotides 14- 1 105 nucleotide sequence in 5.
In another aspect of this invention there is provided a kind of hGDF3-2 polypeptides of separation, it includes:With SEQ ID NO:The polypeptide of six amino acid sequence or its active fragment, or its reactive derivative.It is preferred that the polypeptide is with SEQ ID NO:The polypeptide of 6 sequences.
In another aspect of this invention there is provided a kind of carrier, it contains the above-mentioned DNA isolated.
There is provided a kind of host cell of the carrier conversion in another aspect of this invention.
In another aspect of this invention there is provided a kind of method for producing the polypeptide with hGDF3-2 protein actives, this method includes:
(a)The nucleotide sequence for encoding the polypeptide with hGDF3-2 protein actives is operably coupled to expression regulation sequence, the protein expression vectors of hGDF3- 2, described nucleotide sequence and SEQ ID NO is formed:Shown in 5 from nucleotides 14- 1105 nucleotides sequence at least 70% homology;
(b) expression vector in step (a) is transferred to host cell, forms the recombinant cell of hGDF3-2 albumen;
(c) under conditions of the expression polypeptides of hGDF3- 2 are adapted to, the recombinant cell in incubation step (b);
(d) polypeptide with hGDF3-2 protein actives is isolated.
In one embodiment of the invention, the polynucleotides total length of separation of the invention is 1 141 nucleotides, and its detailed sequence is shown in SEQ ID NO:5, wherein open reading frame is located at 105 nucleotides of 14-1
In the present invention, " separation ", " purifying " or " substantially pure " DNA refer to, the DNA or fragment are separated from the sequence of its both sides is located under native state, also refer to the DNA or fragment to separate with the component under native state with nucleic acid, and with being separated in cell with its protein.
In the present invention, term " hGDF3-2 albumen(Or polypeptide) " refer to coding has the nucleotide sequence of polypeptide of HGDF3-2 protein actives, such as SEQ ID NO to coded sequence:105 nucleotide sequences of 14-1 and its degenerate sequence in 5.The degenerate sequence refers to, positioned at SEQ ID NO:In 1 105 nucleotides of encoder block 14- of 5 sequences, there are one or more codons to be encoded the sequence produced after the degenerate codon of same amino acid replaces.Due to the degeneracy of codon, thus with SEQ ID NO:The degenerate sequence of 105 nucleotide sequence homologies of 14-1 as little as about 70% can also encode out SEQ ID NO in 5:Sequence described in 6.The term also includes can be under medium stringency conditions, with SEQ ID NO more preferably under high stringency conditions:From the nucleotide sequence of nucleotides 14- 1 105 nucleotide sequence hybridization in 5.In addition, the term also includes and SEQ ID NO:From nucleotides 14-1 105 in 5
Homology at least 70 % of the nucleotide sequence of position, preferably at least 80 %, more preferably at least 90 % nucleotide sequence.
The term also includes that albumen, SEQ ID NO with people's HGDF3-2 identical functions can be encoded:The variant form of 5 sequences.These variant forms include (but being not limited to):Several (be usually 1-90, preferably 1-00, more ' honor 1-20, most preferably 1-10) the lacking of nucleotides, insert people and/or substitution, Yi Ji5And/or 3 several (being usually within 60, within preferably 30, more preferably within 10, most preferably within 5) nucleotides of end addition.
In the present invention, " substantially pure " protein or polypeptide refer to that it at least accounts for sample total material at least 20%, preferably at least 50%, more preferably at least 80%, most preferably at least 90 °/.(based on dry weight or weight in wet base).Purity can be measured with any suitable method, and the purity of polypeptide is such as measured with column chromatography, PAGE or HPLC methods.Substantially pure polypeptide is substantially free of its adjoint component under native state.
In the present invention, term " hGDF3-2 polypeptides " refers to the SEQ ID NO with hGDF3-2 protein actives:The polypeptide of 6 sequences.The term also includes having and people's hGDF3-2 identical functions, SEQ ID NO:The variant form of 6 sequences.These variant forms include (but being not limited to):Several (are usually 1-50, preferably 1-30, more preferably 1-20, most preferably 1-10) the lacking of amino acid, insert people and/or substitution, and it (is usually within 20 to add one or several in C-terminal and/or N-terminal, within preferably 10, more preferably within 5) amino acid.For example, in the art, when being replaced with similar nature or similar amino acid, will not generally change the function of protein.Again such as, the function of protein will not generally also be changed by adding one or several amino acid in C-terminal and/or N-terminal.The term also includes the active fragment and reactive derivative of hGDF3-2 albumen.
The variant form of the polypeptide includes:Homologous sequence, allelic variant, natural mutation, induced mutants, many peptide or proteins that can be obtained under high or low stringency conditions with the albumen coded by the DNA of hGDF3-2 DNA hybridization and using the antiserum of anti-hGDF3-2 polypeptides.Present invention also offers other polypeptides, the fusion protein such as comprising hGDF3-2 polypeptides or its fragment.In addition to the almost polypeptide of total length, present invention includes the soluble fragments of hGDF3-2 polypeptides.Generally, the fragment has at least about 10 continuous amino acids of hGDF3-2 peptide sequences, typically at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, most preferably at least about 100 continuous amino acids.
Invention also provides the analog of hGDF3-2 albumen or polypeptide.The difference of these analogs and natural hGDF3-2 polypeptides can be difference on amino acid sequence or not influence the difference on the modified forms of sequence, or have both at the same time.These polypeptides include natural or induction genetic variant.Induction variant can be obtained by various technologies, such as by radiating or producing random mutagenesis exposed to mutagens, can also be by the technology of site-directed mutagenesis or other known molecular biology.Analog is also included with the residue different from natural L-amino acids (such as
D- amino acid) analog, and with it is non-naturally occurring or synthesis amino acid (such as P, Y-amino acid) analog.It should be understood that the polypeptide of the present invention is not limited to the above-mentioned representational polypeptide enumerated.
Modification (not changing primary structure generally) form includes:Chemically derived the form such as acetylation or carboxylated of inner or in vitro polypeptide.Modification also includes glycosylation, and such as those enter in the synthesis and processing of polypeptide or in further processing step:The polypeptide that § is glycosylation modified and produces.This modification can be by the way that polypeptide be completed exposed to the glycosylated enzyme (glycosylase or deglycosylating enzyme of such as mammal) of progress.Modified forms also include the sequence with phosphorylated amino acid residue (such as phosphotyrosine, phosphoserine, phosphothreonine).Also include being modified improving its anti-proteolysis performance or optimizing the polypeptide of solubility property.
Present invention additionally comprises the antisense sequences of hGDF3-2 polypeptid coding sequences.This antisense sequences can be used for the expression for suppressing intracellular hGDF3-2.
Present invention additionally comprises a kind of probe molecule, the molecule generally 8-100 with hGDF3-2 polypeptid coding sequences is individual, preferably 15-50 continuous nucleotide.The probe can be used for the nucleic acid molecules with the presence or absence of coding hGDF3- 2 in detection sample.
Present invention additionally comprises the method for detection hGDF3-2 nucleotide sequences, it includes being hybridized with above-mentioned probe and sample, and then whether detection probe there occurs combination.It is preferred that the sample is the product after PCR amplifications, wherein pcr amplification primer thing corresponds to the coded sequence of hGDF3-2 polypeptides, and can be located at the both sides or centre of the coded sequence.Primer length is generally 20-50 nucleotides.
In the present invention, various carriers known in the art, such as commercially available carrier be can select.
In the present invention, term " host cell " includes prokaryotic and eukaryotic.The example of conventional prokaryotic host cell includes Escherichia coli, hay bacillus etc..Conventional eukaryotic host cell includes yeast cells, insect cell and mammalian cell.It is preferred that the host cell is eukaryotic, such as Chinese hamster ovary celI, COS cells.
On the other hand, there is specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody present invention additionally comprises the polypeptide to hGDF3-2 DNA or its fragment coding.Here, " specificity " refers to that antibody can be incorporated into hGDF3-2 gene outcomes or fragment.It is preferred that referring to those can be combined but nonrecognition and the antibody for being incorporated into other non related antigen molecules with hGDF3-2 gene outcomes or fragment.Antibody, which includes those, in the present invention can be combined and suppress the molecule of hGDF3-2 albumen, and the antibody of hGDF3-2 protein functions is also had no effect on including those.Present invention additionally comprises the antibody that those can be combined with the hGDF3-2 gene outcomes of modification or unmodified form.
The present invention not only includes complete monoclonal or polyclonal antibody, but also including having immunocompetent antibody fragment, such as Fab' or (Fab)2Fragment;Heavy chain of antibody;Antibody light chain;Genetically engineered Single Chain Fv Molecule A (Ladner et al., United States Patent (USP) No. 4,946,778);Or chimeric antibody, such as have mouse antibody binding specificity but
Still retain the antibody of the antibody moiety from people.' the present invention antibody can be prepared by various technologies known to a person skilled in the art.For example, purifying hGDF3-2 gene outcomes or its there is antigenic fragment, animal can be applied to induce the generation of polyclonal antibody.Similar, expressing hGDF3-2 or its, there is the cell of antigenic fragment can be used to immune animal production antibody.The antibody of the present invention can also be monoclonal antibody, and such monoclonal antibody can be prepared using hybridoma technology(See Kohler et al., Nature 256;495, 1975;Kohler et al., Eur.J.Immunol. 6:51 1 , 1976;Kohler et al., Eur.J.Immunol. 6:292, 1976;Hammerling et al., In Monoclonal Antibodies and T Cell Hybridomas, Elsevier, N.Y., 1981).The antibody of the present invention includes that the antibody of hGDF3-2 functions can be blocked and does not influence the antibody of hGDF3-2 functions.Each antibody-like of the present invention can utilize fragment or the functional areas of hGDF3-2 gene outcomes, be obtained by common immunological techniques.These fragments or functional areas can prepare or utilize Peptide synthesizer synthesis using recombination method.The antibody combined with the unmodified form of hGDF3-2 gene outcomes can be immunized animal with the gene outcome of production in prokaryotic (such as Co/ /) and produce;The antibody (such as the albumen or polypeptide of glycosylation or phosphorylation) combined with posttranslational modification form, can be immunized animal with the gene outcome produced in eukaryotic (such as yeast or insect cell) and obtain.
The people's hGDF3-2 nucleotides full length sequence or its fragment of the present invention can generally be obtained with PCR TRAPs, recombination method or artificial synthesized method, for PCR TRAPs, can be according to relevant nucleotide sequence disclosed in this invention, especially open reading frame sequence designs primer, and obtain relevant sequence as template, amplification with commercially available cDNA storehouses or the cDNA storehouses as prepared by conventional method well known by persons skilled in the art.When sequence is longer, it is often necessary to carry out twice or multiple PCR is expanded, the fragment for then again amplifying each time is stitched together by proper order.
Once obtaining relevant sequence, it is possible to obtain relevant sequence in large quantity with recombination method, this is typically clone people carrier, then turns people's cell, then by conventional method from the host cell after propagation it is isolated about sequence.
In addition, can also synthesize relevant sequence with artificial synthesized method.Generally, by first synthesizing multiple small fragments, sequence very long fragment can be obtained by being then attached again.At present, it is already possible to encode the DNA sequence dna of albumen of the present invention (or its fragment, or derivatives thereof) by chemical synthesis completely.In addition, mutation can also be induced one in protein sequence of the present invention by chemical synthesis.
In addition to being produced with recombination method, the fragment of albumen of the present invention also can use solid phase technique, be produced by direct synthetic peptide(Stewart et al.,(1969) Solid-Phase Peptide Synthesis, WH Freeman Co., San Francisco; Merrifield J. ( 1963) J. Am Chem. Soc 85 :2149-2154) synthetic protein can be carried out by hand or automatically in vitro.For example, Applied Biosystems 43 1A type peptide symthesis can be used
Instrument (Foster City, CA) is automatically synthesized peptide, can distinguish each fragment of chemical synthesis albumen of the present invention, then chemically be connected to produce the molecule of total length.
The coded sequence of albumen of the present invention can be additionally used in the assignment of genes gene mapping.For example, by fluorescence in situ hybridization technique (FISH), the chromosome of cDNA clone and metaphase are hybridized, chromosome mapping can be carried out exactly.The technology ' to use the cDNA for being as short as about 500bp;It can also use long to about 2000bp or longer cDNA." in the technology, reference can be made to Verma et al., Human Chromosomes: A Manual of Basic Techniques, Pergamon Press, New York( 1988).
Once sequence is located in some exact position on chromosome, by can be associated with genetic map data by the physical location of sequence on chromosome.These genetic map datas can be obtained, for example, (can be obtained by Mendel (Mendelian) people genetic database by Johns Hopkins University Welch Medical Library on the net).Then, gene and the correlation being positioned between the disease of same chromosomal region are identified by linkage analysis,
Then, it is necessary to determine the difference in terms of the cDNA or genome sequence between diseased individuals and healthy individuals.If a certain mutation is present in part or all of diseased individuals but is not present in normal individual, then the mutation may be exactly the pathogenic factor of the disease.
Using albumen of the present invention, by various conventional screening assays, the material interacted with hGDF3-2 can be filtered out, such as acceptor, inhibitor or anti-agent is amassed wealth by heavy taxation.
Albumen and its antibody of the present invention, inhibitor, antagonist or acceptor etc., when being administered (administration) in the treatment, different effect can be provided usual, these materials can be formulated in nontoxic, inert and pharmaceutically acceptable aqueous carrier medium, wherein pH is typically about 5-8, preferably pH is about 6-8, although pH value can be varied from the property that is formulated material and illness to be treated.The pharmaceutical composition prepared can be administered by conventional route, including (but being not limited to):Intramuscular, intraperitoneal, subcutaneous, intracutaneous or local administration.
By taking people's hGDF3-2 albumen of the present invention as an example, it can be combined with suitable pharmaceutically acceptable carrier.This kind of pharmaceutical composition contains the protein and pharmaceutically acceptable carrier or excipient of therapeutically effective amount.This kind of carrier includes (but being not limited to):Salt solution, buffer solution, glucose, water, glycerine, ethanol, and combinations thereof.Pharmaceutical preparation should match with administering mode.The people hGDF3-2 albumen of the present invention can be made into injection form, and such as aqueous solution with physiological saline or containing glucose and other assistant agents is prepared by conventional method.The pharmaceutical composition of such as tablet and capsule etc, can be prepared by conventional method.Pharmaceutical composition such as injection, solution, tablet and capsule are preferably aseptically manufactured.The dosage of active component is therapeutically effective amount, such as the daily mg/kg body weight of about 1 microgram/kg body weight-about 5.In addition, the polypeptide of the present invention can be also used together with other therapeutic agents.
When people's hGDF3-2 polypeptides of the present invention are used as medicine, the polypeptide for the treatment of effective dose can be applied to mammal, the wherein treatment effective dose typically at least about 10 micrograms/kg body weight, and 8 mg/kg body weight are in most cases no more than about, preferably the dosage is the mg/kg body weight of about 10 micrograms/kg body weight one about 1.Certainly, specific dosage is also contemplated that the factors such as method of administration, patient health situation, within the scope of these are all ripe teacher's technical ability.Brief description
In the accompanying drawings, Fig. 1 is the Homology search figure of hGDF3-2 of the present invention and mouse GDF3 and people GDF3 (hGDF3) amino acid sequence.Wherein, identical amino acid is with marking below sequence, and similar amino acid is marked with " ".In an example of the present invention, people hGDF3-2 cDNA nucleotide sequences are so obtained, with people's marrow λ gt l l cDNA libraries(Purchased from Clontech companies)For template, synthesis forward primer A1: 5'- GGAGCTCTCCCCGGTCTGAC -3'、 A2:5'-CACTCCAGAGGCCATGCTTCG-3' and reversely bow thing B l: 5'- CCTAAGAACACTCCTTCTATTCC -3' 、 B2: 5'- CTAAGTGGTCATAAACCAGATTAGG-3.First expanded with the B2 primer pairs of A 1 in people's bone marrow cDNA library, then using the amplified production as template, with the primer pair amplifies of A2B 1, obtain 1 141 bp purpose fragment.SEQ ID NO are obtained after sequencing:5 full length cDNA sequence.
The nucleotide sequence of the present invention and its protein sequence of coding show high homology with mouse GDF-3 genes.Particularly, its homologue hGDF3 with GDF-3 in people is completely the same in the region in addition to 5 ends, both difference are only that the protein that they are encoded is different in the length of N-terminal, but the hGDF3-2 and mouse GDF-3 of present invention similarity degree is higher.According to the expression characteristics of hGDF3 in biological tissues, hGDF3-2 is considered as being likely to relevant with the bone and cartilage development of lymphocyte generation, RBC acceptor garland rate and embryo.In addition, people hGDF3 albumen is in embryonic carcinoma (embryonal carcinoma, EC) it is pointed out may to be worked as a kind of significant molecule of EC cell-specifics, and in the formation and maintenance of embryonic carcinoma stem cell the characteristics of specifically expressing in stem cell.With reference to specific embodiment, the present invention is expanded on further.It should be understood that these embodiments are only illustrative of the invention and is not intended to limit the scope of the invention.The experimental method of unreceipted actual conditions in the following example, generally according to normal condition such as Sambrook et al., molecular cloning:Laboratory manual (New York:Cold Spring Harbor Laboratory Press. 1989) described in condition, or according to the condition proposed by manufacturer.
Embodiment
Embodiment 1
HGDF3-2 bad the ij of cDN A sequences clone and measure
1. primer is expanded
With people, your zero λ gtllcDNA libraries (are purchased from Clomech companies)It is primer with two pairs of oligonucleotides for template --- A1: 5'- GGAGCTCTCCCCGGTCTGAC -3' (SEQ ID NO:And A2 1): 5'- CACTCCAGAGGCCATGCTTCG-3' (SEQ ID NO:2) it is forward primer, oligonucleotides Β 1:5'- CCTAAGAACACTCCTTCTATTCC -3' (SEQ ID NO :And B2 3): 5'- CTAAGTGGTCATAAACCAGATTAGG-3 (SEQ ID NO:4) it is reverse primer, enters performing PCR.First expanded with A1B2 primer pairs in people's bone marrow cDNA library, PCR conditions are 93 ' C 4 minutes, carried out 35 circulations therewith with 93'C1 minutes, 66'C1 minutes and 72'C1 minutes, last 72'C extends 5 minutes;Again using the amplified production as template, use A2B1 primer pair amplifies, PCR conditions be 93 °C 4 minutes, carry out within 1 minute within 1 minute and 72 °C 35 circulations, last 72'C extensions 5 minutes therewith with 93'C1 minute, 64 °C.' the obtained A2-B1 PCR segments of electrophoresis detection, 1141bp purpose fragment.
2. the sequencing of PCR primer
By pcr amplification product A2-B1 and pGEM-T carriers(Promega) connect, convert Escherichia coli JM103, plasmid is extracted with QIAprepPlasmid kits (QIAGEN), with double-strand nested type missing kit (Pharmacia) to insert people's fragment be oriented series of deletions, then Deleting mutants are carried out with PCR Rapid identification and
"ΓΜ
Sequence.The Deleting mutants truncated successively are sequenced with SequiTherm EXCEL DNA sequencing kits (Epicentre Technologies), finally with computer software splicing order, full length cDNA sequence is obtained, common 1141bp, detailed sequence is shown in SEQ ID NO:5, wherein open reading frame is located at 14-1105 nucleotides.
Full length cDNA sequence according to obtaining derives hGDF3-2 amino acid sequence, totally 363 amino acid residues, and its amino acid sequence refers to SEQ ID NO: 6.Embodiment 2
Homology search
First, the significant conserved sequence of TGF-P superfamilies is found that in the protein sequence that hGDF3-2 is encoded:
(L/I/V/M)X2PX2(F/Y)X4CXGXC ,
Wherein (L/I/V/M) represents any one amino acid in L, I, V, M, and X2 represents 2 arbitrary amino acids.In hGDF3-2, the sequence for meeting this feature is: 281 IIAPKGFMAN YCHGEC296.
Carry out nucleic acid and albumen homology retrieval with BLAST softwares in Non-redun nt GenBank+EMBL+DDBJ+PDB databases and Non-redundant GenBank CDS translations+PDB+SwissProt+Spupdate+PIR databases with hGDF3-2 full-length cDNA sequence and its encoding proteins.As a result find that they show that high homology is analyzed with PCGENE is soft with mouse GDF-3 and people hGDF3, its homogeneity and similitude with GDF-3 on protein level respectively reached 69.1% and 76.5 it be even more that except aminoterminal is identical with exterior domain, both difference is only the former nearly 50 residues more than the latter with hGDF3.Above-mentioned triangular relation is shown in Fig. 1.According to the homology between GDF-3, hGDF3 and hGDF3-2 and the length of their protein, it may be determined that hGDF3-2 and hGDF3 are that, by same gene code, their difference is due to the difference of gene-splicing form;Also, it is reasonable that hGDF3-2, rather than hGDF3, it is only real homologous genes of the mouse GDF-3 in people.Therefore, hGDF3-2 of the present invention has many and same or analogous functions of GDF-3 or hGDF3.
In adult mice, the transcription product of GDF-3 genes only organizes (such as thymus gland in minority, spleen, marrow etc.) in be found, generated and the effect (J.Biol.Chem. in RBC acceptor garland rate in lymphocyte which imply GDF-3, 1993, 268 (5), 3444-3449) Jones etc. are found that GDF3 expression illustrates that GDF-3 is also possible in skeleton development (the MoLEndo. that works in the bone and cartilaginous tissue of mid gestation embryo, 1992, 6, 1961-1968) is similar, hGDF3 expression also shows the characteristics of being confined in a small number of particular organizations(Oncogene, 1998,16,95- 103).
In addition, GDF-3 and hGDF3 are also specific expressed in EC stem cells.Research to hGDF3 shows, in the EC cell lines of all detections, differentiation capability or nourishing dependence regardless of the cell line, can easily detect hGDF3 transcription.Retinoic acid can induce cell differentiation.What is interesting is, under the long duration of action of retinoic acid, the hGDF3 levels of multipotency (pluripotent) EC cells are down to very low, and in differentiation termination (nuinpotent) EC cell lines, therefore the processing of retinoic acid does not cause the decline of hGDF3 expression, expression of the hGDF3 in people's EC cell lines is directly related with the phenotype of EC stem cells, and there is experiment to prove that hGDF3 has certain EC cell specific expressions, point out its possibility can be as a kind of significant molecule of EC cell-specifics.This feature can be used for differentiating and screen particular cell types it is noted that hGDF3 is located in 12p, and the region is noticeable due to the overexpression in CIS (carcinoma in situ), the strain of TGCT and TGCT derived cells.In summary, although the biological significance of the intercellular associations of GDF3 and EC is still unclear, but above phenomena all makes one to have reason to speculate that hGDF3 has played effect in the formation and maintenance of embryonic carcinoma stem cell(Oncogene, 1998, 16,95- 103).
The hGDF3-2 of the present invention as family's a member except that can be used for further functional study, it may also be used for fusion protein is produced together with other albumen, such as fusion protein is produced together with immunoglobulin.In addition, hGDF3-2 of the present invention can also be merged or be exchanged fragment with other members of the family, to produce new egg
In vain, the N-terminal of hGDF3-2 of the present invention N-terminal and hGDF3 or mouse GDF3 can for example be swapped, to produce new higher or with new features the albumen of activity.
For hGDF3-2 of the present invention antibody, other members for screening the family, or for affinity purification GAP-associated protein GAP (other members of such as family) embodiments 3
Expression of the hGDF3-2 in Escherichia coli
In this embodiment, hGDF3-2 cDNA sequence will be encoded(GenBank Accession No. AF064257) (because of application secrecy, therefore the gene order logged in before the application is not to public), expanded with the PCR Oligonucleolide primers at the 5' and 3' ends corresponding to the DNA sequence dna, obtain hGDF3-2 cDNA and be used as Insert Fragment.
The 5' Oligonucleolide primers sequences that use are in PCR reactions:
5 -ATACGGATCCATGCTTCGTTTCTTGCCAG-3'(SEQ ID NO:7), bow I things contain the restriction enzyme site of BamHI restriction enzymes, are 19 nucleotides by the hGDF3-2 coded sequences initiation codon after the restriction enzyme site;
3' ends primer sequence is:
5 -GTTAGTCGACCTACCCACACCCACATTCAT-3 (SEQ ID NO:8), the primer contains the partial coding sequence of the restriction enzyme site of Sail restriction enzymes, translation termination and hGDF3-2.
The restriction enzyme digestion sites that the restriction enzyme site of restriction enzyme on primer corresponds on bacterial expression vector pQE-9 (Qiagen Inc., Chatsworth, CA), plasmid vector coding antibiotic resistance (Ampr), bacterial origin of replication (ori), an IPTG- is adjustable promoter/operator (P/0), a ribosome bind site (RBS), a 6- histidine marks thing (6-His) and restriction enzyme cloning site.
With Bamffl and Sair digestion pQE-9 carriers and Insert Fragment, Insert Fragment is then connected to pQE-9 carriers and keeps open reading frame to be originated in bacterium RBS.Qiagen then is purchased from connection mixture conversion, trade name M15/rep4 bacterial strain, M15/rep4 contains the plasmid pREP4 of multicopy, it is expressed lacl repressors and carries kalamycin resistance (Kanf).Transformant is screened on the LB culture dishes containing Amp and Kan, plasmid is extracted, is identified with BamHI digestions and inserts people's clip size and direction, and sequence verification hGDF3-2 cDNA fragments correctly insert people's carrier.
The incubated overnight in the LB fluid nutrient mediums for adding Α π ι ρ (100 μ g/ml) and Kan (25 μ g/ml)(Ο/Ν) the positive transformant clone containing required construction.(0 Ν) culture is with 1 overnight: 100- 1:250 dilution rate dilution, is then seeded into large volume culture base, culture cell growth to 600 optical density (OD6。Q) be 0.4-0.6 when, add IPTG (" isopropylthio-β-D- galactosides ")To final concentration of lmM.By losing lacl repressors
Living, IPTG inductions, which start P/O, causes gene expression dose to improve.Continue to cultivate cell 3-4 hour, then centrifuge (6000 X g, 20 minutes).Ultrasonic degradation culture, collects cell pyrolysis liquid and is diluted in 6M guanidine hydrochloride.After clarification, by the way that under conditions of the albumen of label containing 6-His can be made to combine closely, the hGDF3-2 of dissolving is purified from solution with nickel-chelating column chromatography.HGDF3-2 is eluted from post with 6M guanidine hydrochlorides (pH5.0), protein precipitation can be denatured from guanidine hydrochloride with several method.Either guanidine hydrochloride being removed using dialysis step or purifying protein being isolated from nickel-chelate column, albumen after purification can be incorporated into second post, there is the linear guanidine hydrochloride gradient successively decreased in the post.The protein denaturation when being attached to the post, is then eluted with guanidine hydrochloride (PH5.0).Finally, by solvable protein to being dialysed containing PBS, then protein is stored in the storage liquid of final concentration of 10% (w/v) glycerine.
Electrophoresis is carried out with 12% SDS-PAGE glue, the molecular size range for identifying expressing protein is about 41KDa, in addition, the amino acid of each 10 amino acid lengths of the N-terminal and C-terminal of expressing protein is sequenced with conventional method, found and SEQ ID NO:6 sequence is consistent.Embodiment 4
HGDF3-2 is in eukaryotic (Chinese hamster ovary celI strain)In expression
In this embodiment, hGDF3-2 cDNA sequence will be encoded(GenBank Accession No. AF064257) expanded with the PCR Oligonucleolide primers at the 5' and 3' ends corresponding to the DNA sequence dna, obtain hGDF3-2 cDNA and be used as slotting people's fragment.
The 5' Oligonucleolide primers sequences that use are in PCR reactions:
5 - ATACGGATCCATGCTTCGTTTCTTGCCAG -3'(SEQ ID NO: 7)
The primer contains the restriction enzyme site of BamHI restriction enzymes, is 19 nucleotides by the hGDF3-2 coded sequences initiation codon after the restriction enzyme site;
3' ends primer sequence is:
5 - GTTAGAATTCCTACCCACACCCACATTCAT -3 (SEQ ID NO:9) primer contains the partial coding sequence of the restriction enzyme site of EcoRI restriction enzymes, translation termination and hGDF3-2.
The restriction enzyme digestion sites that the restriction enzyme site of restriction enzyme on primer corresponds on expressing cho cell carrier pcDNA3, plasmid vector coding antibiotic resistance (Amp1" and Ne0R) a, phage origin of replication (fl ori), a virus origin of replication (SV40 ori), a T7 promoter, a viral promotors (P-CMV), a Sp6 promoter, a SV40 promoter, a SV40 tailing signal and corresponding polyA orders, a BGH tailing signal and corresponding polyA orders
With BamHI and EcoRr digestion pcDNA3 carriers and Insert Fragment, then slotting people's fragment is connected to
PcDNA3 carriers.Then with connection mixture conversion/^^.Bacterial strain.Transformant is screened on the LB culture dishes containing Amp, incubated overnight (0/N) contains the clone of required construction in the LB fluid nutrient mediums for adding Α π ι ρ (100 μ g/ml), extract plasmid, Insert Fragment size and direction are identified with Pstl digestions, and sequence verification hGDF3-2 cDNA fragments have been correctly inserted into carrier.
Plasmid transfection Chinese hamster ovary celI is to use lipofection, is carried out with Lipofectin (GiBco Life), and transfection 48 is small
'-when after, lasting G418 through 2-3 pressurization screening, collects cell and cell conditioned medium determines expressing protein enzyme activity.Remove G418, continuous passage culture;To mixing clone cell Method of Limited Dilution, cell subclone of the selection with compared with high protein activity.The above-mentioned positive of mass propgation is subcloned according to a conventional method.After 48 hours, start to collect cell and supernatant, with ultrasonic degradation method smudge cells.Using 50mMTris HCl (pH7.6) solution containing 0.05%Triton as equilibrium liquid and eluent, the Peak Activity of above-mentioned albumen is collected with the Superdex G-75 posts through pre-equilibration.The DEAE-Sepharose posts balanced again with 50mMTris HCl (pH8.0), gradient elution is carried out by eluent of 50mMTris HCl (pH8.0) solution of the NaCl containing 0-1M, collects the Peak Activity of above-mentioned albumen.Then it is that dialyzate is dialysed to expressing protein solution with PBS (pH7.4).Finally freeze and preserve.
Electrophoresis is carried out with 12% SDS-PAGE glue, the molecular size range of expressing protein is identified for 4IKDa. in addition, the amino acid of each 10 amino acid lengths of the N-terminal and C-terminal of expressing protein is sequenced with conventional method, finds and SEQ ID NO:6 sequence is consistent.Embodiment 5
Prepare antibody
The recombinant protein that embodiment 3 or 4 is obtained is used for that animal is immunized to produce antibody, and specific as follows, recombinant molecule is standby after being separated with chromatography.Also it can be separated with PAGE gel electrophoresis, electrophoretic band is cut from gel, and with isometric complete Freund s adjuvant emulsions.The albumen emulsified with 50-100 μ g/0.2ml, intraperitoneal injection is carried out to mouse.After 14 days, with the same antigen of non-fully Freund s adjuvant emulsions, intraperitoneal injection is carried out with booster immunization with 50-100 μ g/0.2ml dosage to mouse.A booster immunization was carried out every 14 days, is at least carried out three times.The ability that the sero-fast idiosyncrasy activity obtained precipitates hGDF3-2 gene translation products with it in vitro is assessed.
All documents referred in the present invention are all incorporated as reference in this application, are individually recited just as each document as with reference to such.In addition, it is to be understood that after the above-mentioned instruction content of the present invention has been read, those skilled in the art can make various changes or modifications to the present invention, and these equivalent form of values equally fall within the application appended claims limited range.
Sequence table
(1) general information:
(ii) send out!Title:The sub- coded sequence of new human growth and differentiation factor 7, the polypeptide of its coding and preparation method
(iii) sequence number: 9
(2)SEQ ID NO:1 information
(i) sequence signature
(A) length:20 bases
(B) type:Nucleic acid
(C) chain:It is single-stranded
(D) topological structure:Linearly
(ii) molecule type:Oligonucleotides
(xi) sequence description: SEQ ID NO: 1
GGAGCTCTCC CCGGTCTGAC 20
(2)SEQ ID NO:2 information
(i) sequence signature
(A) length:21 bases
(B) type:Nucleic acid
(C) chain:It is single-stranded
(D) topological structure:Linearly
() molecule type:Oligonucleotides
(xi) sequence description: SEQ ID NO: 2
CACTCCAGAG GCCATGCTTC G 21
(2)SEQ ID NO:3 information
(i) sequence signature
(A) length:23 bases
(B) type:Nucleic acid
(C) chain:It is single-stranded
(D) topological structure:Linearly
(ii) molecule type:Oligonucleotides
(xi) sequence description: SEQ ID NO: 3
CCTAAGAACA CTCCTTCTAT TCC 23
(2)SEQ ID NO:4 information
(i) sequence signature
(A) length:24 bases
(B) type:Nucleic acid
(C) chain:It is single-stranded
(D) topological structure:Linearly
() molecule type:Oligonucleotides
(xi) sequence description: SEQ ID NO: 4
CTAAGTGGTC ATAAACCAGA TTAGG 24
(2)SEQ ID NO:5 information:
(i) sequence signature
(A) length: 1 141bp
(B) type:Nucleic acid
(C) chain:Double-strand
(D) topological structure:Linearly
(ii) molecule type: cDNA.
(xi) sequence description: SEQ ID NO: 5
CACTCCAGAC GCCATGCTTC GTTTCTTGCC AGATTTGGCT TTCAGCTTCC TGTTAATTCT GGCTTTGGGC CAGGCAGTCC AATTTCAAGA ATATGTCTTT CTCCAATTTC TGGGCTTAGA TAAGGCGCCT TCACCCCACA AGTTCCAACC TGTGCCTTAT ATCTTGAAGA AAATHTCCA GGATCGCGAG GCAGCGGCGA CCACTGGGGT CTCCCGAGAC TTATGCTACG TAAAGGAGCT GGGCGTCCGC GGGAATGTAC TTCGCTTTCT CCCAGACCAA GGTTTCTTTC TTTACCCAAA GAAAATTTCC CAAGCTTCCT CCTGCCTGCA GAAGCTCCTC TACTTTAACC TGTCTGCCAT CAAAGAAAGG GAACAGCTGA CATTGGCCCA GCTGGTGGAC TTGGGGCCCA AT CTTACTA TAACCTGGGA CCAGAGCTGG AACTGGCTCT GTTCCTGGTT CAGGAGCCTC ATGTGTGGCG
481 CCAGACCACC CCTAAGCCAG GTAAAATGTT TGTGTTGCGG TCAGTCCCAT GGCCACAAG'G
541 TGCTGTTCAC TTCAGCCTGC TGGATGTAGC TAAGGA Ji GG AATGACAACC CCCGGAAAAA
601 TTTCGGGTTA TTCCTGGAGA TACTGGTCAA AGAAAATAGA GACTCAGGGG TGAA Jis Ji CA
661 GCCTGAAGAC ACCTGTGCCA GACTAAGATG CTCCCTTCAT GCTTCCCTGC TGGTGGTGAC
721 TCTCAACCCT GATCAGTGCC ACCCTTCTCG GAAAAGGAGA GCAGCCATCC CTGTCCCCAA
781 GCTTTCT1¾T AAGAACCTCT GCCACCGTCA CCAGCTATTC ATTAACTTCC GGGACCTGGG
841 Ji GGCACAAG TGGATCATTG CCCCCAAGGG Ji fourth CATGGCA AATTACTGCC ATGGAGAGTG
901 TCCCTTCTCA CTGACCATCT CTCTCAACAG CTCCAATTAT GCTTTCATGC AAGCCCTGAT
961 GCATGCCGTT GACCCAGAGA TCCCCCAGGC TGTGTGTATC CCCACCAAGC TGTCTCCCAT
1021 TTCCATGCTC TACCAGGACA ATAATGACAA TGTCATTCTA CGACATTATG AAGACATGGT 1081 AGTCGATGAA TGTGGGTGTG GGTAGGATGT CAGAAATGGG AATAGAAGGA GTGTTCTTAG 1141 G
(2)SEQ ID NO:6 information:
(i) sequence signature
(A) length:363 amino acid
(B) type:Amino acid
(D) topological structure:Linearly
(ii) molecule type:Polypeptide
(xi) sequence is retouched:State: SEQ ID NO: 6
1 Met Leu Arg Phe Leu Pro Asp Leu Ala Phe Ser Phe Leu Leu lie
16 Leu Ala Leu Gly Gin Ala Val Gin Phe Gin Glu Ty「 Val Phe Leu
31 Gin Phe Leu Gly Leu Asp Lys Ala Pro Ser Pro His Lys Phe Gin
46 Pro Val Pro Tyr lie Leu Lys Lys lie Phe Gin Asp Arg Glu Ala
61 Ala Ala Thr Thr Gly Val Ser Arg Asp Leu Cys Tyr Val Lys Glu
76 Leu Gly Val Arg Gly Asn Val Leu Arg Phe Leu Pro Asp Gin Gly
91 Phe Phe Leu Tyr Pro Lys Lys He Ser Gin Ala Ser Ser Cys Leu
106 Gin Lys Leu Leu Tyr Phe Asn. Leu Ser Ala He Lys Glu Arg Glu
121 Gin Leu Thr Leu Ala Gin Leu Val Asp Leu Gly Pro Asn Ser T r
136 Tyr Asn Leu Gly Pro Glu Leu Glu Leu Ala Leu Phe Leu Val Gin
151 Glu Pro His Val Trp Arg Gin Th「 Th「 Pro Lys Pro Gly Lys Met
166 Phe VaT Leu Arg Ser Val Pro Trp Pro Gin Gly Ala Val His Phe
181 Ser Leu Leu Asp Val Ala Lys Asp Trp Asn Asp Asn Pro Arg Lys
196 Asn Phe Gly Leu Phe Leu Glu He Leu Val Lys Glu Asn Arg Asp
211 Ser Gly Val Asn Phe Gin Pro Glu Asp Thr Cys Ala Arg Leu Arg
226 Cys Ser Leu His Ala Ser Leu Leu Val Val Thr Leu Asn Pro Asp
241 Gin Cys His Pro Ser Arg Lys Arg Arg Ala Ala lie Pro Val Pro
256 i ¾eu Ser Cys Lys Asn Leu Cys His Arg His Gin Leu Phe He
271 Asn Phe Arg Asp Leu Gly Trp His Lys Trp He lie Ala Pro Lys
286 Gly Phe Met Ala Asn Tyr Cys His Gly Glu Cys Pro Phe Ser Leu
301 Thr lie Ser Leu Asn Ser Ser Asn Tyr Ala Phe Met Gin Ala Leu
316 Met His Ala Val Asp Pro Glu lie Pro Gin Ala Val Cys He Pro
331 Thr Lys Leu Ser Pro He Ser Met Leu Tyr Gin Asp Asn Asn Asp
346 Asn Val lie Leu Arg His Tyr Glu Asp Met Val Val Asp Glu Cys
361 Gly Cys Gly
(2)SEQ ID NO:7 information
(i) sequence signature
(A) length:29 bases
(B) type:Nucleic acid
(C) chain:It is single-stranded
(D) topological structure:Linearly
(ii) molecule type:Oligonucleotides
(xi) sequence description: SEQIDNO: 7
ATACGGATCC ATGCTTCGTT TCTTGCCAG
(2)SEQ ID NO:8 information
(i) sequence signature
(A) length:30 bases
(B) type:Nucleic acid
(C) chain:It is single-stranded
(D) topological structure:Linearly
(ii) molecule type:Oligonucleotides
(xi) sequence description: SEQIDNO: 8
GTTAGTCGAC CTACCCACAC CCACATTCAT
(2)SEQ ID NO:9 information
(i) sequence signature
(A) length:29 bases
(B types:Nucleic acid
(C) chain:It is single-stranded
(D) topological structure:Linearly
(ii) molecule type:Oligonucleotides
(xi) sequence description: SEQ ID NO: 9
GTTAGAATTC CTACCCACAC CCACATTCAT
Claims (14)
- Claims1. a kind of DNA molecular isolated, it is characterised in that it includes:The nucleotide sequence of polypeptide of the coding with people's hGDF3-2 protein actives,Described nucleotide sequence and SEQ ID NO:In 5 from nucleotides 14- 1 105 nucleotides sequence show at least 70% homologous orDescribed nucleotide sequence can under medium stringency conditions with SEQ ID NO:From the nucleotide sequence hybridization of 14-1105, nucleotides in 5.2. DNA molecular as claimed in claim 1, it is characterised in that the described polypeptide of sequential coding one, the polypeptide has SEQ ID NO:Sequence shown in 6.3. DNA molecular as claimed in claim 1, it is characterised in that the sequence is SEQ ID NO:The sequence of 5 nucleotides 14-1105.4. the hGDF3-2 polypeptides of a kind of separation, it is characterised in that it includes:With SEQ ID NO:The polypeptide of six amino acid sequence or its active fragment, or its reactive derivative.5. polypeptide as claimed in claim 4, it is characterised in that the polypeptide is with SEQ ID NO:The polypeptide of 6 sequences.6.-kind of carrier, it is characterised in that it contains the DNA described in claim 1.7.-kind of the host cell converted with carrier described in claim 6.8. host cell as claimed in claim 7, it is characterised in that the cell is Escherichia coli.9. host cell as claimed in claim 7, it is characterised in that the cell is eukaryotic.10.-kind of the method for producing the polypeptide with hGDF3-2 protein actives, it is characterised in that this method includes:(a) nucleotide sequence for encoding the polypeptide with hGDF3-2 protein actives is operably coupled to expression regulation sequence, form hGDF3-2 protein expression vectors, described nucleotide sequence and SEQ ID NO:Shown in 5 from nucleotides 14- 1 105 nucleotides sequence at least 70% homology;(b) expression vector in step (a) is transferred to host cell, forms the recombinant cell of hGDF3-2 albumen;(c) under conditions of expression hGDF3-2 polypeptides are adapted to, the recombinant cell in incubation step (b);(d) polypeptide with hGDF3-2 protein actives is isolated.1 1. methods as claimed in claim 10, it is characterised in that the sequence is SEQ ID NO:From nucleotides 14- 1 105 in 5.12.-kind of the antibody that can be specifically bound with the hGDF3-2 polypeptides described in claim 4.13.-kind of nucleic acid molecule, it is characterised in that it is the antisense sequences of DNA molecular described in claim 1.14. a kind of probe molecule, it is characterised in that it contains 8-100 continuous nucleotide in DNA molecular described in claim 1.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 99811046 CN1318101A (en) | 1998-09-22 | 1999-09-06 | New human growth differentiation factor encoding sequence and polypeptide encoded by such DNA sequence and producing method thereof |
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN98119759 | 1998-09-22 | ||
CN98119759.0 | 1998-09-22 | ||
CN 99811046 CN1318101A (en) | 1998-09-22 | 1999-09-06 | New human growth differentiation factor encoding sequence and polypeptide encoded by such DNA sequence and producing method thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
CN1318101A true CN1318101A (en) | 2001-10-17 |
Family
ID=34195581
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 99811046 Pending CN1318101A (en) | 1998-09-22 | 1999-09-06 | New human growth differentiation factor encoding sequence and polypeptide encoded by such DNA sequence and producing method thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN1318101A (en) |
-
1999
- 1999-09-06 CN CN 99811046 patent/CN1318101A/en active Pending
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US6656708B1 (en) | Human growth differentiation factor encoding sequence and polypeptide encoded by such DNA sequence and producing method thereof | |
ES2301208T3 (en) | COMPOSITIONS OF POLINUCLEOTIDE AND PROSTATE TUMOR ANTIGEN. | |
CN1313900A (en) | Novel human lysozyme gene, its encoding polypeptide and the method preparing for them | |
US7544485B2 (en) | Baldness related gene and the polypeptide encoded thereby, and uses | |
CN1318101A (en) | New human growth differentiation factor encoding sequence and polypeptide encoded by such DNA sequence and producing method thereof | |
US6893844B1 (en) | DNA encoding a new human hepatoma derived growth factor and producing method thereof | |
CN1313897A (en) | New gene of humanlysoenzyme, the encoding polypeptide and methods for preparing them | |
CN1313899A (en) | Novel human lysozyme gene, its encoding polypeptide and the method for preparing them | |
CN1287171A (en) | Human neuron calcium sensing protein and its code sequence, preparation and use | |
CN1615361A (en) | Liver cancer deriving growth factor 5 of human, it coding sequence, preparation and use thereof | |
CN100355782C (en) | New liver cancer up expressing gene and its encoded protein and application | |
CN1778816B (en) | Human cell surface membrane molecule and use thereof | |
CN1318100A (en) | New human hepatoma-derived growth factor encoding sequence and polypeptide encoded by such DNA sequence and producing method thereof | |
CN1313901A (en) | Novel human lysozyme gene, its encoding polypeptide and the method for preparing them | |
CN100443501C (en) | Mitochondria traffic protein molecule for human marrow stromal cell and sequence encoding same and use thereof | |
CN100358917C (en) | Tumor tag and the use thereof | |
CN100543133C (en) | Phosphokinase and application thereof | |
CN100381466C (en) | Human pifl gene, its coding protein and use thereof | |
CN100384481C (en) | Blastocyst implantation related factor and its uses | |
CN100415299C (en) | Correlation factor of blastocyst nidation and application | |
JP3028847B2 (en) | Mouse gp130 protein | |
CN1290747A (en) | New human metal thioalbumen and its coding sequence | |
CN1287169A (en) | New human G protein protomer and its code sequence | |
JPH1132783A (en) | Hfizg 53 polynucleotide and polypeptide | |
CN1668640A (en) | Tumour tag and use thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C12 | Rejection of a patent application after its publication | ||
RJ01 | Rejection of invention patent application after publication |