CN1215178C - Genetic-sorting model of zinc finger-protein-DNA interaction and use thereof - Google Patents

Abstract

The present invention discloses a genetic screening model of the interaction of zinc finger protein and DNA and an application thereof. The goal of the present invention is to provide a simple universal genetic screening model which researches on the interaction of zinc finger protein and DNA and is established in colibacillus. The genetic screening model of the interaction of zinc finger protein and DNA provided by the present invention contains colibacillus of reporter plasmid, the report plasmid contains a spectinomycin resistance gene aadA, the upstream of spectinomycin resistance gene contains a self promoter PaddA of the aadA gene, and the downstream of the spectinomycin resistance gene aadA contains a constitutive promoter with an opposite direction with the promoter PaadA and the strength higher than that of PaddA. The combination sequence of zinc finger mouse transcription factors Aif 268 is inserted in the operation sequence of the constitutive promoter.

Description

Interactional genetic screening model of zinc finger protein-DNA and application thereof

Technical field

The present invention relates to a kind of genetic model and the application thereof of biology field, particularly relate to interactional genetic model of research zinc finger protein-DNA and application thereof.

Background technology

The interaction of protein-dna is a molecular biological important research content.DNA is conjugated protein to be divided into different families, wherein classic zinc finger protein have structure conservative, relative relatively with DNA effect simple, discern characteristics such as dna sequence dna high special, be to study the interactional desirable object of protein-dna.At present, adopt different strategies both at home and abroad, the DNA identification specificity of zinc finger protein has been carried out broad research and obtained very big progress, but these strategies have a common defective, promptly all be outside organism or carry out in the object half a lifetime, can't really reflect the effect characteristics under the physiological condition.

Summary of the invention

The purpose of this invention is to provide a kind of being based upon in the intestinal bacteria, the interactional genetic screening model of simple, general research zinc finger protein-DNA.

The interactional genetic screening model of zinc finger protein-DNA provided by the present invention, be to contain the intestinal bacteria of reporting plasmid, described report plasmid contains spectinomycin resistance gene aadA, and aadA gene self promotor P is contained in the upstream of spectinomycin resistance gene aadA _AddA, direction and promotor P are contained in the downstream of spectinomycin resistance gene aadA _AddAOn the contrary, and intensity be higher than P _AddAThe composition promotor; In the manipulation sequence of described composition promotor, insert the binding sequence of zinc finger protein mouse transcription factor Zif268.

In order to be more conducive to operation, described report plasmid is single copy.

The present invention refers to that with classic zinc mouse transcription factor Zif268 is a material dexterously, interference phenomenon (Elledge SJ is transcribed in utilization, et al.Position and density effects on repression by stationaryand mobile DNA-binding proteins.Genes Dev.1989,3 (2): 185-197; Elledge SJ, et al.Genetic selection for genes encoding sequence-specific DNA-bindingproteins.Proc Natl Acad Sci USA.1989,86 (10): 3689-3693), in intestinal bacteria, set up a kind of simple, the interactional genetic screening model of general research zinc finger protein-DNA, can be used for disclosing the DNA identification rule of zinc finger protein, screening, specific DNA is conjugated protein for implementation sequence, human intervention is carried out in expression to Disease-causing genes such as specific gene such as HIV, realize the effective prevention and the treatment of specified disease, have important theory and practice significance.

Principle of the present invention is as shown in Figure 1: contain spectinomycin resistance gene aadA on the report plasmid, respectively contain a promotor P in the upstream and downstream of this gene _AddA, P _ConII, the promotor P of its middle and upper reaches _NddABe the promotor of aadA gene self, the promotor P in downstream _ConIIIt is a synthetic composition promotor, will be on the intensity far above the promotor of upstream, direction in contrast, so under the normal circumstances, the promotor in downstream can be disturbed the aadA gene transcription by composition, makes that containing the host who reports plasmid shows as the responsive Sp of spectinomycin ^s, this is the so-called interference of transcribing.At composition promotor P _ConIIBinding sequence corresponding to the position insertion Zif268 that handles sequence Op makes P _ConIIBecome by the composition promotor and can regulate promotor, used P _ConII-ZFExpression has promptly made up the report plasmid that can be regulated by zinc finger protein, and the host of containing this report plasmid shows as the responsive Sp of spectinomycin ^sIf, in the host, introduce an expression library again, wherein there is a clone can produce a zinc finger protein mutant, this mutant can specific identification and in conjunction with the Op site, at this moment, P _ConII-ZFWhat start transcribes and will be blocked, and the aadA gene will be transcribed under the effect of self promotor, and the host is just changed spectinomycin resistance Sp into ^rAccording to the appearance of spectinomycin resistance, just can screen the zinc finger protein mutant that obtains discerning specific site.

Report plasmid of the present invention can be specifically from about 10 ⁴-10 ⁵Mixture in expression plasmid is screened, have sufficient susceptibility.Genetic screening model in the body that the present invention makes up is can set up the library size, disclose amino acid-base action rule or reflect that true zinc finger protein-aspects such as DNA effect characteristics all show to have certain superiority than phage under the physiological condition.

Description of drawings

Fig. 1 is the schematic diagram of genetic screening model of the present invention.

Fig. 2 is the sequencing electrophorogram of report plasmid pConII-Δ ZB.

Fig. 3 is the pcr amplification electrophorogram of the DNA land of Zif268.

Fig. 4 is that the double digestion of expression plasmid pGEX-D is identified (EcoR I+BamH I) electrophoretogram.

Fig. 5 is the sequencing collection of illustrative plates of expression plasmid pGEX-D.

Fig. 6 is the electrophoretogram behind the fusion rotein GST-D purifying.

Fig. 7 is the gel retardation test electrophoretogram of zinc finger protein DNA land.

Fig. 8 is the eclipsed form pcr amplification in zinc finger protein sudden change library electrophorogram as a result.

Embodiment

In the following embodiments, related materials and methods is as follows:

PBKS-Zif268 buys from ATCC.

Express the LB-Zif substratum of zinc finger protein: it consists of and add 100 μ M ZnCl on the basis of LB ₂, 100 μ g/ml L-tyrosine, the IPTG of the HEPES of 20mM (transferring pH7.0) and different concns, penbritin 100 μ g/ml with NaOH.Toolenzyme, biochemical reagents commonly used etc. are company and homemade analytical pure products such as Biolab, Promega.Conventional Protocols in Molecular Biology is referring to " molecular cloning experiment guide " (Science Press, 1992)

The structure of embodiment 1, report plasmid

Core the recognition sequence 5 '-AGCGTGGGCGG-3 ' that selects Zif268 is as handling sequence, synthetic two complementary oligonucleotide fragment P1, P2.Synthetic fragment is mixed annealing, and the big fragment polymerization of archaeal dna polymerase is extended.Extend fragment after Not I, Hind III enzyme are cut digestion, 15% polyacrylamide gel purifying, with same digestion with restriction enzyme and through the big fragment of the plasmid pNN388 of electrophoresis purifying be connected, transformed into escherichia coli.The picking mono-clonal is cut evaluation, sequencing through enzyme, obtains the correct report plasmid pConII-Δ ZB of sequence (it identifies that collection of illustrative plates as shown in Figure 2).In the report plasmid, the binding site of Zif268 is positioned at-4 as the manipulation sequence of promotor ConII.

P1：5’-GGTGGCAAGCTTGCATG-3’

P2：5’-GGTAGCGGCCGCCTGTTGACAATTAATCATCGGCTCGTATAATGCAAGCGTGGGC

GGCTGCAGGCATGCAAGCTTGCCACC-3’

Holding the 5-12 bit base from 5 ' among the P2 is Not I site, is the HindIII site from 5 ' end 70-75 bit base, is the binding site ZB of Zif268 from 5 ' end 47-57 bit base.

The spectinomycin sensitivity test of embodiment 2, report plasmid

After will reporting plasmid pConII-Δ ZB conversion JM109, picking mono-clonal overnight incubation is got and is carried out the bed board test after overnight culture is diluted, and the result is as shown in table 1.

The spectinomycin susceptibility of table 1, different report plasmids

The experiment group	Plasmid	Antibiotic concentration (μ g/ml)
									Cm40	Sp50	Sp80	Sp120	Sp150	Sp200	Sp300
		1 2 3	pNN388 pConII-ΔZB pConII-1	+ + +	+ + +	+ + -	+ - -	+ - -								+ - -	+ - -

+：grow；-：not grow pConII-1：positive contra

As can be seen from Table 1: because pNN388 contains chloramphenicol resistance gene, spectinomycin resistance gene aadA normal expression, so JM109 (pNN388) stable growth (experiment 2) all on all resistant panel, consistent with expection.Report plasmid pConII-Δ ZB the same with positive control pConII-1 (the manipulation sequence of pConII-1 is the binding site of 434 inhibitions), susceptibility (120 μ g/ml to spectinomycin, 80 μ g/ml) all be lower than original plasmid pNN388 (300 μ g/ml), illustrate: do not transcribing inhibition when being Zif268, containing ZB can effectively start as the promotor of handling sequence, reverse interference spectinomycin resistance gene aadA transcribes, make the report plasmid show as spectinomycin susceptibility in various degree, and pConII-Δ ZB have the screening " window " (120-300 μ g/ml) of broad.

As a report plasmid, the problem that also has needs to consider is exactly because " ground unrest " that causes with chromosomal integration, copy number increase, reverse mutation etc., table 2 then further shows: pConII-Δ ZB " answer " mutation frequency when spectinomycin is 120 μ g/ml is extremely low, fully can be as the report plasmid of genetic screening, for next step experiment of carrying out in the born of the same parents lays the foundation.

" ground unrest " of table 2, report plasmid pConII-Δ ZB

Plasmid	Clone's number *
			Cm40	Sp120
	pConII-ΔZB pNN388 pConII-1	1 1 1			(25+3.2)×10 -6 1 (13.1±4.2)×10 -6

^*: with the dull and stereotyped corresponding clone's number of Cm is 1 N=3

The expression of DNA land in intestinal bacteria of embodiment 3, Zif268

The DNA calmodulin binding domain CaM of Zif268 is made up of three placed in-line zinc finger proteins, according to the sequence of Zif268, and synthetic primer P _DN, P _DC, two ends are added EcoR I, BamH I restriction enzyme site, P respectively _DCThe end add termination codon TGA, TAA.Its sequence is as follows:

PDN:5 '-AA GGATCCGAACGCCCATATGCTTG-3 ' is corresponding to the aminoterminal of DNA land

PDC:5 '-ACG GAATTCTTATCAGTCCTTCTGTCTTAAATGG-3 ' is corresponding to the carboxyl terminal of DNA land

With P _DN, P _DCBeing primer, is template with the plasmid pBKS-Zif268 that contains the zif268 full-length cDNA, 53 ℃ of annealing, and 72 ℃ of extensions obtain containing the DNA land fragment D (result is as shown in Figure 3) that three zinc refer to.Pcr amplified fragment adopts the Promega Wizard of company ^TMPCR Preps dna purification system carries out purifying, product behind the purifying is inserted into the corresponding site of pGEX-2T after BamH I, EcoR I enzyme are cut, connect transformed into escherichia coli DH5 α MCR, the picking mono-clonal, carrying out plasmid size, enzyme cuts and identifies and sequencing, obtain the right-on expression plasmid pGEX-D of sequence, assay such as Fig. 4, shown in Figure 5).

Select mono-clonal inoculation 5ml LB-Zif substratum, overnight incubation is got overnight culture in 2% ratio and is inoculated in shake-flask culture 2-3 hour to OD ₆₀₀=0.3-0.5 induces with the IPTG of 40 μ M, 25-30 ℃ of inducing culture 3-4hr, and the result confirms that (as shown in Figure 6) target protein has obtained expression in intestinal bacteria.

The purifying of embodiment 4, fusion rotein

Thalline is cultivated in centrifugal collection, and the thalline carrying out ultrasonic bacteria breaking is added Triton X-100 to final concentration 1%, the mild stirring hydrotropy.Centrifugal, keep the supernatant that contains target protein, mix with ready glutathione S epharose 4B, make target protein combination with it.A part of with the elutriant wash-out that contains gsh, obtain fusion rotein, another partly cuts with zymoplasm, the wash-out of going again separates, obtain Thiadiazolidine isomerase and zinc finger dna land respectively, purification result shows (as shown in Figure 6): utilize affinity chromatography can obtain special fusion rotein GST-D, and fusion rotein is under the effect of zymoplasm, can obtain free target protein D in special being cut in position of fusion place.In addition, contain tangible fusion rotein at the carrying out ultrasonic bacteria breaking supernatant, this shows that under specific culture condition target protein is partly solubility expression in born of the same parents.

The DNA binding characteristic of embodiment 5, Zif268 DNA land

Get the fusion rotein GST-D of the DNA land of containing Zif268 that purifying obtains or DNA land albumen separately, carry out the sluggish experiment of DNA attached gel migration, its external binding characteristic is analyzed.The result as shown in Figure 7, A partly is independent DNA land among the figure, B partly is a fusion rotein, shows: no matter be fusion rotein, or independent DNA land, all kept and particular target site bonded characteristic, because in the whole purge process, target protein is not carried out steps such as renaturation, this shows that Zif268 DNA land has obtained functional expression in intestinal bacteria, and the fusion of GST and DNA land does not have the obvious DNA binding characteristic that influences zinc finger protein.

The foundation of genetic screening model in embodiment 6, the body

Get pGEX-D (expression plasmid of zinc finger protein DNA land), pGEX-2T (glutathione s transferase fusion expression vector) and transform the e. coli jm109 that contains report plasmid pConII-Δ ZB and pConII-1, pNN388 respectively, carry out the bed board experiment, the result is as shown in table 3.

Genetic screening model in the body of table 3, zinc finger protein

The experiment group	The contained different plasmids of JM109	The transformant number		％ Ap rSp r/Ap rCm r
					Ap rCm r	Ap rSp r
		1 2 3 4 5 6 7 8 9 10 11 12	Plasmid-free pGEX-2T pGEX-D pNN388 pConII-1 pConII-Δ ZB pNN388+pGEX-2T pNN388+pGEX-D pConII-1+pGEX-2T pConII-1+pGEX-D pConII-Δ ZB+pGEX-2T pConII-Δ ZB+pGEX-D				0 0 0 0 0 0 1/1 1/1 1/1 1/1 1/1 1/1	0 0 0 0 0 0 1/1 1/1 10 -5/10 -5 10 -5/10 -5 10 -5/10 -5 1/10 -5	- - - - - - 100/100 100/100 0 0 0 100/0

N/M:IPTG induces/clone number or the per-cent of IPTG under not inducing, and with Ap ^rCm ^rOn the conversion subnumber be 1

1-6 finds by experiment: JM109 or when only containing a kind of plasmid, at two anti-dull and stereotyped Ap separately ^rSp ^r, Ap ^rCm ^rAll can not grow, consistent with expection, this shows that there be not significantly " ground unrest " in selected host, plasmid.

In group 7-11, when JM109 contains expression, two kinds of plasmids of report simultaneously, at Ap ^rCm ^rLast stable growth, the resistance marker that two kinds of plasmids are described is good, and be the consistency plasmid, can in JM109, stablize coexistence, and no matter have or not IPTG to induce, the no significant difference of growth illustrates GST and Expression of Fusion Protein thereof on two kinds of two anti-flat boards, can non-ly not influence the functions such as expression of the duplicating of plasmid pNN388, pConII-1, pConII-Δ ZB, resistant gene specifically.

In experiment 7-8, JM109 is at Ap ^rSp ^r, Ap ^rCm ^rTwo kinds of two anti-dull and stereotyped indifferences of growing of going up, and among the experiment 9-11, Ap ^rSp ^rAlmost aseptic dropping out now on the flat board.This is owing to no reverse promotor among the pNN388, spectinomycin resistance gene meeting constructive expression therefore show as the spectinomycin resistance, and plasmid pConII-1, pConII-Δ ZB is owing to contain reverse promotor, the spectinomycin expression of gene is inhibited, therefore at Ap ^rSp ^rHave only the minute quantity bacterium colony to occur (10 on the flat board ^-6), this " ground unrest " that also shows report plasmid pConII-1, pConII-Δ ZB simultaneously is extremely low, conforms to embodiment 2 results.

In experiment 12, contain special expression plasmid of zinc finger protein and report plasmid among the JM109, when not having IPTG to induce, at Ap ^rSp ^rAlso have only a small amount of colony growth on the flat board, belong to " ground unrest " of pConII-Δ ZB, but when IPTG induces, all Ap ^rCm ^rThe clone can be rendered as Ap ^rSp ^rResistance (Ap ^rSp ^r/ Ap ^rCm ^r=100%).Experiment 1-12 shows jointly: the expression specificity ground of the zinc finger protein DNA land of plasmid pGEX-D mediation refers to that with zinc on reporting plasmid pConII-Δ ZB binding site combines, and stops reverse promotor P _{ConII-Δ ZB}Composition start, make that resistant gene aadA is able to express under the startup of self promotor, show as the spectinomycin resistance, this also illustrates genetic screening model in the body of so far having set up zinc finger protein.

The screening efficiency of genetic screening model assessment in embodiment 7, the body

Because final purpose is to utilize above-mentioned experiment, carries out mutant choice, therefore need to determine specificity, the susceptibility of whole test.In order to investigate the potentiality of utilizing above-mentioned test from huge library, to screen rare clone, with the pGEX-2T dilution of plasmid pGEX-D with different amounts, carry out bed board then, can discussion screen the plasmid of expressing zinc finger protein specifically from a mixture, found that: the report plasmid can be specifically from about 10 ⁴-10 ⁵Mixture in expression plasmid is screened, have sufficient susceptibility, the usefulness of the library screening of enough having suddenlyd change.For those rare clones (1/10 ⁸), through multi-turns screen (3-4 wheel), promptly can be from a library screened come out.

Embodiment 8, zinc refer to the foundation in 1 key position completely random sudden change library

For inquiring into the interaction between amino acid-base in the recognition helix comparatively up hill and dale, consider the size that to operate the library simultaneously, under the situation that conservative property His+7 is constant in keeping recognition helix, make+4 amino acid is leu or Arg, + 9 amino acid is Arg or Lys, other position randomization of general-1-+8 position.Design primer P in view of the above _MS, P _MR, being used for zinc and referring to 1 sudden change, its sequence is as follows:

P _MS：3’-GACCGGACACACCTACGC CTAGAT-5’

P _MR：

5’-CTGGCCTGTGTGGATC _T/CTKNNATG(KNN) ₂AA/CG(KNN) ₄AGAAAAGCGGCGCTAGCAGGA-3’

Adopt the eclipsed form round pcr, by three PCR reactions, zinc is referred to the Nucleotide of the key position of 1 (ZF1) suddenlys change, its PCR result as shown in Figure 8.By finding among the figure: in eclipsed form PCR, amplified production is about 240bp for the second time, consistent with expection, though with first and second time product is the big or small about 280bp of going up of the D* of amplified production for the third time of template, but not to present tight single band, supposition is because the PCR product itself has bigger molecular diversity, reaches 10 ¹¹, and the charge property between the differing molecular has small difference, therefore shows heterogeneity in swimming.

After the PCR product reclaims, cut through E.coR I, BamH I enzyme, is connected with the expression vector pGEX-2T that handled through same restriction enzyme, connects product after dissolving the reduction electricity with 0.5 * TE again and leading, selection 2.4KV, 4k Ω condition shock by electricity, conversion MC1061.Electric shock transforms 10 times simultaneously, has obtained about 10 ⁸-10 ⁹Transformant, this is elementary library.

Reclaim all transformants, a large amount of overnight incubation in containing the 1L LB substratum of 100 μ g/ml, the elementary library of increasing.Collect overnight culture, carry out a large amount of preparations and the purifying of plasmid, obtain expression plasmid library pGEX-D*, be divided into different equal portions ,-20 ℃ of preservations are standby.

Embodiment 9, the conservative sublocus GCG of identification are with the merit mutant choice

Get and contain the e. coli jm109 (pConII-Δ ZB) of reporting plasmid, prepare electric transformed competence colibacillus, carry out electricity with the expression plasmid library DNA for preparing then and transform, screen.

Because the report plasmid can increase owing to copy number once in a while, to cause phenotype to change into the spectinomycin resistance by the spectinomycin sensitivity be false-positive appearance for integration and point mutation etc., " ground unrest " improved, for getting rid of this interference, we are after each takes turns screening, the clone that will show as the spectinomycin resistance prepares plasmid again, be transformed into and contain in the bacterial strain of reporting plasmid, carry out the screening of next round.In addition, owing to contain expression plasmid and report plasmid in the resistance transformant simultaneously, when preparation DNA transforms again, might simultaneously the report plasmid that contains be transformed into same escherichia coli host, for overcoming this influence, select that distinctive restriction enzyme Hind III digests on the report plasmid, make it to become linear, and then transform.

Through after the above processing, as shown in table 5, along with the carrying out of screening, the ratio (Ap that resistance clone is shared ^rSp ^r/ Ap ^rRatio) obviously increase.After the four-wheel, the enrichment multiple reaches 10 ⁴, Ap ^rSp ^r/ Ap ^rRatio is near 1, and the picking mono-clonal carries out the plasmid preparation, and Hind III digestion transforms JM109, carries out the plasmid preparation again, and sequencing obtains 20 clones, and its sequence and correlation properties are shown in table 6,7.

Table 5, mutant choice

The screening wheel number	Bioaccumulation efficiency (Ap rSp r/Ap rCm r)
		1 2 3 4	10 -6 2×10 -4 0.02 0.85

The sequence of table 6, mutant and characteristic

The clone	Frequency	Amino acid position in the spiral										Charged residue number	The PH7.0 net charge	Binding characteristic fGCG in the body
															-1	1	2	3	4	5	6	7	8	9
		WT MT1 MT2 MT3 MT4 MT5 MT6 MT7 MT8 MT9 MT10 MT11 MT12 MT13 MT14 MT15	1 1 2 1 1 3 1 2 1 1 1 1 1 2 1 20	X R R K R K R R K R K R D K K R Q R/K	X S L V E E R S S G D D P S G S V X	X D Q D D Y E D C P C D A N C D H D	X E T L V D V E D D V D D V Q E V D/E/V	R L L L L R L L R L R L L L L L L L	X T K W I T Q T G A G T K H D T R X	X R K T R R R R R R R R R P S R T R	H H H H H H H H H H H H H H H H H H														X I G P G W T I N G F I E A T I E X	K R K R K R R R K R K R R R R R K R/K	6 5 4 6 7 6 6 6 5 6 7 7 4 4 6 5	+2 +5 +3 +2 +2 +4 +2 +4 +4 +4 +1 +1 +4 +2 +2 +3	0.85 0.73 0.74 0.87 0.91 0.86 0.91 0.80 0.74 0.87 0.76 0.59 0.80 0.81 0.76 0.73

f _GCG: binding specificity constant in the body transforms positive colony proportion Ap when containing the JM109 that reports plasmid again with different mutants ^rSp ^r/ Ap ^rCm ^r

Table 7, zinc refer to the bias of different positions upper amino acid in 1

The position	Amino acid	P e	P f	δ 32	(P f-P e)/δ 32
						-1 +2 +3 +4 +6 +9	R(Arg) K(Lys) D(Asp) Q(Gln) D(Asp) C(Cys) Q(Gln) D(Asp) E(Glu) V(Val) L(Leu) R(Arg) R(Arg) T(Thr) K(Lys) R(Arg) K(Lys)	3/32 1/32 1/32 1/32 1/32 1/32 1/32 1/32 1/32 2/32 3/32 3/32 3/32 2/32 1/32 3/32 1/32	12/20 6/20 1/20 1/20 9/20 3/20 1/20 6/20 5/20 6/20 17/20 3/20 15/20 2/20 1/20 14/20 6/20	0.052 0.031 0.031 0.031 0.031 0.031 0.031 0.031 0.031 0.043 0.052 0.052 0.052 0.043 0.031 0.052 0.031	9.73 8.68 0.61 0.61 13.5 3.84 0.61 8.68 7.06 5.52 14.5 1.08 12.6 1.23 0.61 11.7 8.68

P _e: in the completely random library, the expection frequency of occurrences: P _f: the actual frequency of occurrences in all 20 clones, δ: standard variance, [P _e(1-P _e)/n] ^1/2, n=32 is 32 kinds of codons of NNK representative.

Embodiment 10, the conservative sublocus GCG of identification are with the sequential analysis of merit mutant

Can find by the statistics in table 6, the table 7, same merit zinc phalangeal process variant for identification GCG sublocus, + 4 ,+9 a relative fixed, in addition,-1 ,+2 ,+3 ,+6 four a position display goes out the preference to specific amino acids, have bigger conservative property,, above-mentioned four positions tool vital role in DNA identification is described because that conservative property means is functional.

-1 mainly is two positively charged amino acid of Arg, Lys, and the two almost occurs with same frequency, but electronegative Asp and neutral Gln have also occurred.Form in the crystalline structure of mixture at Zif268 and conserved dna binding site ^[8],-1 amino acid be with 5 '-GCG-3 ' in 3 ' G effect because at G: in the C base pairing, charge distribution is inhomogeneous, and G is electronegativity, can interact by the strong HB of hydrogen between therefore positively charged Arg, Lys and the G.But early stage phage shows in the experiment,-1 amino acid or mostly be Arg or mostly be Lys (Jamieson AC, et al.In vitro selection of zinc fingers with alteredDNA-binding specificity.Biochemistry.1994 May 17; 33 (19): 5689-5695), in theory, the two can be well and the G effect, and the reason that above-mentioned difference occurs may be that phage shows that sample number is less in the experiment, also may be the library constructing method difference.

Opposite with-1 ,+2 mainly is electronegative Asp, secondly is Cys.Just can form salt bridge between the positive and negative charge, and Asp can also play a supporting role to the side chain of the length of Arg-1, Lys-1, stablize the structure of whole DNA-albumen composition, this is consistent with the result in the crystalline structure.But in MT15, situation is just opposite, is Gln-1His+2, and+2 His is positively charged, also can form HB probably between imidazolyl and amide group.

+ 3, mainly be Asp, Glu, Val, three's frequency of occurrences is almost consistent, other amino acid such as Leu, Thr, Gln have also appearred in addition, with Barbas CF 3 rd, Klug A (Choo Y, et al.Selection of DNAbinding sites for zinc fingers using rationally randomized DNA reveals codedinteractions.Proc Natl Acad Sci USA.1994 Nov 8; 91 (23): 11168-11172, WuH, et al.Building zinc fingers by selection:toward a therapeutic application.Proc Natl Acad Sci USA.1995 Jan 17; 92 (2): 344-348) people's such as grade unanimity as a result.In crystalline structure, + 3 amino acid and dna double spirane structure are the most approaching, therefore this position upper amino acid may be subjected to the influence of space steric effect, because in GCG, intermediary C is less, so both can admit bigger amino acid such as Leu, Gln, Glu, also can admit less amino acid such as Val, Thr, Asp, but because C has positive electricity polarity, electronegative Asp, Glu occurs at the high frequency of this position, illustrate+3 amino acid with base on, it is complementary to be subjected to chemistry simultaneously, the restriction of stereochemistry complementary double factor, this be former experiment disclose.In addition, Jamieson AW etc. utilizes phage to show that this position of experiment discovery mainly is Asp, but it just will-1 in library construction ,+2 ,+3 ,+6 sudden changes, other stationkeeping constant (Jamieson AC, et al.In vitroselection of zinc fingers with altered DNA-binding specificity.Biochemistry.1994 May 17; 33 (19): 5689-5695), the present invention then is with more multi-position sudden change, having obtained more various amino acid distributes, the necessity in the bigger library of satisfied structure, and show in zinc finger protein, really have the interaction between the amino acid in the recognition helix, this effect can affect indirectly the DNA identification of zinc finger protein again.

+ 4, show strong preference to Leu ,+9, Arg, Lys occur with equifrequent.+ 6 mainly is Arg, can interact with G, consistent with crystalline structure.+ 1 ,+5 then have bigger randomness, tool does not directly act in DNA identification.

Comparatively speaking ,-1 ,+2 ,+3 ,+6 four positions in ,-1 ,+6 conservative property obviously is better than+2 ,+3, and+6 for the strictest, in used 15 mutant, the overwhelming majority is Arg, consistent with WT.On the structure because-1 ,+6 respectively with the base effect of 5 ', the 3 ' end of GCG, therefore stablizing single zinc and referring to-the tailor-made usefulness of weighing anchor in the identification of triplet sublocus, prior status is arranged.Early stage phage shows that testing the single zinc of pointing out for any one triplet sublocus of identification refers to, in fact have only-1 ,+3 ,+two positions relatively more conservative (Rebar EJ, et al.Zinc finger phage:affinity selection of fingers with new DNA-bindingspecificities.Science.1994 Feb 4 in 6; 263 (5147): 671-673), and our result confirms that above-mentioned three positions are all more fixing, and+2 play complementary effect.Our result also illustrates, in zinc finger protein and DNA mechanism, some base can with more than amino acid contact as G can with effects such as Arg, His, Gln, Ser, Lys, between amino acid-base, there is not a simple one-to-one relationship, reflects the complicacy in the zinc finger protein DNA recognition reaction yet.

In addition, on charge property, its whole recognition helix of the clone that the present invention obtains has strong positive charge, and Jamieson AW etc. think it mainly is electroneutral (Jamieson AC, et al.In vitro selection of zincfingers with altered DNA-binding specificity.Biochemistry.1994 May 17; 33 (19): 5689-5695).Because in the DNA vat, the electric polarity in G: the C pairing distributes, the GCG sublocus has negative electricity character generally, and therefore positively charged recognition helix is deep in the vat, and with electronegative GCG effect, recognition reaction can be more stable, and is also more reasonable.This explanation again suddenlys change to multi-position more, is necessary fully.

And all phages show experiment, all fail to screen the sequence of wild-type, and experiment of the present invention obtain for twice, show that screening model has reflected the mechanism under the physiological condition more realistically than the phage demonstration really in the body.When utilizing phage to show to carry out affine screening, according to a kind of group effect, final result might be the individuality that low specificity, low-affinity but have the high expression level advantage fully, and the individuality of special, the high-affinity of those height, expression inferior position but might be eliminated on the contrary.

Claims (3)

1, the interactional genetic screening model of zinc finger protein-DNA is to contain the intestinal bacteria of reporting plasmid, and described report plasmid contains spectinomycin resistance gene aadA, and aadA gene self promotor P is contained in the upstream of spectinomycin resistance gene aadA _AddA, direction and promotor P are contained in the downstream of spectinomycin resistance gene aadA _AddAOn the contrary, and intensity be higher than P _AddAThe composition promotor; In the manipulation sequence of described composition promotor, insert the binding sequence of zinc finger protein mouse transcription factor Zif268.

2, genetic screening model according to claim 1 is characterized in that: described report plasmid is single copy.

3, the application of the described genetic screening model of claim 1 in screening zinc finger protein mutant.

Images