CN102634535B - Construction method of zinc finger protein inserting vector based random zinc finger protein library - Google Patents
Construction method of zinc finger protein inserting vector based random zinc finger protein library Download PDFInfo
- Publication number
- CN102634535B CN102634535B CN201210106175.1A CN201210106175A CN102634535B CN 102634535 B CN102634535 B CN 102634535B CN 201210106175 A CN201210106175 A CN 201210106175A CN 102634535 B CN102634535 B CN 102634535B
- Authority
- CN
- China
- Prior art keywords
- zinc finger
- finger protein
- gal11p
- pbd
- random
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Abstract
The invention discloses a construction method of a zinc finger protein inserting vector based random zinc finger protein library, wherein the method comprises the following steps of: constructing a zinc finger protein expression inserting vector pBD-P-Galllp-ZFR, constructing a random zinc finger protein sequence, and constructing a random zinc finger protein expression vector pBD-P-Galllp-ZFS, thereby obtaining a high-capacity random zinc finger protein library after converting and expressing the zinc finger protein expression inserting vector pBD-P-Galllp-ZFR, the random zinc finger protein sequence and the random zinc finger protein expression vector pBD-P-Galllp-ZFs. The high-capacity random zinc finger protein library establishes a foundation for the screening of the zinc finger protein.
Description
Technical field
The invention belongs to zinc finger protein storehouse technical field, relate to a kind of construction process of the random zinc finger protein storehouse based on zinc finger protein insertion vector.
Background technology
Zinc refers to that proteinoid extensively distributes in animals and plants and microorganism, nearly wherein in human genome, just has the albumen of 1% sequence encoding zinc fingers, the common trait of zinc finger protein be protein by with Zn
2+combination, make self to be folded into finger-like polypeptide structure.Different with position with the number of His (H) residue according to Cys (C), zinc finger protein can be divided into the subclass such as CCHH, CCCH-CCCC, CCHC, CCCH.
C
2h
2zinc finger domain is found in the transcription factor TFIIIA of nineteen eighty-three at Xenopus Oocytes, is the widest proteinoid that distributes in eukaryotic gene group so far.This zinc finger protein consists of the structure of β β α about 30 amino-acid residues, each zinc refers in conjunction with 3 continuous nucleotide sequences.Its structure is relatively more fixing and avidity is strong, so be applicable to very much the artificial DBP of design.
In ZiFDB (http://bindr.gdcb.iastate.edu:8080/ZiFDB/) database, there are 888 kinds of zinc to refer at present, mainly comprise four classes:
SangamoBioSciences: they design a class triplet zinc finger protein, and wherein each zinc refers to identify GNN nucleotide sequence.
Barbas laboratory: they adopt the method for module assembled to design a large amount of zinc finger proteins that can identify different triplet nucleotide sequences.
Toolgen: in the zinc finger protein that they encode from human genome, screening obtains zinc finger protein.
Joung laboratory: they adopt the method for OPEN to create a large amount of triplet zinc finger proteins, the target sequence of its identification 9bp.
Obtain the method that artificial conjuncted zinc refers to and can be divided into two classes: sieve method and module assembled method.The advantage of module assembled method is simple and fast: simply each zinc finger print piece is connected and is used for identifying target sequence.Shortcoming is that the conjuncted zinc of designing refers to that avidity is lower or there is no avidity.Along with zinc refers to that the method will become a kind of efficient method in conjunction with the further investigation of DNA mechanism; Sieve method confidence level is higher, but more consuming time and need higher molecular experimental skill than module assembled method.
Invention description
The problem that the present invention solves is to provide a kind of construction process of the random zinc finger protein storehouse based on zinc finger protein insertion vector, by building, the random zinc finger protein expressed sequence with degeneracy is inserted in expression vector and is transformed, obtained the random zinc finger protein storehouse of heavy body, for the screening of zinc finger protein is laid a good foundation.
The present invention is achieved through the following technical solutions:
A zinc finger protein insertion vector, comprises promotor and antibiotic-screening gene, in the downstream of promotor, contains Gal11p gene order, contains zinc finger protein sequence insertion point in the downstream of Gal11p gene order.
Described promotor is Lac-UV5 promotor; The nucleotide sequence of described zinc finger protein sequence insertion point is as shown in SEQ.ID.NO.3.
Described zinc finger protein insertion vector is pBD-P-Gal11p-ZFR, by restriction enzyme site, lac-UV5 promotor is cloned into carrier pBD, then Gal11p gene order is cloned into the downstream of lac-UV5 promotor, then the insertion point ZFR of zinc finger protein sequence is cloned into the downstream of Gal11p gene order.
The nucleotide sequence of shown Lac-UV5 promotor is as shown in SEQ.ID.NO.1; The nucleotide sequence of Gal11p gene order is as shown in SEQ.ID.NO.2; The nucleotide sequence of zinc finger protein sequence insertion point is as shown in SEQ.ID.NO.3.
A random zinc finger protein sequence, its nucleotide sequence is as shown in SEQ.ID.NO.4.
A random zinc finger protein expression vector is that the random zinc finger protein sequence as shown in SEQ.ID.NO.4 with sticky end is inserted in the insertion point ZFR of zinc finger protein sequence of pBD-P-Gal11p-ZFR carrier;
Described pBD-P-Gal11p-ZFR carrier,, by restriction enzyme site, Lac-UV5 promotor is cloned into carrier pBD, then Gal11p gene order is cloned into the downstream of Lac-UV5 promotor, then the insertion point ZFR of zinc finger protein sequence is cloned into the downstream of Gal11p gene order and forms.
The construction process in random zinc finger protein storehouse, comprises the following steps:
1) clone respectively the insertion point ZFR of the zinc finger protein sequence shown in Lac-UV5 promoter element, Gal11p gene order and SEQ.ID.NO.3, then according to the order of Lac-UV5-gal11p-ZFR by 3 sequence clones in pBD carrier, build pBD-P-Gal11p-ZFR carrier;
2), according to-1,1 of zinc finger protein, 2,3,5,6 site design random primers, obtain the random zinc finger protein sequence as shown in SEQ.ID.NO.4 by overlapping PCR;
3) be inserted into after the random zinc finger protein sequence enzyme shown in SEQ.ID.NO.4 is cut in the insertion point ZFR of zinc finger protein sequence of pBD-P-Gal11p-ZFR carrier, obtain pBD-P-Gal11p-ZFS expression vector;
4) take E.coli DH5a as Host Strains, pBD-P-Gal11p-ZFS expression vector is transformed to Host Strains, collect all mono-clonals after chlorampenicol resistant screening, extract plasmid, all plasmids that obtain are mixed, obtain random zinc finger protein storehouse.
It is random zinc finger protein sequence to be carried out to enzyme by pfu DNA polymerase inscribe activity cut that the enzyme of described sticky end is cut.
Described random zinc finger protein sequence is inserted in pBD-P-Gal11p-ZFR carrier by BbsI restriction enzyme site.
The transfection of described pBD-P-Gal11p-ZFS expression vector is the method that adopts electricity to transform.Electricity conversion condition, electroporation apparatus parameter: voltage 1800V, time length 5ms; Electric shock cup specification: Gap (mm) 2.0, Minimum Volume 40 μ l, Maximum Volume 400 μ l.
Compared with prior art, the present invention has following useful technique effect:
At present the construction process in zinc finger protein storehouse report is fewer, and the most frequently used zinc finger protein storehouse is to buy and singly refer to that zinc refers to storehouse to Joung Lab, and then the method by overlapping PCR builds needed zinc and refers to storehouse.Yet singly refer to that zinc refers to that storehouse has 74, the independent price in each storehouse is 65 $, buys and allly singly refer to that zinc refers to storehouse needs 4440 $ (http://www.addgene.org/zfc/browse/).By needs, from sending plasmid abroad, program is very loaded down with trivial details.
The present invention is based on zinc finger protein constructional feature design degenerate primer, the method by overlapping PCR builds random zinc and refers to storehouse, and it has the following advantages:
1) construction process is simple, uses molecular biology ordinary method just can complete, and substantially all Molecular Biology Labs all possess this condition.Only need two kinds of instruments of PCR instrument and electroporation apparatus, by PCR, enzyme cut, connect, electricity transforms and plasmid extraction can complete.
2) cost is low, and the capital cost of present method is: degenerate primer synthesizes, limits restriction endonuclease Bbs I, electric shock cup, dTTP and some laboratory common agents and equipment expense.
3) cycle short, zinc finger protein inserts pBD-P-Gal11p-ZFR vector construction, only need in skeleton carrier, insert 3 DNA fragmentations can complete, and probably needs two time-of-weeks.Random zinc refers to that storehouse structure only need insert random zinc finger protein sequence at pBD-P-Gal11p-ZFR carrier, then electricity conversion Host Strains, and extracting plasmid can complete, and being no more than 3 days can complete.
4) storage capacity is large, and this random zinc finger protein storehouse has comprised the possible zinc finger protein of all identification 9bp nucleotide sequences, approximately comprises 1.41 * 10
22plant different zinc finger proteins.
Accompanying drawing explanation
Fig. 1 is the result figure that pBD-p carrier single endonuclease digestion is identified;
Fig. 2 is the result figure that pBD-p-gal11p carrier PCR identifies;
Fig. 3 is the result figure that pBD-P-Gal11P-ZFR carrier PCR identifies;
Fig. 4 is the plasmid map of pBD-p-gal11p-ZFR carrier;
Fig. 5 is that random zinc finger protein storehouse builds schematic diagram;
Fig. 6 is the amplification figure of ZFF123 fragment;
Fig. 7 is the plasmid map of pBD-p-gal11p-ZFS carrier;
Fig. 8 is the expression of pBD-p-gal11p-ZFS carrier in BL21.
Embodiment
The invention provides the construction process in a kind of random zinc finger protein storehouse, comprise that structure that zinc finger protein express to insert carries pBD-P-Gal11p-ZFR is, the structure of random zinc finger protein sequence and random zinc finger protein expression vector pBD-P-Gal11p-ZFS, will its conversion and express after obtain the random zinc finger protein storehouse of heavy body.Below in conjunction with concrete embodiment, the present invention will be described in detail, described just explanation of the invention rather than restriction.
First source or the preparation of following nutrient solution/carrier are provided:
PBD carrier, pTRG-gal11P carrier, pBD-LGF2 carrier are purchased from TaKaRa company.Bacillus coli DH 5 alpha is purchased from Tian Gen company.
SOB substratum modified form formula (1L system): tryptone 20g; Yeast extract 5g; NaCl 0.5g; KCl 10ml (250uM).
SOC substratum modified form formula (1L system): tryptone 20g; Yeast extract 5g; NaCl 0.5g; KCl 10ml (250uM)); Glucose 1.8ml (20%).
Paraxin (34mg/ml) preparation: 0.34g is dissolved in 10ml ethanol.
IPTG (100mg/ml) preparation: 1.2g is dissolved in 50ml ddH
2in O, 0.22um membrane filtration.
1, random zinc refers to the structure of insertion vector pBD-P-Gal11P-ZFR
The structure of 1.1pBD-P carrier
Design primer Plac-F, Plac-R clone lac-UV5 promotor from pBD carrier:
Plac-F：gcttatc
atc?gataagctaa?ttctcactca?tta；
Plac-R：gtta
gcggcc?gctttgaaga?cctcatacgc?tgtttcctgt；
Wherein, line part is restriction enzyme site;
The amplification system of Lac-uv5 promotor: pBD carrier 1ul; Primer Plac-F 2ul; Plac-R 2ul; Pfu DNA polymerase 1ul; Pfu DNA polymerase buffer 5ul; DNTP 1ul; ddH
2o 29ul.
The amplification condition of Lac-uv5 promotor: 95 ℃ of 3min; 95 ℃ of 30s, 58 ℃ of 45s, 72 ℃ of 45s, 30cycle; 72 ℃ of 10min.
Then the Lac-UV5 promotor of using respectively Cla I and Not I double digestion pBD carrier (the λ CI ORF on excision pBD carrier) and pcr amplification, reclaims after endonuclease bamhi 4 ℃ of connections of spending the night of T4DNA ligase enzyme; To connect product and transform DH5 α, be coated with bacterium liquid in cultivating containing 37 ℃ of inversions on the LB solid medium of chlorampenicol resistant (34ug/ml).Picking mono-clonal, bacterium colony PCR identifies and checks order, and after evaluation is correct, obtains pBD-P carrier.The enzyme of pBD-P carrier is cut qualification result as shown in Figure 1, and wherein M is marker (100bp, 250bp, 500bp, 750bp, 1000bp, 2000bp, 3000bp, 5000bp); Swimming lane 4 is pBD carrier, and swimming lane 1,2 and 3 is pBD carrier single endonuclease digestion (contain Bbs I restriction enzyme site in the pBD-P carrier of insertion Lac-UV5 promotor, and skeleton carrier pBD not containing Bbs I restriction enzyme site), and clip size is 2511bp.The nucleotide sequence of lac-uv5 promotor is as shown in SEQ.ID.NO.1.
The structure of 1.2 pBD-P-Gal11p carriers
Primer Gal11-F, the Gal11-R of restriction enzyme site introduced in design, take PTRG-Gal11p as template amplification Gal11P fragment:
Gal11-F：gcc
gaagaca?ttatgcctca?acagcagcaa；
Gal11-R：gac
gcggccg?ccaaagcttg?gatttttctc?a；
Wherein, line part is restriction enzyme site;
The amplification system of Gal11p: pTRG carrier 1ul; Primer Gal11-F 2ul; Ga111-R2ul; Pfu DNA polymerase 1ul; Pfu DNA polymerase buffer 5ul; DNTP 1ul; ddH
2o 29ul.
The amplification condition of Gal11p: 95 ℃ of 3min; 95 ℃ of 30s, 58 ℃ of 45s, 72 ℃ of 45s, 35cycle; 72 ℃ of 10min.
Then use respectively the Gal11p fragment of Bbs I and Not I double digestion pBD-P and amplification, 4 ℃ of connections of spending the night of DNA ligase after recovery endonuclease bamhi; To connect product and transform DH5 α, be coated with bacterium liquid in cultivating containing 37 ℃ of inversions on the solid medium of chlorampenicol resistant (34ug/ml).Picking mono-clonal, bacterium colony PCR order-checking are identified, after evaluation is correct, obtain pBD-P-Gal11P carrier.As shown in Figure 2, wherein M is marker (100,200,300,400,500,600) to the PCR qualification result of pBD-P-Gal11p carrier, swimming lane 1,2, and 3,4,5,7 for building correct clone, and its PCR identifies that stripe size is 296bp.The nucleotide sequence of Ga111p is as shown in SEQ.ID.NO.2.
The structure of 1.3pBD-P-Gal11P-ZFR carrier
Primer ZFR1, the ZFR2 of restriction enzyme site introduced in design, by overlapping PCR method, obtains zinc finger protein insertion sequence ZFR:
ZFR1：cgatgcggcc?gctgactaca?aagattctag?acccgg
ggag?gtcttctaag?tgataa；
ZFR2：gcatggatcc?ttactactgt?gcatgtcttc?ttac
ttatca?cttagaagac?ctcc；
Wherein, line part is the overlapping primer bridging in two ends sequence.
The zinc finger protein insertion sequence ZFR following (being shown in SEQ.ID.NO.3) of overlapping PCR synthesized:
CGAT
TGACTACAAAGATTCTAGACCCGGGGAG
GTCTT CTAAGTGATAAGTAA
GAAGACATGCACAGTAGTAA
ATGC
Wherein, drawing dotted portion is restriction enzyme site Not I and BamH I, and drawing solid line part is all restriction enzyme site Bbs I.Recognition site and the cleavage site of Bbs I restriction enzyme are not identical, by appropriate design, can after enzyme is cut, remove Bbs I restriction enzyme site, to eliminate the impact of restriction enzyme site DNA sequence dna.
The amplification system of ZFR: ZFR1 2ul; ZFR2 2ul; Pfu DNA polymerase 1ul; Pfu DNA polymerase buffer 5ul; DNTP 2ul; ddH
2oul37ul.
The amplification condition of ZFR: 94 ℃ of 3min; 94 ℃ of 30s, 58 ℃ of 30s, 72 ℃ of 45s, 25cycle; 72 ℃ of 10min.
Then use respectively the ZFR fragment of Not I and BamH I double digestion pBD-P-Gal11P and amplification, 4 ℃ of connections of spending the night of DNA ligase after recovery endonuclease bamhi; To connect product and transform DH5 α, be coated with bacterium liquid in cultivating containing 37 ℃ of inversions on the solid medium of chlorampenicol resistant (34ug/ml).Picking mono-clonal, bacterium colony PCR order-checking are identified, after evaluation is correct, obtain pBD-P-Gal11P-ZFR carrier.
The bacterium colony PCR qualification result of pBD-P-Gal11P-ZFR carrier as shown in Figure 3, wherein M be Trans2k DNA marker (size is 2000,1000,750,500,250 from top to down, 100bp) 4,6,7, positive clone, 1,2,3,5 negative clones.According to design primer object clip size, be 753bp.
The plasmid map of 1.4 constructed pBD-P-Gal11P-ZFR carriers as shown in Figure 4, wherein, the putting in order as Lac-UV5-Gal11p-ZFR of 3 elements of insertion;
Lac-UV5 is a kind of promotor of medium tenacity, and it is responsible for Gal11p and zinc and refers to that sequence transcribes and translate.
Gal11p can interact with Gal4, can whether regulate and control promoter transcription, in being widely used in protein-protein or making a search, as bacterial Two-Hybrid system and yeast two-hybrid system.Make so constructed carrier, zinc finger protein storehouse to screen by enough two-hybrid systems.
ZFR is zinc finger protein sequence insertion point, comprises two Bbs I restriction enzyme sites, and enzyme can result from the sticky end of zinc finger protein sequence pairing after cutting, and can remove the Bbs I restriction enzyme site containing in carrier, to eliminate restriction enzyme site, zinc finger protein sequence is affected.
2, the structure of random zinc finger protein sequence
C
2h
2zinc finger domain is found in the transcription factor TFIIIA of nineteen eighty-three at Xenopus Oocytes, is the widest proteinoid that distributes in eukaryotic gene group so far.This zinc finger protein consists of the structure of β β α about 30 amino-acid residues, each zinc refers in conjunction with 3 continuous nucleotide sequences.Its structure is relatively more fixing and avidity is strong, so be applicable to very much the artificial DBP of design.The present invention designs the random zinc finger protein of three fingers storehouse, its identification 9bp nucleotide sequence.
Zinc finger protein has conservative sequence, and the site of its bind nucleic acid is its-1,1,2,3,5,6 site, and these six sites are variable amino acid.According to above-mentioned zinc finger protein sequential structure feature and codon degenerate, design primer, obtains random zinc finger protein sequence (building flow process as shown in Figure 5) by overlapping PCR method.
For the random zinc finger protein sequence of identifying all sequences of 9bp Nucleotide, designed random primer is:
ZFF11：gagcgcccct?tccagtgtcg?catttgcatg?cggaactttt?cgvnsvnmvn?vnwcttvnw?vnmcataccc?gtactcatac；
ZFF12：cgcatacaga?tccgacactg?aaacggtttt?tcaccggtat?gagtacgggt?atg；
ZFF21：gtgtcggatc?tgtatgcgaa?atttctccvn?kvnmvnsvnm?ttgvnwvnkc?atctacgtacgcacacc；
ZFF22：tcggcattgg?aatggcttct?cgccggtgtg?cgtacgtaga?tg
ZFF31：gccattccaa?tgccgaatat?gcatgcgcaa?cttcagt
ZFF32：ccctcaggtg?ggtttttagg?tgknbmnbca?gsnbmnbknb?mnbactgaag?tgcgcatg；
ZFA1：ggggagcgcc?ccttccagtg?tcgc；
ZFA2：gtgcagagga?tcccctcagg?tgggttttta?ggtg；
Wherein, N represents A, T, C, G; V represents G, A, C; S represents G, C; M represents A, C; W represents A, T; K represents G, T;
The amplification program of random zinc finger protein sequence is:
The amplification ZFF1 of ZFF11 and ZFF12, amplification system (50ul) is: ZFF11 1ul (50uM); ZFF121ul (50uM); Pfu DNA polymerase 1ul; Pfu DNA polymerase buffer 5ul; DNTP 1ul; ddH
2o 41ul;
The amplification ZFF2 of ZFF21 and ZFF22, amplification system (50ul) is: ZFF211ul (50uM); ZFF221ul (50uM); Pfu DNA polymerase 1ul; Pfu DNA polymerase buffer 5ul; DNTP 1ul; ddH
2o 41ul;
The amplification ZFF3 of ZFF31 and ZFF32, amplification system (50ul) is: ZFF31 1ul (50uM);
ZFF321ul(50uM)；pfu?DNA?polymerase?1ul；pfu?DNA?polymerase?buffer?5ul；dNTP?1ul；ddH
2O?41ul；
Amplification condition is: 94 ℃ of 3min; 94 ℃ of 30s, 50 ℃ of 30s, 72 ℃ of 30s, 6cycle; 94 ℃ of 30s, 56 ℃ of 30s, 72 ℃ of 30s, 25cycle; 72 ℃ of 10min.
After completing, above-mentioned amplification reclaims respectively the ZFF1 that amplification obtains, ZFF2, and ZFF3 fragment, its sequence is as follows:
ZFF-1：gagcgcccct?tccagtgtcg?catttgcatg?cggaactttt?cgvnsvnmvn?mvnwcttvnw?vnmcataccc?gtactcatac?cggtgaaaaa?ccgtttca
gt?gtcggatctg?tatgcg
ZFF-2：
gtgtcggatc?tgtatgcgaa?atttctccvn?kvnmvnsvnm?ttgvnwvnkc?atctacgtacgcacaccggc?gagaagccat?tccaatgccg?a
ZFF-3：
gccattccaa?tgccgaatat?gcatgcgcaa?cttcagtvnk?vnmvnkvnsc?tgvnkvnmca?cctaaaaacc?cacctgaggg
Line part is three sections of zinc finger protein sequence laps, can realize the random combine of these three sections of sequences by overlapping PCR.Then following program is put up a bridge and is increased:
ZFF1+ZFF2 amplification system amplification ZFF12:ZFF1 1.5ul; ZFF2 1.5ul; Pfu DNA polymerase 1ul; PfuDNA polymerase buffer 2ul; DNTP 1ul; ddH
2o 13ul.
ZFF2+ZFF3 bridging amplification system amplification ZFF23:ZFF2 1.5ul; ZFF3 1.5ul; Pfu DNA polymerase 1ul; Pfu DNA polymerase buffer 2ul; DNTP 1ul; ddH
2o13ul
Amplification condition is: 94 ℃ of 3min; 94 ℃ of 30s, 58 ℃ of 30s, 72 ℃ of 30s, 15cycle; 72 ℃ of 10min.
ZFF12 and ZFF23 fragment that the rear amplification of recovery respectively of having increased obtains, then carry out following bridging amplification:
Amplification system: ZFF12 3ul; ZFF23 3ul; Pfu DNA polymerase 1ul; Pfu DNA polymerase buffer 5ul; DNTP 1ul; ddH
2o 37ul;
Amplification condition: 94 ℃ of 3min; 94 ℃ of 30s, 57 ℃ of 30s, 72 ℃ of 30s, 15cycle; 72 ℃ of 10min.
The ZFF123 fragment that after above-mentioned amplification completes, recovery amplification obtains, as shown in Figure 6, wherein, M is 50bpmarker to the electrophoresis detection result of its amplification, 1 is that ZFF123 amplified fragments size is 283bp.
Take ZFF123 fragment as template, utilize phosphorylation primer (phosphoric acid turn to improve follow-up joint efficiency) ZFA1, the ZFA2 ZFF123A that increases, its amplification system is:
ZFF1233ul；ZFA1primer?1ul(50uM)；ZFA2primer?1ul(50uM)；pfu?DNA?polymerase?1ul；pfu?DNA?polymerase?buffer?5ul；dNTP?1ul；ddH
2O?38ul；
Amplification condition is: 94 ℃ of 3min; 94 ℃ of 30s, 58 ℃ of 45s, 72 ℃ of 45s, 35cycle; 72 ℃ of 10min.As shown in Figure 6, wherein M is 50bp marker to the ZFF123A fragment that final amplification obtains, and 1 is F123 amplified fragments, and its size is 286bp.
Reclaim the ZFF 123A fragment that amplification obtains, its sequence is as shown in SEQ.ID.NO.4.
Again by 3 '-5 ' 5 prime excision enzyme activity of pfu DNApolymerase, to obtain the zinc finger protein sequence ZFS with sticky end.Its sticky end is as follows:
GGGG----ZFS----
----ZFS----CGTG
Its enzyme is cut system: ZFF12 310ul; DTTP 3ul; Pfu DNA polymerase 1ul; Pfu DNA polymerase Buffer 3ul; ddH
2o 13ul; Enzyme tangent condition: 72 ℃ of 15min.Thereby obtain having the zinc finger protein sequence ZFS of sticky end.
3, the foundation in the structure of expression vector pBD-P-Gal11p-ZFS and random zinc finger protein storehouse
PBD-P-Gal11p-ZFR carrier is cut after (37 ℃ of enzymes are cut 6h) to DNA after recovery endonuclease bamhi with BbsI enzyme.The zinc finger protein sequence ZFS with sticky end that enzyme is cut back to close is connected with it, 4 ℃ of connections of spending the night of T4 ligase enzyme; Obtain random zinc and refer to expression vector pBD-P-Gal11p-ZFS;
As shown in Figure 7, the ZFS wherein inserting is between two BbsI restriction enzyme sites of zinc finger protein insertion point ZFR for the plasmid map that random zinc refers to expression vector pBD-P-Gal11p-ZFS.Zinc is referred to expression vector pBD-P-Gal11p-ZFS proceeds to the expression of BL21 bacterial strain inducing albumen, cultivate cell concentration to 0.6 left and right for 37 ℃, add 27 ℃ of induction 12h of 50uM IPTG, collect 1ml thalline (12000rpm 1min), twice of PBS lotion thalline, add 30ul lysate [Popculture reagent (Novagen, cat.no.71092) according to the N,O-Diacetylmuramidase that adds 4units/ml at 10: 1] cracking 30min on ice, add loading buffer[100Mm Tris HCL (ph=6.8); 4% (m/v) SDS; 2% (v/v) tetrabromophenol sulfonphthalein; 20% glycerine; 2% β mercaptoethanol] 95 ℃ of water-bath 10min, 10% polyacrylamide gel electrophoresis show ZFS can normal expression as shown in Figure 8, wherein M is Blue Plus II Protein Marker (large 100kDa from top to down, 62kDa, 40kDa, 30kDa, 24kDa, 14kDa), 1,2 is to empty bacterial strain, 3,4,5,6 is sample, 1,3,5 is induction sample bacterial strain, 2,4,6 for not inducing sample bacterial strain.The size that Lac-UV5 starts lower object fragment is 20kDa left and right, and in Fig. 8, red arrow is depicted as object fragment.
The preparation of electricity transformant: connect 1% fresh E.coli DH5a bacterial classification in SOB liquid medium, 37 ℃ are cultivated 8～10h to OD is between 0.8～1.0, connect 1ml bacterium liquid in 100ml sterilizing SOC nutrient solution in 25 ℃～37 ℃ cultivations, attempt best culture temperature, until OD, it is 0.6 o'clock, collect 100ml thalline, 4 ℃, the centrifugal 5min of 3000g.Remove supernatant, 10% glycerine is washed thalline, and 4 ℃, the centrifugal 5min of 5000g, repeats twice.With 400ul10% glycerine suspension thalline, above step is all in operation on ice.
Electricity transforms random zinc and refers to expression vector pBD-P-Gal11p-ZFS:
PBD-P-Gal11p-ZFS is added in the competence of preparation, mix gently, all in ice, operate.Electric shock 1800V, 5ms.After electric shock, place 6min on ice, then add 800uL SOC liquid nutrient medium, 37 ℃, 120rpm cultivates 1h, evenly coats containing paraxin (34mg/ul) flat board, and common-battery transforms 20 pipes, and each pipe electricity transforms thalline and coats in two 150mm culture dish.Be inverted for 37 ℃ and cultivate, finally obtain 30 wares and transform thalline.
Collect all mono-clonals of culture dish, extract plasmid, adopt in omega company and carry plasmid kit, concrete steps are with reference to specification sheets.All plasmids of gained are mixed, finally obtain random zinc finger protein storehouse.Resulting random zinc finger protein storehouse is to comprise random triplet zinc finger protein sequence zinc to refer to expression vector plasmid mixture.
Its zinc finger protein sequence of random zinc finger protein storehouse is as follows:
ggggagcgcc?ccttccagtg?tcgcatttgc?atgcggaact?tttcgvnsvn?mvnmvnwctt
vnwvnmcata?cccgtactca?taccggtgaa?aaaccgtttc?agtgtcggat?ctgtatgcga
aatttctccv?nkvnmvnsvn?mttgvnwvnk?catctacgta?cgcacaccgg?cgagaagcca
ttccaatgcc?gaatatgcat?gcgcaacttc?agtvnkvnmv?nkvnsctgvn?kvnmcaccta
aaaacccacc?tgaggggatc?ctctgcac
Wherein, N represents A, T, C, G; V represents G, A, C; S represents G, C; M represents A, C;
W represents A, T; K represents G, T;
Because zinc finger protein has conservative sequence, the site of its bind nucleic acid is its-1,1,2,3,5,6 site, but these site amino acid do not contain aromatic amino acid conventionally.By design random primer, adopt the method for overlapping PCR obtain three sections of zinc finger proteins its-1,1,2,3,5,6 sites have comprised 15 or 16 seed amino acids (removing Phe, Tyr, Trp and Cys tetra-seed amino acids), have comprised all possible protein sequence of single zinc finger protein.By overlapping PCR, realized the random combine of three sections of zinc finger protein sequences again, completed triplet zinc finger protein sequence library, then expand by PCR, enzyme is cut, connected, electricity transforms and extract plasmid completes random triplet zinc finger protein storehouse.Random triplet zinc finger protein storehouse refers to the plasmid mixture of final extraction, and the storage capacity in random triplet zinc finger protein storehouse is greater than 1.48 * 10
21(15
18).
Claims (2)
1. a zinc finger protein insertion vector, is characterized in that, comprises promotor and antibiotic-screening gene, in the downstream of promotor, contains Gal11p gene order, contains zinc finger protein sequence insertion point in the downstream of Gal11p gene order;
Described zinc finger protein insertion vector is pBD-P-Gal11p-ZFR, by restriction enzyme site, lac-UV5 promotor is cloned into carrier pBD, then Gal11P gene order is cloned into the downstream of lac-UV5 promotor, then the insertion point ZFR of zinc finger protein sequence is cloned into the downstream of Gal11p gene order;
The nucleotide sequence of lac-UV5 promotor is as shown in SEQ.ID.NO.1; The nucleotide sequence of Gal11P gene order is as shown in SEQ.ID.NO.2; The nucleotide sequence of zinc finger protein sequence insertion point is as shown in SEQ.ID.NO.3.
2. a random zinc finger protein expression vector, it is characterized in that, be by the random zinc finger protein sequence as shown in SEQ.ID.NO.4 with sticky end, by BbsI restriction enzyme site, be inserted in the insertion point ZFR of zinc finger protein sequence of pBD-P-Gal11p-ZFR carrier;
Described pBD-P-Gal11p-ZFR carrier,, by restriction enzyme site, lac-UV5 promotor is cloned into carrier pBD, then Gal11p gene order is cloned into the downstream of Lac-UV5 promotor, then the insertion point ZFR of zinc finger protein sequence is cloned into the downstream of Gal11p gene order and forms;
The nucleotide sequence of lac-UV5 promotor is as shown in SEQ.ID.NO.1; The nucleotide sequence of Gal11P gene order is as shown in SEQ.ID.NO.2; The nucleotide sequence of zinc finger protein sequence insertion point is as shown in SEQ.ID.NO.3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210106175.1A CN102634535B (en) | 2012-04-12 | 2012-04-12 | Construction method of zinc finger protein inserting vector based random zinc finger protein library |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210106175.1A CN102634535B (en) | 2012-04-12 | 2012-04-12 | Construction method of zinc finger protein inserting vector based random zinc finger protein library |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102634535A CN102634535A (en) | 2012-08-15 |
| CN102634535B true CN102634535B (en) | 2014-11-26 |
Family
ID=46619111
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210106175.1A Expired - Fee Related CN102634535B (en) | 2012-04-12 | 2012-04-12 | Construction method of zinc finger protein inserting vector based random zinc finger protein library |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102634535B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102994437B (en) * | 2012-11-06 | 2014-04-02 | 大连理工大学 | Streptomycete artificial zinc finger protein mutant strains with high yield of lignocellulose degrading enzymes and method for obtaining same |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20020061512A1 (en) * | 2000-02-18 | 2002-05-23 | Kim Jin-Soo | Zinc finger domains and methods of identifying same |
| CN1215178C (en) * | 2003-01-08 | 2005-08-17 | 中国人民解放军军事医学科学院生物工程研究所 | Genetic-sorting model of zinc finger-protein-DNA interaction and use thereof |
| CN102206631A (en) * | 2011-03-08 | 2011-10-05 | 西北农林科技大学 | Open-source method for screening zinc finger proteins targeted combined with target sites of human DYRK1A gene |
-
2012
- 2012-04-12 CN CN201210106175.1A patent/CN102634535B/en not_active Expired - Fee Related
Non-Patent Citations (2)
| Title |
|---|
| 利用同序异尾限制性内切酶快速克隆多基因片段的新方法;杜广营 等;《生物化学与生物物理进展》;20061231;第33卷(第6期);584-588 * |
| 杜广营 等.利用同序异尾限制性内切酶快速克隆多基因片段的新方法.《生物化学与生物物理进展》.2006,第33卷(第6期),584-588. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102634535A (en) | 2012-08-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103343120B (en) | Wheat genome site-specific modification method | |
| CN102558309B (en) | Transcription activator-like effector nucleases, and encoding genes and application thereof | |
| CN111770992A (en) | CRISPR-Cas12j enzymes and systems | |
| CN112105728A (en) | CRISPR/Cas effector proteins and systems | |
| CN106086031B (en) | Pig flesh chalone gene editing site and its application | |
| CN101565461B (en) | Zinc finger protein related to plant type and spike grain number of rice, encoding gene and application thereof | |
| CN102634535B (en) | Construction method of zinc finger protein inserting vector based random zinc finger protein library | |
| CN102850444B (en) | A pair of transcription activator like effector nucleases of L3 and R1 and a coding gene and an application thereof | |
| CN102702335B (en) | Recombinant transcription activator like effector, transcription activator like effector nuclease, as well as coding gene and application thereof | |
| CN102993278B (en) | Purification method of methicillin-resistant staphylococcus aureus (MRSA) vaccine recombinant protein antigen FnbA1 | |
| CN105367628A (en) | Pair of TALENs for efficiently editing rice WAXY gene, and identification targeting site and application thereof | |
| CN108359689B (en) | Method for identifying signal peptide with secretion function by using disease-resistant gene to identify nontoxic effector protein | |
| KR100958095B1 (en) | Method for the mass expression of a antimicrobial peptide by using a translational coupling system | |
| CN105838691A (en) | Pair of transcriptional activator-like effector nucleases (TALEN) as well as encoding gene and application thereof | |
| CN102702331B (en) | Pair of transcription activator-like effector nucleases (TALEN), encoding gene and application thereof | |
| CN102627692B (en) | A pair of transcription activator-like effector nucleases and coding engines as well as application thereof | |
| CN106397559B (en) | A kind of and plant carbonate stress tolerance GAP-associated protein GAP GsHA16 and its encoding gene and application | |
| CN102702332B (en) | One pair of transcription activator effect factor nucleases R1 and R2, coding gene and application thereof | |
| CN104531633A (en) | Cas9-scForkI fusion protein and application thereof | |
| CN103589717A (en) | Active transposon of fish Tc1-like and application of active transposon | |
| CN104707135A (en) | Recombinant protein vaccine, recombinant expression vector containing genes for coding recombinant protein vaccine and application of recombinant protein vaccine | |
| CN108864273B (en) | Simulated human-derived antibacterial peptide and preparation method thereof | |
| CN108424909B (en) | Cilium assembly regulatory gene and encoding protein, acquisition method and application thereof | |
| CN102627690B (en) | Pair of transcription activator-like effector nucleases (TALENs) and coding genes and application thereof | |
| CN102604906A (en) | Bombyx mori glutathione-S-transferase BmGSTD4 and genes thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C53 | Correction of patent for invention or patent application | ||
| CB03 | Change of inventor or designer information |
Inventor after: Guo Zekun Inventor after: Zhang Yong Inventor after: Wang Xiaohai Inventor after: Yang Lixia Inventor before: Wang Xiaohai Inventor before: Yang Lixia Inventor before: Guo Zekun Inventor before: Zhang Yong |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: INVENTOR; FROM: WANG XIAOHAI YANG LIXIA GUO ZEKUN ZHANG YONG TO: GUO ZEKUN ZHANG YONG WANG XIAOHAI YANG LIXIA |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20141126 Termination date: 20170412 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |