CN103589717A - Active transposon of fish Tc1-like and application of active transposon - Google Patents

Abstract

The invention relates to an active transposon of a fish Tc1-like and an application of the active transposon, and particularly relates to a transposon with a complete inverted left and right terminal repeat sequence, a transposon capable of encoding a transposase, the transposase encoded by the transposon, a genetic vector with the transposon and the transposase and a gene transfer system. The transposon activity verification in a zebra fish proves that the transposon has transposon activity, and the gene transfer system can be subjected to efficient transposition in the zebra fish, so that a foundation is laid for further verifying the transposition efficiency of the transposon and carrying out relevant researches and applications in vertebrates by using the transposon.

Description

Active transposon of fish Tc1-like and uses thereof

Technical field

The present invention relates to gene engineering technology field, specifically, relate to a kind of fish tc1active transposon of-like and uses thereof.

Background technology

Transposon (Transposon) is that a class does not rely on homologous recombination and the mobile DNA sequence dna that can jump in genome and between genome, is also referred to as jumping gene or the removable factor, and it is widely distributed at occurring in nature.According to its swivel base mechanism, be divided into two classes: retrotransposon and DNA transposon. tc1most species, the widest class of distribution in-like transposon ShiDNA transposon family.From tc1after transposon is found in nematode, with tc1the transposon general designation with analog structure tc1the constitutional features of-like transposon ，Qi family is the gene with a coding transposase, and two ends have inverted terminal repeat sequence. tc1-like transposon is because transposition activity difference is divided into again two classes: autonomous transposon and non-autonomous transposon.In vertebrates tc1there is defect and lose transposition activity in-like transposon major part, is mainly in transposase open reading frame, to have sudden change, frameshit, insertion, disappearance or terminator codon, causes the activated transposase of can not encoding, so majority is non-autonomous transposon.The people such as Ivics isolate inactivation from salmon fishes tc1-like transposon, utilize molecular recombination technique construction go out in vertebrates first tool active and can be in mammalian cell swivel base sB( sleeping Beauty) transposon.Recently, from flounder ( pleuronectes platessa) identify in genome pPTN( passport), be found to have the function of the complete transposase of natural coding, in mammalian cell, show transposition activity, becoming in vertebrates first has natural activity tc1-like transposon.

Transposon, as a kind of new and effective transgenosis instrument, is being extensively studied and is being applied to the aspects such as transgenic breeding, bio-reactor, pest control, gene functional research, has broad prospects.For example, by transposon, build in vitro the vector plasmid that has disease resistance or change biology growing rate gene of coding people expectation, imported zygote, make it correctly to integrate on karyomit(e), in histocyte, suitably express, turn out the transgenosis new lines with anticipant character phenotype, thereby cultivate ordinary method within compared with short duration, can not or need the long-term kind that could be bred as of cultivating; By an efficient transposon vector, foreign gene is imported in biology, make its stably express heredity, contribute to people to carry out more deep research to object biology, for the research of somatic cell genetics and genetic expression provide one efficiently, new system easily, and then can improve the production performance of economic living.And be faced with now the problems such as genetically modified stability, security, and only have by further furtheing investigate from now on the impact of Transposon System and swivel base mechanism and its transformation efficiency of host's factor pair, could promote better the development of transgenic technology.Transposon technology, as the important tool of gene function molecule, particularly for functional genomics research, not only will be determined coding region and the non-coding region of sequence, also will identify the biological function that it is relevant.In a word, find more transposon and verify its Structure Mechanism, for tools such as gene functional research, breedings, being of great significance.

Summary of the invention

The object of the invention is, for deficiency of the prior art, provides a kind of nucleotide sequence of separation.

One object more of the present invention is that another kind of separated nucleotide sequence is provided.

Another object of the present invention is that a kind of genophore is provided.

The 4th object of the present invention is that a kind of transposase is provided.

The 5th object of the present invention is that a kind of gene transfer system is provided.

The 6th object of the present invention be, nucleotide sequence, genophore, the transposase of above-mentioned separation, the purposes of gene transfer system are provided.

For realizing above-mentioned first object, the technical scheme that the present invention takes is:

A nucleotide sequence for separation, described nucleotide sequence contains the nucleotide sequence shown in SEQ ID NO.4 and SEQ ID NO.5.

For realizing above-mentioned second object, the technical scheme that the present invention takes is:

A nucleotide sequence for separation, the nucleotide sequence that described nucleotide sequence contains SEQ ID NO.6 or SEQ ID NO.7.

For realizing above-mentioned the 3rd object, the technical scheme that the present invention takes is:

, described genophore comprises:

A) nucleotide sequence for separation, described nucleotide sequence contains the nucleotide sequence shown in SEQ ID NO.4 and SEQ ID NO.5,

And/or

B) nucleotide sequence for separation, the nucleotide sequence that described nucleotide sequence contains SEQ ID NO.6 or SEQ ID NO.7.

As one embodiment of the present invention, described genophore is to take pTgf2-Mlyz2-RFP carrier as underlying carrier, the nucleotide sequence shown in SEQ ID NO.4 is inserted in SpeI and XhoI site at pTgf2-Mlyz2-RFP carrier, in BglII and the KpnI site of pTgf2-Mlyz2-RFP carrier, inserts the nucleotide sequence shown in SEQ ID NO.5.

As another embodiment of the invention, described genophore is to take PCS2+ carrier as underlying carrier, in XhoI and the XbaI site of PCS2+ carrier, inserts the nucleotide sequence shown in SEQ ID NO.6 or SEQ ID NO.7.

For realizing above-mentioned the 4th object, the technical scheme that the present invention takes is:

, the aminoacid sequence of described transposase is as shown in SEQ ID NO.24.

For realizing above-mentioned the 5th object, the technical scheme that the present invention takes is:

, described gene transfer system comprises:

A) nucleotide sequence for separation, described nucleotide sequence contains the nucleotide sequence shown in SEQ ID NO.4 and SEQ ID NO.5,

With

B) a kind of nucleotide sequence of separation (nucleotide sequence that described nucleotide sequence contains SEQ ID NO.6 or SEQ ID NO.7) or transposase (aminoacid sequence of described transposase is as shown in SEQ ID NO.24).

For realizing above-mentioned the 6th object, the technical scheme that the present invention takes is:

As above arbitrary described separated nucleotide sequence, as above arbitrary described genophore, transposase as above, the application of gene transfer system as above in mediated dna transfered cell.

The invention has the advantages that:

Separation obtains having the transposon of complete left and right inverted terminal repeat sequence thm1, and the transposon of the transposase of can encoding thm3, adopt thm1and thm3built thmtransposon system, and in zebra fish, carried out transposition activity checking.Result shows: in 860 transgenic zebrafishes, have 448 to observe red fluorescence, fluorescence rate is about 52.1%; To growing the zebra fish that has red fluorescence to express for 3 months, carry out PCR detection, the integration rate of RFP gene is about 66.67%.Above result of study prompting the present invention has filtered out activated novel thmtransposon and having proved thmtransposon system can carry out high-efficiency transposon in zebra fish.For further checking thmswivel base efficiency and the employing of transposon thmtransposon carries out correlative study in vertebrates and application is laid a good foundation.

Accompanying drawing explanation

Fig. 1 carries out the electrophorogram of Tc1-like transposon pcr amplification in 18 kinds of fish.

Fig. 2 is based on different plant species tc1the molecular system tree that class transposon nucleotide sequence builds.

Fig. 3 A is tc1three kinds of structural pattern figure of-like transposon.

Fig. 3 B is thm1with thm3the comparison of sequence similarity degree.

Fig. 3 C is thm1complete sequence and analysis.Gray area is left and right inverted terminal repeat sequence (ITRs), and the base sequence of white font is transposase binding site.

Fig. 4 A and Fig. 4 B are thm3the analytical results of coded aminoacid sequence.Wherein Fig. 4 A is thm3coded aminoacid sequence and SB, FP, PPTN transposase aminoacid sequence comparison result.Fig. 4 B is thm3complete sequence and coded aminoacid sequence, grey black region is the primary structure territory of Thm transposase.

Fig. 5 is pTgf2-Mlyz2-RFP carrier collection of illustrative plates.

Fig. 6 is transgenosis donor plasmid and helper plasmid schematic diagram.A: transgenosis donor plasmid pThm-Mlyz2-RFP structural representation; B: transgenosis helper plasmid pCS2-ThmTP structural representation.

Fig. 7 is transgenic zebrafish rFPthe luciferase expression situation of gene.A: the Red zebra fish of 28h under microscope transmitted light; B: the Red zebra fish of 28h under microscope fluorescence; C: the Red zebra fish of membrane under microscope transmitted light; D: the Red zebra fish of membrane under microscope fluorescence; E: the Red zebra fish of 100d under natural light.

Fig. 8 is transgenic zebrafish rFPthe PCR of gene detects electrophoretogram.

Embodiment

Below in conjunction with accompanying drawing, embodiment provided by the invention is elaborated.

embodiment 1

one, fish tc1the obtaining and analyzing of-like transposon

The sampling and processing of 1 experiment material

Experiment use carp ( cyprinus carpio), crucian ( carassius auratus), Hua Tau ( hemibarbus maculatus Bleeker), the wheat head ( pseudorasbora parva), silver carp ( hypophthalmichthys molitrix), Gymnocypris prezewalskii ( gymnocypris przewalskiiprzewalskii), grass carp ( ctenopharyn odon idellus), Megalobrama amblycephala ( megalobrama amblycephala), river Puffer ( takifugu), Yellow catfish ( pelteobagrus fulvidraco), long-snout catfish ( leiocassis longirostris) pick up from Qingpu Shanghai Quan Jie plant, Gymnocypris prezewalskii ( gymnocypris przewalskii przewalskii), Yadong salmon ( salmo trutta fario Linne) pick up from Yadong County salmon plant of Tibet Autonomous Region, blue or green Medaka ( oryzias latipes), tilapia ( tilapia), Acipenser gueldenstaedti Brandt ( acipenser gueldenstaedti), angle fish ( pterophyllums carale), goldfish ( carassius auratus), red Buddhist nun Xu Shi Barb ( puntius denisonii) pick up from Shanghai Ocean University's aquatic products and Life Sciences cultivation centralab.The tail fin of obtained different fish is placed in to 75% ethanol, and-25 ℃ save backup.

2 experimental techniques

The extraction of the total DNA of 2.1 fish gene group: adopt salting-out process

The fin (about 100-200mg) of getting various fish, shreds, dry (55 ℃, 5-6min); Add lysate (STE of 410 μ L (pH=8.10), the SDS of 80 μ L (Proteinase K of 10%, pH=8.14) He 10 μ L (20 μ g/ml)); Upset shakes up, 56 ℃ of water bath heat preservation 14-15 hour; Add 340-400 μ L saturated nacl aqueous solution to mix, jog 3min; Add 340-400 μ L chloroform, shake up; 4 ℃ of centrifugal 20min of 12000rpm, move into supernatant liquor in another clean centrifuge tube; Add 450-500 μ L ,-20 ℃ of Virahols are centrifugal, 12000rpm, 20min, 4 ℃; Remove supernatant liquor, stay precipitation, add 800 μ L 75% ethanol; 4 ℃ of centrifugal 12000rpm, 5-15min; To removing ethanol, dry precipitation, add the distilled water of 100-200 μ L, then add the RNase of 2 μ L ,-25 ℃ save backup.This studies all molecule experimental implementation with reference to < < molecular cloning laboratory manual > > (Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning:A Laboratory Manual. 2nd ed[M]. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1989.).

2.2 pcr amplifications and detection

According to tc1the conserved regions of-like transposon and pertinent literature design single primer sequence tc1-likeA:ACAGTTGAAGTCGGAAGTTTACATAC(SEQ ID NO.1), take the above-mentioned fish DNA that obtained as template, carry out pcr amplification, in PCR amplification mixture containing 10mmol/L Tris-HCl(pH 8.4), 20mmol/L KCl, 10mmol/L (NH ₄) ₂sO ₄, 1.5mmol/L MgCl ₂, every kind of dNTPs of 0.1mmol/L, primer concentration be 0.2 μ mol/L, about 200ng.Genomic dna, 2U Taq enzyme, reaction cumulative volume is 50 μ L.Pcr amplification program is: after 94 ℃ of denaturation 5min; 94 ℃ of 30s, 51 ℃ of 30s, 72 ℃ of 2min, totally 35 circulations; Finally again 72 ℃ extend 10min.Get 3 μ L PCR products through agarose gel electrophoresis, after EB dyeing, photographic recording in Bio-Rad gel imaging system.The PCR product of the gene fragment obtaining TA after the steps such as electrophoretic separation, rubber tapping recovery, PCR product purification clones into pMD19-T carrier (being purchased from TaKaRa company), uses respectively carrier universal primer RV-M 5'-GAGCGGATAACAATTTCACACAGG-3'(SEQ ID NO.2) and M13-475'-CGCCAGGGTTTTCCC AGTCACGAC-3'(SEQ ID NO.3) and single primer tC1-likeA examines bacterium, selects directed two positive colonies and checks order, and primer synthesizes and examining order provides by Shanghai biotechnology company limited.

The bioinformatic analysis of 2.3 sequences that obtain

Utilize the software in table 1 to carry out comprehensive bioinformatic analysis to the sequence obtaining: in NCBI public database, to analyze the sequence that obtains and known tc1the homology of-like transposon sequence, is greater than 70% sequence and known by homology tc1-like sequence is constructing system evolutionary tree together, to obtaining these sequences, exists tc1position in the molecular evolution of-like transposon family.Homology is greater than that 70% sequence is carried out left and right inverted terminal repeat sequence (ITRs) and transposase open reading frame is analyzed, to obtaining the sequence that there is left and right inverted terminal repeat sequence (ITRs) and can encode 340 amino acid left and right simultaneously.Obtain after this sequence, by the aminoacid sequence of this sequence codified and known activated tc1-like transposon sB, fP( frog Princereferring to Dong Liu, Cuiping You, Shaojun Liu, Liangguo Liu, Wei Duan, Song Chen, Jinpeng Yan, Yun Liu.Characterization of a Novel Tc1-Like Transposon From Bream (Cyprinidae, Megalobrama) and Its Genetic Variation in the Polyploidy Progeny of Bream – Red Crucian Carp Crosses[J]. J Mol Evol, 2009,69:395-403), pPTNthe corresponding aminoacid sequence of transposase compare, detect it and whether have tc1-like transposase is for the primary structure territory of swivel base, to infer whether it has transposition activity.

Table 1 tc1-like transposon screening bioinformatic analysis project and use software

3 experimental results

3.1 pcr amplifications obtain many sequences

Take 18 kinds of fish DNAs template, tc1-likeA is primer, by pcr amplification, obtains 34 specific fragments (Fig. 1) that length is 1600bp left and right, reclaims specific fragment and checks order, and result shows that 34 sequence size of cloning gained are all between 907-2036bp.

The bioinformatic analysis of 3.2 sequences that obtain

3.2.1 the structure of homology analysis and systematic evolution tree

To 34 sequence alignment analyses of obtain, find that 34 sequences exist respectively in following 14 kinds of fish gene groups, Cypriniformes fish: carp ( cyprinus carpio), crucian ( carassiusauratus), Hua Tau ( hemibarbusmaculatusBleeker), silver carp ( hypophthalmichthysmolitrix), Gymnocypris prezewalskii ( gymnocyprisprzewalskiiprzewalskii), grass carp ( ctenopharynodonidellus), Megalobrama amblycephala ( megalobramaamblycephala), red Buddhist nun Xu Shi Barb ( puntiusdenisonii); He Zhen order: blue or green Medaka ( oryziaslatipes); Perciformes: tilapia ( tilapia), angle fish ( pterophyllumscarale); Tetraodontiformes: river Puffer ( takifugu); Gadiformes: Acipenser gueldenstaedti Brandt ( acipensergueldenstaedti), salmon shape order: Yadong salmon ( salmotrutta fario Linne).Find in addition carp ( cyprinuscarpio), crucian ( carassiusauratus), grass carp ( ctenopharynodonidellus), Yadong salmon ( salmotruttafarioLinne) all there is same sequence in four kinds of fish, this sequence 1473bp, by its called after tbt2, therefore, sequence actual number is 31.

31 nucleotides sequences that obtain are listed in NCBI public database and carry out homology analysis, and result shows wherein with known tc1-like transposon sequence has have 29 of homology, and has 15 sequences and known in these 29 sequences tc1the homology of-like sequence is greater than 70%, wherein Megalobrama amblycephala ( megalobramaamblycephala) the middle 1329bp sequence that obtains tma2in 2009, be found, gene order number is EU585770(Miskey C, Izsvak Z, Plasterk R H, et al. The frog prince:a reconstructed transposon from Rana pipiens with high transpositional activity in vertebrate cells[J]. Nucleic Acids Res, 2003,31:6873-6881), other 14 sequences exist respectively in following 9 kinds of fish gene groups, Cypriniformes fish: carp ( cyprinuscarpio), crucian ( carassiusauratus), silver carp ( hypophthalmichthysmolitrix), Gymnocypris prezewalskii ( gymnocyprisprzewalskiiprzewalskii), grass carp ( ctenopharynodonidellus), red Buddhist nun Xu Shi Barb ( puntiusdenisonii); He Zhen order: blue or green Medaka ( oryziaslatipes); Perciformes: angle fish ( pterophyllumscarale); Salmon shape order: Yadong salmon ( salmotruttafarioLinne), 15 sequences are respectively thm1, thm2, thm3, tci2, tpd1, tpd2, tca2, tcc2, tcc3, tgpp1, tmf1, tpc1, tma2, tbt1, tbt2.These 15 sequences are representational with 15 that obtain from NCBI public database tc1the nucleotide sequence of-like transposon is constructing system evolution NJ tree (Fig. 2) together.As shown in Figure 2, these 15 sequences all belong to tc1-like transposon family, and with rainbow trout ( oncorhynchus mykiss) tsg-1, carp ( cyprinus carpio) tc1, Atlantic salmon ( salmo salar) tss-1, Triangular light ( rasbora heteromorpha) tc1, Megalobrama amblycephala ( megalobrama amblycephala) tma2, togue ( salvelinus namaycush) tsn1deng what find in teleostei tc1-like transposon sibship is nearer.

3.2.2 different sequences left and right inverted terminal repeat sequence (ITRs) and coding transposase analytical results

To obtaining 15 sequences in above-mentioned steps, carry out, after left and right inverted terminal repeat sequence (ITRs) and the analysis of transposase open reading frame, finding mainly to have occurred following three kinds tc1the structural pattern of-like transposon (Fig. 3 A), a pattern is to have complete left and right inverted terminal repeat sequence (ITRs), but can not encode complete transposase, thm1, tgpp1and tbt1pattern for this reason; B pattern does not have complete left and right inverted terminal repeat sequence (ITRs), the complete transposase of can not encoding, thm2, tci2, tpd1, tpd2, tca2, tcc3, tmf1, tpc1and tbt2pattern for this reason; C pattern is not have complete left and right inverted terminal repeat sequence (ITRs), but the complete transposase of encoding, tcc2, tma2and thm3pattern for this reason, wherein tcc2280 amino acid of codified, tma2238 amino acid of codified, thm3335 amino acid of codified.

thm1the left arm nucleotide sequence (367nt) of transposon is as shown in SEQ ID NO.4, and wherein 1-18nt is binding site outside left-end point, and 176-192nt is binding site inside left-end point, and 1-208nt is left-end point LTR; Right arm nucleotide sequence (230nt) is as shown in SEQ ID NO.5, and wherein 27-49nt is binding site inside right end, and 214-230nt is binding site outside right end. thm3nucleotide sequence as shown in SEQ ID NO.6, its coding 335 amino acid whose ORF sequences as shown in SEQ ID NO.7, wherein last three bases are terminator.

From the above results thm3there are 335 the amino acid whose sequences of can encoding, but do not there is complete left and right inverted terminal repeat sequence (ITRs).And obtain in fish of the same race thm1with thm3similarity is 91%(Fig. 3 B), it has the complete left and right inverted terminal repeat sequence (ITRs) (Fig. 3 C) of 210nt left and right, but because of part base mutation, does not have the possibility of coding continuous amino acid.Therefore, can adopt the different piece of two sequences to set up novel tc1-like transposon- thmtransposon system.

3.2.3 thm3the analytical results of coded aminoacid sequence

Right thm3coded aminoacid sequence (SEQ ID NO.24) with sB, fP, pPTNthree kinds of transposon transposases compare, find its with sBthe aminoacid sequence similarity that transposon transposase is corresponding is the highest, and similarity is 80%(Fig. 4 A).Analyze simultaneously thm3the corresponding primary structure of coded aminoacid sequence territory, result shows that the primary structure territory that occurs for catalysis swivel base all exists (Fig. 4 B) as DD (34) E, NLS etc.Therefore the transposase that this institute obtains probably has transposition activity, can be used for carrying out the experiment that next step builds transposon system.

two, the structure of Thm transposon system and checking

1 experimental technique

1.1 Thm transposon systems build

Take above-mentioned sequence information as condition adopts Protocols in Molecular Biology, build transgenosis donor plasmid pThm-Mlyz2-RFP and transgenosis helper plasmid pCS2-ThmTP.Wherein, build Thm transposon system primer information used as shown in table 2.

Table 2 builds Thm transposon system primer information used

Note: underlining sequence is restriction enzyme site.

The structure of transgenosis donor plasmid pThm-Mlyz2-RFP: the total DNA of silver carp tail fin of take is template, is used primer ThmLF and ThmLR amplification thm1the left arm of transposon (367nt) DNA sequence dna (SEQ ID NO.4), the PCR product obtaining TA after the steps such as electrophoretic separation, rubber tapping recovery, PCR product purification clones the carrier into pMD19-T, with carrier universal primer M13F(-47) 5'-CGCCAGGGTTTTCCCAGTCACGAC-3'(SEQ ID NO.22) and M13R(-48) 5'-AGCGGATAACAATTTCACACAGGA-3'(SEQ ID NO.23) inspection bacterium, select positive colony and extract plasmid DNA, re-use that primer ThmLF-SpeI and ThmLR-XhoI amplification obtain with double enzyme site thm1the left arm of transposon (367nt) DNA sequence dna, use SpeI and XhoI double digestion, the left arm of double digestion (367nt) DNA sequence dna is connected to pTgf2-Mlyz2-RFP underlying carrier after SpeI and XhoI double digestion, and (collection of illustrative plates as shown in Figure 5, this vector construction is shown in and delivers document: Guo Xiuming, yellow innovation, Shen Ruijie, Jiang Xiayun, Chen Jie, Zou Shuming. tgf2the insertion efficient studies [J] of transposon in Megalobrama amblycephala genome. heredity, 2013,35 (8): 63-68.), thereby obtain band thm1the transgenosis donor plasmid pThmL-Mlyz2-RFP of the left arm of transposon (367nt) DNA sequence dna.

To band thm1the transgenosis donor plasmid pThmL-Mlyz2-RFP of the left arm of transposon (367nt) DNA sequence dna carries out BglII and KpnI double digestion.Meanwhile, the total DNA of silver carp tail fin of take is template, uses primer ThmRF and ThmRR amplification thm1the right arm of transposon (230nt) DNA sequence dna (SEQ ID NO.5), the PCR product obtaining TA after the steps such as electrophoretic separation, rubber tapping recovery, PCR product purification clones the carrier into pMD19-T, with carrier universal primer M13F(-47) and M13R(-48) inspection bacterium, select positive colony and extract plasmid DNA, re-use primer ThmRF-BglII and ThmRR-KpnI amplified band double enzyme site thm1the right side of transposon (230nt) arm DNA sequence dna, is used BglII and KpnI double digestion, is subcloned in pThmL-Mlyz2-RFP.Built transgenosis donor plasmid pThm-Mlyz2-RFP, this plasmid comprises thm1the left arm of transposon (367nt) DNA sequence dna, right arm (230nt) DNA sequence dna.

The structure of transgenosis helper plasmid pCS2-ThmTP: the total RNA of silver carp body early embryo of take is template, is used primer ThmA-169F and ThmA-1176R amplification thm3transposase ORF(SEQ ID NO.7), the PCR product of the gene fragment obtaining TA after the steps such as electrophoretic separation, rubber tapping recovery, PCR product purification clones the carrier into pMD19-T, with universal primer RV-M and M13-47 inspection bacterium, select positive colony and extract plasmid DNA, use primer ThmA-XhoI and ThmA-XbaI amplification thm3transposase ORF, is used XhoI and XbaI double digestion to obtain thm3oRF, will thm3oRF be connected to the PCS2+ underlying carrier after XhoI and XbaI double digestion, thereby build transgenosis helper plasmid pCS2-ThmTP, the collection of illustrative plates of PCS2+ underlying carrier and sequence are shown in http://www.addgene.org/vector-database/2295/.

1.2 microinjection checking transposition activities

The Thm3 transposase mRNA that pThm-Mlyz2-RFP plasmid and in-vitro transcription are gone out, is dissolved in certain density phenol red and distilled water after purifying, the final concentration of plasmid and mRNA is 50pg/nl, deposits in-80 ℃ of refrigerators standby.Under three-dimensional anatomical lens, the zebra fish zygote in 1-2 cell stage is injected, every piece of zygote injection volume is 2nL.It is that the thermostat container of 28 ℃ is cultivated that zygote after injection is put into temperature, and 4h changes water one time, 6h at fluorescence microscopy Microscopic observation zebra fish red fluorescence expression once, after observing fish body and having red fluorescence to express, statistics fluorescence rate.To growing the zebra fish that has red fluorescence to express for 3 months, carry out PCR detection, count rFPthe integration rate of gene (red fluorescent protein gene) in zebra fish genome.Detection primer is as follows.

2 experimental results

2.1 thmthe structure of transgenosis system plasmid

In RNA by RT-PCR detection display silver carp tissue, contain thm3gene order, by molecule clone technology, will thm3the ORF frame sequence construct of gene enters in transgenosis helper plasmid pCS2+, and structure is as shown in B in Fig. 6.

Also built transgenosis donor plasmid pThm-Mlyz2-RFP, this plasmid comprises simultaneously thm1the left arm nucleotide sequence of transposon and right arm nucleotide sequence, structure is as shown in A in Fig. 6.With pCS2-ThmTP plasmid, be that template is carried out in-vitro transcription go out the to encode mRNA of Thm transposase, to mediate exogenous origin gene integrator that donor plasmid carries in zebra fish genome.

The observation of 2.2 transgenic zebrafish red fluorescences

Transgenic zebrafish started to observe red fluorescence in the muscle formation phase, and red fluorescence presents the banded spot of several high brightness; Along with the development of fetal development, the trend that fluorescence intensity has continuous increase, area constantly to expand, part fish body also can be observed red fluorescence (A-E in Fig. 7) under natural light.Zebra fish about 100 days can observe carmine spot under natural light.

By statistics, have 860 tail zebra fish membranes after microinjection, wherein have 448 tails to observe red fluorescence, fluorescence rate is about 52.1%, part batch in once there is the fluorescence rate (table 3) up to 79%.

The statistics of 2.3 transgenic zebrafish positive rates

The transgenic zebrafish tissue extraction DNA that chooses 27 tails growth 100d expression red fluorescences carries out PCR detection, and detected result shows rFPthis reporter gene has been integrated in the genomic dna of transgenic zebrafish (Fig. 8).Wherein 18 tails can detect foreign gene, and 9 tails do not detect foreign gene, its mediation rFPthe integration rate of this foreign gene in zebra fish genome is about 66.67%(table 3).

Table 3 thmtransposon swivel base Efficiency Statistics table

This research and establishment based on thm1with thm3the Thm transposon system of sequence, and utilize containing of building rFPthe Thm transposon system of gene carries out microinjection and carries out transgenic research in this outstanding model animals of zebra fish, to verify the activity of Thm transposon system.After microinjection operation, at fluorescence microscopy Microscopic observation, at zebrafish embryo muscle, form the expression that phase can be observed red fluorescence, this observations conforms to known transgenic research result in Tang fish, and (letter is clear, white person of outstanding talent, Ye Xing, Xia Shiling, Liang Xufang, Luo Jianren. zebra fish mylz2the clone of promotor and the structure that turns green fluorescence protein gene fish. Chinese aquatic science, 2004,11 (5): 391-395.).After the whole membranes of transgenic zebrafish, add up its luciferase expression rate, in 860 zebra fishs, have 448 to observe red fluorescence, fluorescence rate average is about 52.1%.This fluorescence rate higher than the fluorescence rate of utilizing Tgf2 transposon system to study in Megalobrama amblycephala (Guo Xiuming, yellow innovation, Shen Ruijie, Jiang Xiayun, Chen Jie, Zou Shuming. tgf2the insertion efficient studies [J] of transposon in Megalobrama amblycephala genome. heredity, 2013, 35 (8): 63-68.), also higher than utilizing SB transposon system mouse, in Hele cell, carry out green fluorescence expression rate (the M á t é s of transgenic research, L, Chuah, MK, Belay, E, Jerchow, B, Manoj, N, Acosta-Sanchez, A et al. Molecular evolution of a novel hyperactive Sleeping Beauty transposase enables robust stable gene transfer in vertebrates. Nature, 2009, 12:1148-1156).Through PCR, detect research, find rFPthe integration rate of gene in the zebra fish genome that has red fluorescence to express is about 66.67%, and this integration rate is higher, shows that the transposon system of transposon DNA sequence dna of the present invention and structure has important using value in transgenic research.

The above is only the preferred embodiment of the present invention; it should be pointed out that for those skilled in the art, do not departing under the prerequisite of the inventive method; can also make some improvement and supplement, these improvement and supplement and also should be considered as protection scope of the present invention.

SEQUENCE LISTING

<110> Shanghai Ocean University

Active transposon of <120> fish Tc1-like and uses thereof

<130> /

<160> 25

<170> PatentIn version 3.3

<210> 1

<211> 26

<212> DNA

<213> artificial sequence

<400> 1

acagttgaag tcggaagttt acatac 26

<210> 2

<211> 24

<212> DNA

<213> artificial sequence

<400> 2

gagcggataa caatttcaca cagg 24

<210> 3

<211> 24

<212> DNA

<213> artificial sequence

<400> 3

cgccagggtt ttcccagtca cgac 24

<210> 4

<211> 367

<212> DNA

<213> Hypophthalmichthys molitrix

<400> 4

tacagttgaa gtcggaagtt tacatacact taaaaaaaaa aaaaacacaa aaactttttt 60

ttcttcactg tcatgcatta aatcagagta aactatttct gttttagatc aataaatatt 120

aacatatttt ttgcatttgt taaatgtcag aatttttatg tatttttctt atcactttca 180

tcaaagacag aagtatacat acactaagtt tattgtgtct ttaaacaaaa agaaaactcc 240

agatgattcc attctgagct taagaagctt ctgataggtt aattgattct atttgagtta 300

attggtggca cgcctgtgga tgaatataaa ggcacacctc aaacacagag cctctttctt 360

tgacatc 367

<210> 5

<211> 230

<212> DNA

<213> Hypophthalmichthys molitrix

<400> 5

ttctaccaaa tactaaggaa gtgtatgtat acttctgact ttgatgaaag tgataaaaaa 60

atacataaaa attctccctc gctcgattct gacatttaac aaatgaaaaa aatatgttaa 120

ttataattga tctaaaacag aaaaagttta ctctgattta atgtatgaca gtaaagaaaa 180

aagtttttgt gttttttctg aagtgtatgt aaacttccga cttaactgta 230

<210> 6

<211> 1209

<212> DNA

<213> Hypophthalmichthys molitrix

<400> 6

tacagttgaa gtcggaagtt tacatacact aagtttattg tgtctttaaa caaaaagaaa 60

actccaaatg attccattct gatcttaaga agcttctgat aggttaattg attccatttg 120

agttaattgg tggcacacct caaacacaga gcctctttct ttgacatcat gggaaaatca 180

agagaaatca accaagacat caggaaaaga attgtggacc tccacaagtg tggctcatcc 240

ttaggtgcaa tttccagatg cctgaaggtc ccacgttcat ctgttcagat aataatacgc 300

aagtataaaa aacatgggaa tgtacaacca tcataccact caagaaggag acggattctg 360

agtcccagag aggaatgttt tttggtgcaa atcaacccca ggacaacagc aaaagacctt 420

gtgaagatgc tggctgaaac tggtaagaca gtgtcattat ccacagtaaa acgagtcctg 480

taccaccatg agctgaaagg ttactctggg aggagaaagc cattacttca aaaccaccat 540

aaagccagac tacagtttgc aactgcacat ggggacaaaa atcgtaattt ctggagacat 600

gtcctgtggt ctgatgaaac aaaaattgaa ctgttcggcc ataatgataa acagtatatt 660

tggaggaaaa agggcgaagc tttgaagcct cagaacacca tctcaactgt gaagtatggg 720

ggtggtagta taatgatgtc gggctgcttt gctgcagaag ggactggtgc acttcacaaa 780

atagatggca tcatgataaa agaaaattat gtggatatat tgaagcagca tctgaagaca 840

tcagccagga agttaaagct tgggcgcaaa tgggtcttcc aaatggacaa tgaccccaag 900

cataccacca aattagttac aaagtggctt aaggacaaca aagtcaaggt attggagtgg 960

ccatatcaaa gccctgatct caatcccata gaaaatttgt ggacagcact gaaaaggcaa 1020

gtgcgagcga gaaggcttac aaacctgatc cagttacacc agttctgtca agaggagtgg 1080

gccaaaattc cagcaaacta ttgtagaaag cttgcggaag gatacccaaa acgtttaaac 1140

gtgaaacagt ttcggggcaa ttctaccaaa tactaaggaa gtgtatgtaa acttccgact 1200

tcaactgta 1209

<210> 7

<211> 1008

<212> DNA

<213> Hypophthalmichthys molitrix

<400> 7

atgggaaaat caagagaaat caaccaagac atcaggaaaa gaattgtgga cctccacaag 60

tgtggctcat ccttaggtgc aatttccaga tgcctgaagg tcccacgttc atctgttcag 120

ataataatac gcaagtataa aaaacatggg aatgtacaac catcatacca ctcaagaagg 180

agacggattc tgagtcccag agaggaatgt tttttggtgc aaatcaaccc caggacaaca 240

gcaaaagacc ttgtgaagat gctggctgaa actggtaaga cagtgtcatt atccacagta 300

aaacgagtcc tgtaccacca tgagctgaaa ggttactctg ggaggagaaa gccattactt 360

caaaaccacc ataaagccag actacagttt gcaactgcac atggggacaa aaatcgtaat 420

ttctggagac atgtcctgtg gtctgatgaa acaaaaattg aactgttcgg ccataatgat 480

aaacagtata tttggaggaa aaagggcgaa gctttgaagc ctcagaacac catctcaact 540

gtgaagtatg ggggtggtag tataatgatg tcgggctgct ttgctgcaga agggactggt 600

gcacttcaca aaatagatgg catcatgata aaagaaaatt atgtggatat attgaagcag 660

catctgaaga catcagccag gaagttaaag cttgggcgca aatgggtctt ccaaatggac 720

aatgacccca agcataccac caaattagtt acaaagtggc ttaaggacaa caaagtcaag 780

gtattggagt ggccatatca aagccctgat ctcaatccca tagaaaattt gtggacagca 840

ctgaaaaggc aagtgcgagc gagaaggctt acaaacctga tccagttaca ccagttctgt 900

caagaggagt gggccaaaat tccagcaaac tattgtagaa agcttgcgga aggataccca 960

aaacgtttaa acgtgaaaca gtttcggggc aattctacca aatactaa 1008

<210> 8

<211> 18

<212> DNA

<213> artificial sequence

<400> 8

atgggaaaat caagagaa 18

<210> 9

<211> 18

<212> DNA

<213> artificial sequence

<400> 9

ttagtatttg gtagaatt 18

<210> 10

<211> 27

<212> DNA

<213> artificial sequence

<400> 10

ccgctcgaga tgggaaaatc aagagaa 27

<210> 11

<211> 26

<212> DNA

<213> artificial sequence

<400> 11

gctctagatt agtatttggt agaatt 26

<210> 12

<211> 18

<212> DNA

<213> artificial sequence

<400> 12

tacagttgaa gtcggaag 18

<210> 13

<211> 18

<212> DNA

<213> artificial sequence

<400> 13

ctctgtgttt gaggtgtg 18

<210> 14

<211> 26

<212> DNA

<213> artificial sequence

<400> 14

ggactagtta cagttgaagt cggaag 26

<210> 15

<211> 27

<212> DNA

<213> artificial sequence

<400> 15

ccgctcgagc tctgtgtttg aggtgtg 27

<210> 16

<211> 24

<212> DNA

<213> artificial sequence

<400> 16

gaagtgtatg tatacttctg actt 24

<210> 17

<211> 24

<212> DNA

<213> artificial sequence

<400> 17

tacagttgaa gtcggaagtt taca 24

<210> 18

<211> 32

<212> DNA

<213> artificial sequence

<400> 18

gaagatctga agtgtatgta tacttctgac tt 32

<210> 19

<211> 32

<212> DNA

<213> artificial sequence

<400> 19

ggggtaccta cagttgaagt cggaagttta ca 32

<210> 20

<211> 21

<212> DNA

<213> artificial sequence

<400> 20

atggcctcct ccgagaacgt c 21

<210> 21

<211> 27

<212> DNA

<213> artificial sequence

<400> 21

tggttacaaa taaagcaata gcatcac 27

<210> 22

<211> 24

<212> DNA

<213> artificial sequence

<400> 22

cgccagggtt ttcccagtca cgac 24

<210> 23

<211> 24

<212> DNA

<213> artificial sequence

<400> 23

agcggataac aatttcacac agga 24

<210> 24

<211> 335

<212> PRT

<213> Hypophthalmichthys molitrix

<400> 24

Met Gly Lys Ser Arg Glu Ile Asn Gln Asp Ile Arg Lys Arg Ile Val

1 5 10 15

Asp Leu His Lys Cys Gly Ser Ser Leu Gly Ala Ile Ser Arg Cys Leu

20 25 30

Lys Val Pro Arg Ser Ser Val Gln Ile Ile Ile Arg Lys Tyr Lys Lys

35 40 45

His Gly Asn Val Gln Pro Ser Tyr His Ser Arg Arg Arg Arg Ile Leu

50 55 60

Ser Pro Arg Glu Glu Cys Phe Leu Val Gln Ile Asn Pro Arg Thr Thr

65 70 75 80

Ala Lys Asp Leu Val Lys Met Leu Ala Glu Thr Gly Lys Thr Val Ser

85 90 95

Leu Ser Thr Val Lys Arg Val Leu Tyr His His Glu Leu Lys Gly Tyr

100 105 110

Ser Gly Arg Arg Lys Pro Leu Leu Gln Asn His His Lys Ala Arg Leu

115 120 125

Gln Phe Ala Thr Ala His Gly Asp Lys Asn Arg Asn Phe Trp Arg His

130 135 140

Val Leu Trp Ser Asp Glu Thr Lys Ile Glu Leu Phe Gly His Asn Asp

145 150 155 160

Lys Gln Tyr Ile Trp Arg Lys Lys Gly Glu Ala Leu Lys Pro Gln Asn

165 170 175

Thr Ile Ser Thr Val Lys Tyr Gly Gly Gly Ser Ile Met Met Ser Gly

180 185 190

Cys Phe Ala Ala Glu Gly Thr Gly Ala Leu His Lys Ile Asp Gly Ile

195 200 205

Met Ile Lys Glu Asn Tyr Val Asp Ile Leu Lys Gln His Leu Lys Thr

210 215 220

Ser Ala Arg Lys Leu Lys Leu Gly Arg Lys Trp Val Phe Gln Met Asp

225 230 235 240

Asn Asp Pro Lys His Thr Thr Lys Leu Val Thr Lys Trp Leu Lys Asp

245 250 255

Asn Lys Val Lys Val Leu Glu Trp Pro Tyr Gln Ser Pro Asp Leu Asn

260 265 270

Pro Ile Glu Asn Leu Trp Thr Ala Leu Lys Arg Gln Val Arg Ala Arg

275 280 285

Arg Leu Thr Asn Leu Ile Gln Leu His Gln Phe Cys Gln Glu Glu Trp

290 295 300

Ala Lys Ile Pro Ala Asn Tyr Cys Arg Lys Leu Ala Glu Gly Tyr Pro

305 310 315 320

Lys Arg Leu Asn Val Lys Gln Phe Arg Gly Asn Ser Thr Lys Tyr

325 330 335

Claims (8)

1. a separated nucleotide sequence, is characterized in that, described nucleotide sequence contains the nucleotide sequence shown in SEQ ID NO.4 and SEQ ID NO.5.

2. a separated nucleotide sequence, is characterized in that, the nucleotide sequence that described nucleotide sequence contains SEQ ID NO.6 or SEQ ID NO.7.

3. a genophore, is characterized in that, described genophore comprises the nucleotide sequence described in claim 1 and/or 2.

4. genophore according to claim 3, it is characterized in that, described genophore is to take pTgf2-Mlyz2-RFP carrier as underlying carrier, the nucleotide sequence shown in SEQ ID NO.4 is inserted in SpeI and XhoI site at pTgf2-Mlyz2-RFP carrier, in BglII and the KpnI site of pTgf2-Mlyz2-RFP carrier, inserts the nucleotide sequence shown in SEQ ID NO.5.

5. genophore according to claim 3, is characterized in that, described genophore is to take PCS2+ carrier as underlying carrier, in XhoI and the XbaI site of PCS2+ carrier, inserts the nucleotide sequence shown in SEQ ID NO.6 or SEQ ID NO.7.

6. a transposase, is characterized in that, the aminoacid sequence of described transposase is as shown in SEQ ID NO.24.

7. a gene transfer system, is characterized in that, described gene transfer system comprises:

A) nucleotide sequence claimed in claim 1; With

B) nucleotide sequence claimed in claim 2 or transposase claimed in claim 4.

8. the nucleotide sequence described in claim 1 or 2, claim 3-5 arbitrary described genophore, transposase claimed in claim 6, the application of gene transfer system claimed in claim 7 in mediated dna transfered cell.

Images