CN105567711B - The construction method and purposes of a kind of jian carp retrotransposon and transgene carrier - Google Patents

Abstract

The invention discloses a kind of jian carp retrotransposon and the construction method and purposes of transgene carrier, the transposons includes nucleotide sequence shown in SEQ ID NO.1；A kind of nucleotide sequence of engineer's synthesis, as shown in SEQ ID NO.2；A kind of genophore, the genophore include the jian carp retrotransposon and/or the nucleotide sequence SEQ ID NO.2 that the engineer synthesizes.The jian carp retrotransposon and genophore imports the application in cell in mediated dna.The present invention in jian carp liver cell by carrying out transposition activity verification, confirm that above-mentioned transposons has transposition activity, the gene transfer system can carry out high-efficiency transposon in jian carp liver cell, thus correlative study is carried out in vertebrate for the further transposition efficiency for verifying transposons and using the transposons by the present invention and application is laid a good foundation.

Description

The construction method and purposes of a kind of jian carp retrotransposon and transgene carrier

Technical field

The present invention relates to genetic engineering field, be specifically related to a kind of jian carp ty3-gypsy retrotransposons JRE and its Purposes.

Background technology

DNA transposons (transposon) be it is a kind of can on eucaryote chromosome continuous shift position function Property DNA fragmentation be considered as causing eucaryote hereditary to finding that new gene and analysis gene function play an important role One of the main reason for variation.Transposons as insertion mutation is former or molecular label have been widely used for gene separation and gram Grand, some even can be used as preparation of the conversion carrier for genetically modified animals and plants.piggyBacTransposons is in drosophila (Bactrocera tryoni,)^[4], silkworm (Bombyx mori) etc. in insects, an efficient, steady carrier can be used as Transgenic research is carried out, and germ line is promoted to convert.Also utilization is had been reported that on poultrymarinerTransposable element, which can be realized, to be turned The preparation of gene chicken.And caenorhabditis elegan (Caenorhabditis elegans) in findTc3Transposable element then at Work(conversion zebra fish (Danio rerio).According to the difference of swivel base mode, transposons can be divided into DNA transposons and reverse transcription turns Stand (retrotransposon).Wherein, retrotransposon refers to using RNA as intermediary, and reverse transcription after DNA at being turned It is first (retroposon) also referred to as to return seat for the moving element of seat.In recent years research shows that return seat member be in eucaryote most Important a kind of swivel base member element, and the maximum movable genetic constitution of one kind of quantity in current known higher plant.According to Whether contain long terminal repeats (long terminal repeat, LTR) in sequential structure and LTR reverse transcriptions can be divided into Transposons and without LTR retrotransposons.

LTRRetrotransposon is mainly made of 2 open reading frame (open reading frames, ORFs), i.e., Core protein gene (gag) and enzyme gene region (pol).Gag encoding histones are similar to the relevant egg of RNA virus particle reverse transcription In vain,polMajor protein in gene code process of reverse-transcription, including protease (PR), reverse transcriptase (RT), RNase H and Integrase (INT).RT and RNase H be inverted rotor replicate, the key enzyme of swivel base, INT main functions are to make retrotransposon The novel site being inserted into chromosome.Due topolThe arrangement position of genetic homology and INT albumen,LTRRetrotransposon Be divided into forty3-gypsyWithty1-copiaTwo major classes.LTRRetrotransposon using " copy-duplication " mechanism, It is constantly expanded in host gene;Due to returning seat member with controlling elements such as enhancer, promoters, host's base is eventually participated in The processes such as the expression of cause and the generation of new gene.Some LTR reversions have been identified in a variety of aquatile genomes at present Transposons is recorded, such as zebra fish, goldfish（Carassius auratus）, megalobrama amblycephala（Megalobrama amblycephala） Deng, but there is no the reports of LTR transposons in jian carp.This insertion of retrotransposon causes to generate the function of becoming and lead Have in the screening of fish important character related gene, the functional study of important gene and transgenic animals etc. important Study and use foreground.Such as Tol2 transposon systems have been used to the transgenic research of many animals, successfully obtain mutation Body, such as drosophila (Drosophila melanogaster), zebra fish, Africa xenopus (Xenopus laevis), chicken (Gallus Gallus), mouse (Mus musculus) isotype biology.

Retrotransposon is being extensively studied as a kind of new and effective transgenosis tool and is being applied to turn base Because of breeding, bioreactor, control of insect, gene functional research etc., have broad prospects.For example, passing through transposons The desired vector plasmid for having disease resistance or changing biology growing rate gene of structure coding people in vitro, is conducted into Fertilized eggs are allowed to correctly integrate on chromosome, suitably be expressed in histocyte, turn out and turn with anticipant character phenotype Gene new lines cannot or need to cultivate the kind that could be bred as a long time to cultivate conventional method in short period of time；It borrows An efficient transposon vector is helped, foreign gene is imported in biology, so that it is stablized expression and heredity, contributes to people to purpose Biology carries out more in-depth study, and one is provided efficiently, easily newly for the research and gene expression of somatic cell genetics System, and then the production performance of economic living can be improved.And the problems such as being faced with the stability of transgenosis, safety now, only Have through further influence of the further investigation Transposon System and transposition mechanism and host factor to its transformation efficiency from now on, ability Preferably promote the development of transgenic technology.Important tool of the transposon technology as gene function molecule, especially for work( For energy genomics research, not only to determine code area and the noncoding region of sequence, also to identify its relevant biological function. In short, finding more transposons and verifying its Structure Mechanism, there is highly important meaning for gene functional research, breeding etc. Justice.

Invention content

The object of the present invention is to provide a kind of jian carp retrotransposon and the construction methods and purposes of transgene carrier.

To achieve the above object, the technical solution adopted by the present invention is that：

A kind of jian carp retrotransposon, nucleotide sequence contain nucleotide sequence shown in SEQ ID NO.1.

A kind of nucleotide sequence of separation, the nucleotide sequence contain the nucleotide sequence of SEQ ID NO.2.

A kind of genophore, the genophore include：Nucleosides shown in SEQ ID NO.1 and SEQ ID NO.2 Acid sequence.

As one embodiment of the present invention, it is basic carry that the genophore, which is with jian carp retrotransposon, Body, as another embodiment of the invention, it is basic carry that the genophore, which is with jian carp retrotransposon JRE, Body is inserted into nucleotide sequence shown in SEQ ID NO.2 at 1237 sites JRE.

A kind of gene transfer system, including：

a）The nucleotide sequence SEQ No 1,

b）The nucleotide sequence SEQ No 2.

The jian carp retrotransposon JRE imports the application in cell in mediated dna.

The genophore and gene transfer system imports the application in cell in mediated dna.

Under study for action find build in lithium genome exist the transposons of a ty3-gypsy retrotransposition subtypes, general It is named as JRE transposons, and the jian carp retrotransposon JRE has the classical architecture (Fig. 1) of LTR retrotransposons, Include the coded sequence of gag albumen and pol protein structure domains.Wherein the gene order of pol structural domains is PR-RT-RH-IN, because And the transposons belongs to ty3-gypsy types.JRE is made of 5126 bp nucleotide altogether, including 470 bp, 5 end LTR, 3 end LTR of 4203 bp ORF and 453 bp.Entire ORF encodes 1401 amino acid, and 5 end LTR and 3 end LTR have two It is a to reverse the border sequence TG. .CA repeated.JRE transposons both sides are repeated by the forward direction on boundary of ATCTT.LTR has The typical inverted repeats area for being started with TGT, being terminated with ACA, has also discovered polypurine site in LTR, is such as located at 203 AAAGGAGGTAA [25] at bp has the PBS sequence complementary with the ends ser-tRNA 3 ' in 5 end LRT.

Advantageous effect：The invention has the advantages that：

1, the isolated transposons JRE with complete left and right long terminal repeats, and with this transposons structure Transposon system, and transposition activity verification has been carried out in jian carp liver cell.

2, transposons involved in the present invention derives from jian carp itself, therefore has more in jian carp transgenic research Good homology has higher transposition efficiency.

Description of the drawings

Fig. 1, JRE transposons structure chart open reading frame are indicated with rectangle;2 triangles indicate inverted repeats (TG...CA);Gag, core protein;Pol, enzyme gene GAP-associated protein GAP;PR, protease;RT, reverse transcriptase; RH, RNA enzyme;IN, integrase;PBS, PPT indicate primer binding sites and poly purine position respectively

Fig. 2 JRE transposons Molecular Phylogenetic trees are built；

Fig. 3 JRE transposon transgene Vector maps.

Specific implementation mode

Below by specific implementation mode combination attached drawing, invention is further described in detail.But those skilled in the art It will be understood that the following example is merely to illustrate the present invention, and should not be taken as limiting the scope of the invention.It is not specified in embodiment Particular technique or condition person, according to technology described in document in the art or condition (such as with reference to J. Pehanorm Brookers Deng write, what Huang Peitang etc. was translated《Molecular Cloning:A Laboratory guide》, the third edition, Science Press) or according to product description into Row.Reagents or instruments used without specified manufacturer, being can be with conventional products that are commercially available.

The acquisition and analysis of embodiment 1, jian carp ty3-gypsy retrotransposons JRE

1.1 experiment fishes

Jian carp preserves for this laboratory, and acquisition blood carries out extracting genome DNA.

1.2 extracting genome DNA

It is extracted using Dalian treasured bioengineering Co., Ltd Whole Blood Genomic DNA Extraction Kit Genome DNA of Jian Carp, key step are as follows:5 tail of jian carp, the 10 μ L uses of blood of tail vein sterile blood sampling, acquisition is taken to contain 56 DEG C of 15 min of digestion of Proteinase K and RNase A lysates, are then added 200 μ L, 100% ethyl alcohol, carried out column purification, Finally elution buffer is used to elute the DNA combined with film, is tested using agarose gel electrophoresis.Use distilled water DNA sample is diluted spare, other Sample storages are spare to -70 DEG C.

1.3 PCR are expanded and detection

According to the correlation text of the conserved region of jian carp genome portion sequencing result and Ty3-gypsy transposons in early-stage study Design primer sequence 5 ' GATACATCGCCCATCCCTACG3 ' is offered, 5 ' GATACATCGCCCATCCCTACG3 ' are obtained with above-mentioned Jian carp DNA is template, carries out PCR amplifications, Tris-HCl containing 10mmol/L in PCR amplification mixtures（pH 8.4）、 20mmol/L KCl、10mmol/L (NH4)₂SO4,1.5mmol/L MgCl2,0.1mmol/L each dNTPs, primer concentration For 0.2 μm of ol/L, about 200ng.Genomic DNA, 2U Taq enzymes, reaction total volume are 50 μ L.PCR amplification programs are：94℃ After pre-degeneration 5min；98 DEG C of 10s, 68 DEG C of 15min, totally 30 recycle；Last 72 DEG C of extension 10min again.Take 3 μ L PCR productions Object is through agarose gel electrophoresis, after EB dyeing, the film recording in Bio-Rad gel imaging systems.The genetic fragment of acquisition PCR products through being separated by electrophoresis, being tapped and recovered, PCR product purifications and etc. after TA clone into pMD19-T carriers（It is purchased from TaKaRa companies）, the double positive colonies for selecting orientation are sequenced, and primer synthesis and examining order are by Shanghai bioengineering Co., Ltd provides.

1.4 Analyses of molecular systematics

The JRE retrotransposon full length sequences obtained using the analysis of the websites NIH BLAST softwares, while in GenBank In be compared, download higher other species ty3-gypsy amino acid sequences of amino acid sequence similarity, use Clustal W softwares are analyzed, and are analyzed using neighbor-joining structure systematic evolution trees.Phylogenetic analysis Employed in sequence be: Amphimedon queenslandica (XP-003390581.1), Xiphophorus maculates (AF193865.), Saccoglossus kowalevskii (XP002732475.1), Azumapecten farreri (ABM90392), Mizuhopecten yessoensis (ABM90393), Oreochromis niloticus (XP_003460117), Xenopus tropicalis (XP_002935079.2), Danio rerio (AF503912), Candidatus entotheonella (ETW98900), Clonorchis sinensis (GAA49140)。

1.5 experimental result

1.5.1 PCR amplification is to overall length

By the repetition sequencing of at least four clone, the overall length of transposons is obtained, GenBank points are searched for by BLASTX Repetitive sequence analysis tool in analysis and 1.6 softwares of Staden Package confirms that the retrotransposon is inverted with LTR The classical architecture (Fig. 1) for recording transposons, includes the coded sequence of gag albumen and pol protein structure domains.Wherein pol structural domains Gene order is PR-RT-RH-IN, thus the transposons belongs to ty3-gypsy types.JRE is altogether by 5126 bp nucleotide It constitutes, including 3 end LTR of 470 bp 5 end LTR, 4203 bp ORF and 453 bp.Entire ORF encodes 1401 amino There are two reverse the border sequence TG. .CA repeated for acid, 5 end LTR and 3 end LTR tools.JRE transposons both sides be with ATCTT is that the positive of boundary repeats.LTR has the typical inverted repeats area for starting with TGT, terminating with ACA, in LTR Polypurine site is had also discovered, as being located at the AAAGGAGGTAA [25] at 203 bp, is had in 5 end LRT and ser- The complementary PBS sequences in the ends tRNA 3 '.

The amino acid sequence speculated according to RT, RH and IN gene of the intermediate regions JRE has carried out network analysis, uses Clustal W softwares progress sequence alignment, JRE transposons and Patinopecten yessoensis (Mizuhopecten yessoensis) have 40.7% similitude.From phylogenetic tree as can be seen, jian carp JRE transposons and Patinopecten yessoensis, Chlamys farreri, Great Barrier Reef sea It is one that tender spot Xiphophorus helleri etc., which gathers,.

The structure of 2 retrotransposon transposon vector of embodiment

1 experimental method

Design of primers, synthesis and gene sequencing:According to In-Fusion technical principles, when cloning primer designs, in needle Each 15 alkali in the linearized both ends p-GCFU is introduced respectively to the outside of the upstream and downstream primer of Survivin gene orders Base keeps 15 bases on the outside of cloning primer and 15 base sequences at linearized vector both ends homologous, and middle and lower reaches are drawn Object removes three bases of termination codon.Synthesize 5 ' ACCGGACATATGCCCGGG of pair of primers GATACATCGCCCATCCCTACG3 ', 5 ' CCTGCAGGAATTCCCGGGGATACATCGCCCATCCC T ACG3 '.PCR reflects Determine primer to be designed according to S urvivin and carrier, wherein sense primer is located at Survivin, and downstream primer is located at carrier, And downstream primer is also used for the sequencing identification of follow-up positive colony.Primer synthesizes and gene sequencing is by the rich still biotechnology in Shanghai Co., Ltd completes.

Using the PCR product obtained in embodiment 1 as masterplate, digestion, 37 DEG C of 1h are carried out using BamH I restriction endonucleases.Digestion Product recycles after 1 % agarose gel electrophoresis, and method is the same, and is dissolved in 50 μ L sterilizing distilled waters.The digestion of acquisition The SEQ No 2 that segment is synthesized with by Shanghai Bo Shang biotech firms carry out 4 DEG C of connections overnight using T4 DNA ligases, and use DNA Purification Kit connection products.

The nucleotides sequence of Seq No 2 is classified as：

MCS AflII BlnI BsePI Eco52I EcoO65I HaeII HpaI

GATCC CTTAAG CCTAGG GGTNACC CGGCCG GGTNACC GTTAAC GCCGGC

NheI Not I PvuI

GCTAGC GCGGCCGC CGATCG G。

Plasmid DNA solution after connection product and digestion is swapped instead using In-Fusion PCR Cloning Kits It answers, reaction condition is room temperature 30min, prepares clone and exchanges liquid.200 μ L competent cell suspensions are taken to be transferred to sterile micro- It measures in centrifuge tube, adds 2 μ L to exchange liquid, gently rotate with mixing content, 30min is placed in ice;Pipe is put into pre- Pipe is quickly transferred to ice bath l-2 min after being warmed to 42 DEG C of heat shocks 90 seconds, often 800 μ l LB culture mediums are added in pipe;Then Pipe, which is transferred to shaken cultivation (250rpm) 45min on 37 DEG C of shaking tables, makes bacteria resuscitation;By several lists of the random pickings of 100 μ l Bacterium colony is placed in the LB culture mediums containing 100 μ g/mL ampicillins, and 37 DEG C of shaken cultivations stay overnight (16h) and use alkaline lysis Method extracts plasmid, and screening positive plasmid carries out sequencing identification.

2, result

Reverse transcription transposon gene DNA is successfully obtained by PCR reactions and using BamHI digestions and using T4 DNA Connection product after ligase connection.It is about 103 to obtain positive colony number after exchanging liquid conversion with 2 μ l, random picking 7 A clone carries out PCR identifications, and only one clone is false positive, the amplified fragments size of remaining clone and expection are in the same size For 4694bp, and negative control has no band through the detection of 1.5 % agarose electrophoresis.Any PCR Preliminary Identifications of random picking Positive colony is consistent with expection through cloning and sequencing result.

The application of 3 retrotransposon transposon vector of embodiment

1 experimental method

Choose green fluorescent protein（GFP）As reporter gene, pair of primers is designed, primer both ends contain AflII and NaeI Restriction enzyme site, using PCR amplification GFP reporter genes, pcr response procedures are：94 ℃ 30s 、60 ℃ 5min 、72 ℃ 45s, totally 30 recycle, and PCR products are detected through 1% agarose gel electrophoresis, recycle target fragment, and connection pMT18T is carried Body (Takara), sequence verification (calm and peaceful company of Sino-U.S.).PCR products and expression vector obtained by sequencing are after digestion through 1% fine jade Sepharose electrophoresis detection recycles.Then it uses T4 DNA enzymatics to connect, is connected with JRE transposon vectors, connection product is still adopted With IN-FUSION technology clonal expansions.The positive plasmid screened is served Hai Boshang companies and is sequenced, and sequencing result shows Through GFP genes are successfully inserted into polyclonal position（MCS）Point in.

The positive plasmid screened is transfected into jian carp liver cell：Containing 10% fetal calf serum, 100IU/mL penicillin, In 5% CO in the DMEM culture mediums of 100 μ g/mL streptomysins₂Cell incubator in cultivate jian carp liver cell.When cell covers When lid culture bottle bottom surface 70% or so, by transposons transfected hepatocytes, specific point 2 groups are transfected：1) JRE transposons 500ng With 2) blank control.The transfection of cell is carried out (reagent specification is shown in concrete operations) with LipofectamineTM2000.

Gene trap colony screening：JRE transposon vectors transfected hepatocytes for 24 hours after, after 0.25% trypsin digestion 10 cun of disks are transferred to, it is to be formed apparent by the resistance screening of G418 with the culture solution culture two weeks containing 1000 μ g/mL G418 It after clone, is carefully transferred with pipette tips into 96 orifice plates, presses 1: 2 passage afterwards, positive cell will be obtained and passed through through phenol/chloroform side Method extracts the genomic DNA of high-purity.Carry out the expression quantity of PCR amplification detection GFP genes.The result shows that GFP genes are successful It is transferred in jian carp hepatocytic genes group DNA.

<110>China Aquatic Science Research Academy Fresh Water Fishery Research Center

<120>The construction method and purposes of a kind of jian carp retrotransposon and transgene carrier

<130>

<160> 6

<170> PatentIn version 3.3

<210> 1

<211> 5941

<212> DNA

<213>Artificial sequence

<400> 1

atttgcggcc atacaggtat ttatgtaaaa ataagacctt aactatcatt aaaatgtctt 60

aaatccatgt ttcaaagtta ttatggaaat gtgagtgaaa tgacactgag ggtatttaat 120

tattacttta attggacttt atttttgctt tttggaatca taaaactgtg tttaactcag 180

agcgtgtgaa attgagactg aatttgtttt tacgctagta ggagccacat gtttagtaaa 240

gtcgctatag gactgtggtt attttaaatc atgtgaatgt ctcagtagag ctttgcaata 300

ggctttgaag gcgattcatc tgcgacaatg aacgcgatac tgcatagctt gtcagtgaac 360

tacggctctg tatattaaat gccgctccat ttgaaagcag gtgatggcga tttagcggta 420

atcagagaac cggctttact gacgaaatgc gcgtgacaat cacatccgat acatcgccca 480

tccctacgac aaacaatgtt gatctgccgt ggtacaagta cttgtggaga ttgaatcagt 540

gccacatctt cgcctgttcc gttgttgtct cctttttgta gttttaaata atgatttaat 600

gatttgatat ttatttgccg ccgtcacggc tataatgctt ctctgacgag ccgctttttc 660

ttttgctttt gccatggtct gcgggttaca caagcaacat ggccgaggac attgcagact 720

agcggtttgc atgtgtgctg cacatcgacg cggataacga cgcagcgtag gtctgacgca 780

gaaatataaa tcagcattta ctacccagac agcaatatag tgttggccca gatccggccc 840

gcatgaaatc aaaacaagac cgataccttg acacatataa cctgatctgt tgtatgttaa 900

gggtgatatt atgtttgtcc agtaggtggc ggtggcgcac tgggtgtgtg gctgtagcac 960

tgttaaaagc agagaagaac gctcagtgtg tgtgtgcttg cgctgggctt gctggctata 1020

gagatgagtc ccaacaaaga gagaccattc agaagtttcc gtgttctctg agttttccct 1080

ggtatctacg atacaacata tggcgacgag gatgaaagtc actgtggagc ggctgtttcc 1140

taagagcaaa taaaaagcag gacgtgggtg agctgatgaa agttaatagc taccacctga 1200

aagactgatt gagtagaacg atggctaaca tgctgggatc cgtgacgcca tttgataata 1260

aatcacaatc atgggaggag tatcgtgaaa tattgaacca ttttttcgtg gcaaatgatg 1320

ttgaagaacc agagaaaaaa agagccattt tgttgagctg tgtgggagct cagacatata 1380

cattaatgag gaatttattg agtcctggga gaccgggatc aaaaagttat gaggatctgg 1440

tgagtttgct gaaaaatcac tttaatccaa agcccagtga aatagttcaa aggtggaagt 1500

ttaattcacg taacagacac tttgatgaaa gtatagtcga atatgtggcc gaactgagga 1560

aattagctca agactgtaat tttggagata cacttacagt tatgctgaga gacagattag 1620

tgtgtggtgt taatgatgac agcatacaac ggagattatt ggctgaggag gaactgacat 1680

ttgagacagc gttaaggaaa gctcaggtga ttgaagttgc taataaggat atggttgatt 1740

tgcatagaga taaaggaaat cgaatgggta ccactgtttt caagatggac acaggagaaa 1800

aaaacaagtc gagtgttaca ggattgtgct atcgatgtgg tggaagtaac catgggccca 1860

aagattgtag atttgccaac gaaaagtgtt ataattgtgg taaaatggga catgtgaaaa 1920

gagtatatag aatgaaagca caagaaatgt gtgtggataa ggacaggaag ttttggaaat 1980

gggggagagg aaatcaatca aagaaggcaa attatcttca agaagaagaa gaagaggaag 2040

atcgggatga agatgttttc accatgtata gtatagaggc accacagccc catgtacccc 2100

ctattacaca gatattgctt gtaaatgaat accctgtgaa gtttgagatt gacactggat 2160

gtagcgtgac tgtcgtatca cagagggagt atggaaaaat ggaagctaag aagaacttgt 2220

ctgaactcaa aacaagcact ctcagtttaa aaacctacac cggacagtca gtgcccgttt 2280

taggtaccac caaagttaaa gtcaaacaca aagggcttac caaagaactc acagcagtgg 2340

ttgtggcagg atctgggcct aatttgtggg gacgatcatg gctcacagag ctagaactca 2400

gctgggaaaa agtgagtaaa cttaaagaca cctcagagtt gttgcaagat atcctaaggg 2460

aacatgaaac agttttcaaa gaggaacttg gaacactaaa aggagcttct gctaagattc 2520

atgtaccaag tgatgcaaag cctcattttt ttaaatcaag gtcactgcct tttgctatga 2580

gagagaaagt tgaagccgaa cttgagcgtc tgattaaaga tcatattata gagcctgtga 2640

aattttcaga gtggtcagca cctgttgtgc ctgttttaaa atcagatggg tcagtacaac 2700

tttgtggaga ttatagagta accattaatc gagagtcgtc actggagcag tatcccattc 2760

ctcgaatgga ggacatgttt gctgtcttag ctggagggga aaaatttagc aagttagata 2820

tgagtcatgc atatcaacag attctgttag ataagacgtc acagtcatat gtgaccgtaa 2880

atacacataa aagaattgtt cacgtacacc agattacctt ttggagttag ttccagtcca 2940

gcaattttcc agaggaccat ggaaggggtc ctgaaagata ttccaaaggt cactgtatat 3000

ctggacgata tcttgctgac aggacgagat gatcaagagc atttaaggac cctggatcaa 3060

gtgttgcagc ggttggagga ggctggtttg agattaaaaa grggcaartg yragttcatg 3120

gaaaaggaag taattttcct gggacacaaa gtagatgcca ctggtattca tccagttccc 3180

gaaaaagtcc aagcagttca aaatgcacca agaccaacgt ccgtaactga gctgaaagca 3240

tatttgggac tgttgaattt ctataacagg tttctgccaa acctctcgac actgcttgct 3300

ccattgcacc agctcttaaa gaaggaagtc ccctggtgtt ggaaagagga acaagaggaa 3360

gtttttaaaa aatccaaaga attactgcag tccaactggg tgttaatcca ctatgatgag 3420

agaaaagaat tagtgctttc ttgtgatgcc tcagcatacg gtgtgggagc cgtgttagca 3480

catcgtatgg cagatggaac agagcgaccc attggatttg tgtcacgaac acttacagta 3540

gccgaaaaaa attactcgca gctggagaag gagggtttag ctgtggtgtt cggggtcaag 3600

aaattccata aatacctgta tggccgcaaa tttgtaatct gtacagatca yaarcctcta 3660

ctgactttat tgaatgaact gaaagcggtg ccacagatgg tctctcaaag aattatgaga 3720

tgggcactga tgttgggggc atacgagtat gtcatttctt acagagcggg caaggacaat 3780

ggaaatgctg atgccctcag tcggctgcct gttcctgaga ctccggaaaa agaagcgaag 3840

gaggattatg tcttgatgtt tgacagcatt attagtcctt tgacgacatc agagcagatc 3900

aagcactgga caacccgcga tcttgtcctc tctagagtgc gtgagtatgt acttaaaggt 3960

tggcctgatc acagtaatat aaatgagttt gcacctgtgg ggagcccgca tcatcattcc 4020

agagcaagga cgtgcagggt tgctggaaca gctacatcaa tctcacccag gtatgtcaag 4080

gatgaaaggg ctggcccgta gttacttgtg gtggccaaag ttagatgctg atattgaggc 4140

gcgagtaaca aattgtactg tgtgtcaaga acagaggaaa gctcctgtgg gtgcaccact 4200

tcatctgtgg gaatggccac gacagccatg gagaagagtg catatggact atgctggtcc 4260

attcctgggg aagatgtttt taattttagt tgatgcccat tctaagtgga ttgaggcata 4320

tccartaaat tcagcaacaa cagcgactac tctggagtrc ctcagaaaga gtttcagtac 4380

ccatggcatt cctgaaatga tggtgtctga taatgctcag tgttttgtaa gtgaagcgag 4440

caaagaattt atgtctagga atggaataac ccatgttact tctgccccgt atcatccatc 4500

atccaatgkt cttgctgagc gggcagttca aacktttaag kacctcatga tgaagaatgt 4560

ycatgggaac actatggaga ccaggctgca tagagccttg ttcagttatc gcattacacc 4620

tcagtctacc acaggattgt cacctgccga aatgatgatg gggaggaaat tgcgatgcac 4680

cctagacaaa atacaccctg actttactag caaaattgaa ttgaaacaac aagttcaaaa 4740

agagcaacat gaccaacatg caaaatctcg ttattttgaa gtgggagata cggtgtacac 4800

taggaatttt ggatatggac caagatgggt gcagggagta attcaagata ttacaggacc 4860

ggtatcctat aaagtagcaa taggaagtgg ccaagtagta cgatgtcatg ttgatcaatt 4920

attcagtcga caacaacaag agatcttgac taaagacttt ccagctgcct ggggtgttca 4980

agcttatgat gctgaggttg tgtcaatgga tgctgatatt caaatgccag aatcactcag 5040

tacgtcgaca acacctgagg taattccaac tggggataac ggggagcctg agcattcgaa 5100

atctgcctgt caaagaaatc agttgccaga ttcacctaat gctcaaagaa tgcctgaatt 5160

gactcaaact gcagatagaa gggagcctga gagtgcaccc tcgggatgta tacgacgttc 5220

agtaagagag aggaaaccac cagcatatct taaagacttt gtgactaaag aaatagagta 5280

tgcagagaaa aaaaaaatgt cattgtataa attgtcctag aagattttgt gtcttgggaa 5340

aggatggcct ctgagttaag tggaggggaa atgttgtatg ttaagggcga tattatgttt 5400

gtccagtagg aggcggtggc gcactgggtg tgtggctgta gcactgttaa aagcagagaa 5460

gaacgctcag tgtgggtgtg cttgcgctgc gcttgctggc tatagagatg agtcccaata 5520

aagagagacc attcagaagt ttccgtgttc tctgagtttt ccctgctatc tacgatacaa 5580

caagattggt ttttccttgc ccatgttttg tgtggtgtcc aagctgcagt gtcttaccct 5640

ctgttctcct gttcaaggac ctgtagtaca gagatctggc accttgagtg gtccgcagtg 5700

tgctggccag ctctgggatc tctgttcacc tgagcaacat ttaattattg tttgttattt 5760

tgtgttttgt ggtgagaata aggattctcc tttcactact ctgcatctga gtcctctgtc 5820

tatcccgcac cctgacagaa tctactcacc actaaatgga ttcagcagag gaaacagttg 5880

cgctgagctc tcctgcagca gggctctctt ctgggtcgac acagatgaag tggtgcaccc 5940

a 5941

<210> 2

<211> 70

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (21)..(21)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (34)..(34)

<223> n is a, c, g, or t

<400> 2

gatcccttaa gcctaggggt nacccggccg ggtnaccgtt aacgccggcg ctagcgcggc 60

cgccgatcgg 70

<210> 3

<211> 21

<212> DNA

<213>Artificial sequence

<400> 3

gatacatcgc ccatccctac g 21

<210> 4

<211> 21

<212> DNA

<213>Artificial sequence

<400> 4

gatacatcgc ccatccctac g 21

<210> 5

<211> 39

<212> DNA

<213>Artificial sequence

<400> 5

accggacata tgcccgggga tacatcgccc atccctacg 39

<210> 6

<211> 39

<212> DNA

<213>Artificial sequence

<400> 6

cctgcaggaa ttcccgggga tacatcgccc atccctacg 39

Claims (7)

1. a kind of jian carp retrotransposon, which is characterized in that the nucleotide sequence of the transposons such as SEQ ID NO.1 institutes Show.

2. a kind of nucleotide sequence of engineer's synthesis, which is characterized in that the nucleotide sequence such as SEQ ID NO.2 institutes Show.

3. a kind of genophore, which is characterized in that the genophore includes that the jian carp reverse transcription described in claim 1 turns Nucleotide sequence described in stand and claim 2.

4. according to the genophore described in claim 3, which is characterized in that the genophore is turned with jian carp reverse transcription Stand is underlying carrier, and the nucleotides sequence as shown in SEQ ID NO.2 is inserted into 1237 sites in jian carp retrotransposon Row.

5. a kind of gene transfer system, which is characterized in that the gene transfer system includes：

a）Nucleotide sequence jian carp retrotransposon as shown in SEQ ID NO.1 described in claim 1,

b）Nucleotide sequence SEQ ID NO.2 described in claim 2.

6. the jian carp retrotransposon described in claim 1 imports the application in cell in mediated dna.

7. the gene transfer system described in genophore and claim 5 described in claim 3 or 4 is imported in mediated dna Application in cell.