CN104928321A - Crispr/Cas9-induced scale-missing zebra fish mode and establishment method - Google Patents
Crispr/Cas9-induced scale-missing zebra fish mode and establishment method Download PDFInfo
- Publication number
- CN104928321A CN104928321A CN201510071972.4A CN201510071972A CN104928321A CN 104928321 A CN104928321 A CN 104928321A CN 201510071972 A CN201510071972 A CN 201510071972A CN 104928321 A CN104928321 A CN 104928321A
- Authority
- CN
- China
- Prior art keywords
- eda
- scale
- zebra fish
- cas9
- sgrna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a Crispr/Cas9-induced scale-missing zebra fish mode. The mode is scale-missing zebra fish containing EDA gene exon 4-locus base insertion. Meanwhile, the invention also discloses an establishment method and the application of the Crispr/Cas9-induced scale-missing zebra fish mode. The established scale-missing zebra fish mode has a great application value in functional research of related genes of appendages of the skin, screening of medicines for treating ectoderm dysplasia such as human baldness, and the like.
Description
Technical field
The present invention relates to gene engineering technology field, particularly relate to a kind of scale loss zebra fish pattern of being induced by Crispr/Cas9 and establishment method.
Background technology
The mankind and mammiferous hair, tooth, nail, sweat gland, the feather of birds, the scale, hypopharynx tooth, antenna etc. of fish all belong to the appendages of skin, and the growth of the appendages of skin is for most important the mankind, and appendages of skin dysplasia patient has Familial Occurrence, also find that there is this type of phenomenon mouse, fish etc. at present, confirmed by genetics research, the growth of the appendages of skin regulates and controls primarily of EDA family gene.
Eda (Eetodysplasin) and acceptor Edar and TNF is associated, belong to TNF superfamily member, EDA signal is regulated by Eetodysplasin, EDAR, EDARADD, in the vertebrates appendages of skin regulation and control of fish to the mankind, define a tnf ligand-acceptor-fit family.EDA signal path finds in the ectodermal dysplasia syndromes of the mankind first.Lossless or hypohidrosis type is ectodermal dysplasia, and (EDA) is a kind of symptom the most general in ectodermal dysplasia colony, and the form of two or more appendages of skin of major effect occurs.
EDA major effect hair, tooth and concentrated exocrine gland comprise sweat gland, tarsal gland and preputial glands.As a kind of genetic disease, EDA occurs with forms such as X-linked recessive, autosomal dominant and recessiveness.Within 1875, Darwin describes X-linkage first in his book " The variations of animals and plants under domestication ", have recorded phenotype and the distinctive hereditary pattern of the male sex of influenced Indian family appendages of skin in detail.In patient, found three kinds of various forms of variations of gene after more than 100 year, wherein X-is chain
eDAtransgenation accounts for more than 90% in the case, and all the other cases mainly
eDARwith
eDARADDthe autosomal dominant inheritance that genetic comparison is rare.A large amount of results proves
eDA,
eDARwith
eDARADDgenes encoding participates in tnf ligand-acceptor-fit family that the appendages of skin are grown.Eetodysplasin be one chain by X sex chromosome
eDAtwo type transmembrane proteins of genes encoding, it comprises a short collagenous portion (collagen) and a TNF territory in extracellular space.There iing furin (furin) site close to collagen district, producing the EDA part of solubility, then form activated ligand trimer.Have been found that the deletion mutantion in TNF, collagen, furin cutting and cross-film site generation missense or reading frame at present, EDA syndromes can be caused.TNF is the functional domain of Eetodysplasin, but some the sudden change displays found in patient, collagen district also plays a very important role, this region comprises 19 G-X-Y and repeats, although 2 G-X-Y repetitions in reading frame or the disappearance of 4 G-X-Y repetitions do not affect the function in TNF territory, EDA syndromes can be caused equally.Comparative genomics and genetics research finder, mouse, fish, Africa xenopus, chicken, ox, chimpanzee etc.
eDA, EDAR, EDARADD genehigh conservative during evolution.
The similar spontaneous mutation animal model of current discovery has
eDARthe medaka suddenlyd change,
eDAthe dog of sudden change and ox, Tabby, Downless/Sleek and Crinkled mouse mutant.People's
eDAtransgenation is consistent with the phenotype of the tabby mouse of spontaneous mutation, shows as the decline of hair follicle quantity or the defect of disappearance and sweat duct and tooth development.The appendages of skin show as species specificity, and relative to mammiferous hair, sweat gland, fish are hone lamella, scale etc. mainly.Colosimo etc. (2005) study discovery, and in the transition of three-spined stickleback from ocean to fresh water, EDA also participates in the adaptive evolution of hone lamella pattern.The EDA-A1 of mouse can make fresh water three-spined stickleback hone lamella recover, with the consistent pattern of ocean three-spined stickleback, to point out further
eDAgene is for the adaptability (plasticity-) of appendages of skin parallelism.
Summary of the invention
Technical problem to be solved by this invention is to provide a kind of scale loss zebra fish pattern of being induced by Crispr/Cas9.
Another technical problem to be solved by this invention is to provide the establishment method of this scale loss zebra fish pattern.
For solving the problem, a kind of scale loss zebra fish pattern of being induced by Crispr/Cas9 of the present invention, is characterized in that: this pattern refers to the scale loss zebra fish comprising EDA gene extron 4 site base and insert.
An establishment method for the scale loss zebra fish pattern of being induced by Crispr/Cas9 as above, comprises the following steps:
(1) utilize Ensemble online database, search zebra fish EDA gene order no:ENSDARG00000074591 and download, PAM sequence i.e. 5 '-GGNNNNNNNNNNNNNNNNNNNGG-3 ' is searched in this sequence, the targeting sequence found at EDA gene extron is TTAGGCAAGAAAGGGCCCCC[TGG], and design and design abrupt climatic change primers F-eda:ttgttttgcttctcatcagttg and abrupt climatic change primer R-eda:tttgctctgctgcttcactc;
(2) the sequence verification of the wild-type allele of target sequence:
Random selecting 5 pieces of 24hpf wild-type zebrafish embryos, extract genomic DNA template, then pcr amplification is carried out with F-eda and R-eda, obtain the pcr amplification product I that fragment length is 358bp, this pcr amplification product I is with described abrupt climatic change primers F-eda direct Sequencing, consistent with the sequence in database to show target gene group sequence, overlapping without SNP application;
(3) build sgRNA:
(4) set up eda-sgRNA template:
Obtain the template of the in-vitro transcription of sgRNA with PCR method, this template sequence is as follows:
tAATACGACT CACTATA gTT AGGCAAGAAA GGGCCCCCgt tttagagcta gaaatagcaa gttaaaataa ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg gtgctttttt t;
(5) sgRNA in-vitro transcription:
With described pcr amplification product I for template, carry out sgRNA in-vitro transcription by T7 RNA polymerase, obtain sgRNA; Described sgRNA makes its concentration be 1000ng/ul after dehydrated alcohol method precipitation;
(6) Cas9 mRNA in-vitro transcription:
Be template with the humanized Cas9 encoding sequence (Mali et al., 2013. Science, 339 (6121): 823-6) that U7 drives, carry out Cas9 in-vitro transcription by U7 RNA polymerase, then to attach the names of pre-determined candidates and tailing, obtain Cas9 mRNA; Described Cas9 mRNA makes its concentration be 600ng/ul after dehydrated alcohol method precipitation;
(7) the microinjection of zebra fish zygote and abrupt climatic change:
After described sgRNA and described Cas9 mRNA balanced mix, the micro-wild-type zebrafish zygote being injected into 1 ~ 2 cell stage, when fetal development to 24 hpf, get 5 pieces of embryos, prepare genomic DNA template, then carry out pcr amplification with described abrupt climatic change primers F-eda and described abrupt climatic change primer R-eda, obtain pcr amplification product II; Described pcr amplification product II is subcloned in pEASY-T3 carrier; And with T7 and Sp6 universal primer, transformant is increased, by PCR primer ten group totally two groups directly send order-checking, sequencing primer is T7 or Sp6 wherein;
(8) mutant scale Observation On The Development and dyeing qualification:
The scale developmental state of the zebra fish of EDA transgenation is had to carry out microscopic examination to detection, screening obtains EDA gene extron 4 target site introducing insertion mutation and causes scale loss mutant, scale dyeing qualification is carried out, to determine whether scale has developmental defect to scale heteroplasia individuality.
An application for the scale loss zebra fish pattern of being induced by Crisper/Cas9 as above, is characterized in that: this checking of scale loss zebra fish model application in appendages of skin genes involved function and screening of ectodermal dysplasia medicine.
The present invention compared with prior art has the following advantages:
1, the present invention is directed to zebra fish EDA gene (containing 8 exons), design targeting is shown in Fig. 1 in the EDA-sgRNA(in exon 4 site), by building EDA-sgRNA and Cas9 mRNA carrier, inject zygote after reverse transcription, the insertion mutation (see figure 2) in exon 4 site primer 12 bases detected through pcr amplification and sequence verification.
2, the present invention carries out the observation of scale developmental state and dyeing qualification to the individuality of EDA gene insertion mutation and wild-type individuality, find that this mutant there is no that scale is grown, and the individual scale of wild-type covers whole body (see figure 3).
3, the scale loss zebra fish pattern set up of the present invention has very large using value in ectodermal dysplasia medicines such as the functional study of appendages of skin genes involved, screening treatment human hair be rare etc.
Accompanying drawing explanation
Below in conjunction with accompanying drawing, the specific embodiment of the present invention is described in further detail.
Fig. 1 is zebra fish EDA gene of the present invention and Crispr/Cas9 target site.Zebra fish EDA gene has 8 exons, has screened the Crispr target site in exon 4 site by Photographing On-line.
Fig. 2 is the zebra fish that Crispr/Cas9 of the present invention induces
eDAdetection in Gene Mutation.Genome is extracted to the F1 individuality set up, utilizes abrupt climatic change primers F-eda and R-eda to increase, and direct Sequencing is carried out to PCR primer, detect and whether have sudden change to introduce (A and B); In addition the concrete mutation type of TA clone identification (C and D) is carried out to the PCR primer having sudden change to introduce.Wherein:
A figure is that wild-type zebrafish EDA gene comprises target site region PCR product sequencing result, is target site in frame;
B figure is that the bimodal saltant type zebra fish detected result indicating insertion or deletion mutantion appears in PCR primer;
C figure is that B figure detects individual PCR primer T-A cloning and sequencing result, compares have base to insert with wild-type;
D target site sequence compares, the individual target site sequence (WT) of wild-type sequence (MT+15bp) individual with the saltant type having 15 bases to insert.
Fig. 3 is the individual Alizarin red staining of zebra fish of the present invention.Carry out scale dyeing qualification scale developmental state to the zebra fish wild-type of EDA process and saltant type individuality, wherein A is mutant zebra fish, and scale lacks substantially; B is wild-type zebrafish, and whole body covers scale.
Embodiment
embodiment 1a scale loss zebra fish pattern of being induced by Crispr/Cas9, this pattern refers to the scale loss zebra fish comprising EDA gene extron 4 site base and insert.
The establishment method of this scale loss zebra fish pattern, comprises the following steps:
(1) utilize Ensemble online database, search zebra fish EDA gene order no:ENSDARG00000074591 and download, PAM(protospacer-adjacent motif is searched in this sequence) sequence i.e. 5 '-GGNNNNNNNNNNNNNNNNNNNGG-3 ', the targeting sequence found at EDA gene extron is TTAGGCAAGAAAGGGCCCCC[TGG], and design and design abrupt climatic change primers F-eda:ttgttttgcttctcatcagttg and abrupt climatic change primer R-eda:tttgctctgctgcttcactc.
(2) the sequence verification of the wild-type allele of target sequence:
Random selecting 5 pieces of 24hpf wild-type zebrafish embryos, extract genomic DNA template, then pcr amplification is carried out with F-eda and R-eda, obtain the pcr amplification product I that fragment length is 358bp, this pcr amplification product I is with abrupt climatic change primers F-eda direct Sequencing, check order respond well, color atlas readability is good.Result shows that target gene group sequence is consistent with the sequence in database, overlapping without SNP application.
(3) build sgRNA:
1. carrier and Insert Fragment process:
SgRNA carrier construction is used
bbsl enzyme is cut pT7-gRNA, is cut glue recovery, obtains sgRNA and clones skeleton pT7-gRNA_
bbsIoiE site is as Insert Fragment, and this Insert Fragment does following process: use ddH
2the Oligo of target site is dissolved as 10 μMs by O, respectively gets 5 μ L equal-volume mixings, anneals: 95 DEG C of 5min by following program ,-1 DEG C/30sec/cycle, to 4 DEG C.
2. linked system:
Get target site Oligo and sgRNA after annealing and clone skeleton pT7-gRNA_
bbsthe each luL of I runs glue, carries out quantitatively, be connected by the target site Oligo after annealing with gRNA carrier Insert Fragment and carrier.Because Insert Fragment is smaller, final determine linked system and be: Oligo l μ L, pT7-gRNA_
bbsi l μ L, 5 × T4 ligase buffer 2 μ L, T4 ligase l μ L, totally 10 μ L systems, 25 DEG C connect 3 ~ 4h.Get 5 μ L, be transformed in Trans-Tl competent cell.
3. bacterium colony PCR verifies:
Picking 5 ~ 10 mono-clonals are in l0 μ L LB liquid nutrient medium, get l μ L and carry out pcr amplification as template, primer is that carrier universal primer RV-M and target site specific mutagenesis detect primer R-eda, increases by EsayTaq DNA Polymerase, l0 μ L system.Object band is about 130bp.Picking positive colony send order-checking, chooses the correct clone of sequence and carries out glycerine guarantor bacterium, extract plasmid.
(4) set up eda-sgRNA template:
Obtain the template of the in-vitro transcription of sgRNA with PCR method, this template sequence is as follows:
tAATACGACT CACTATA gTT AGGCAAGAAA GGGCCCCCgt tttagagcta gaaatagcaa gttaaaataa ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg gtgctttttt t.
Wherein: italicized capitals part is T7 promotor part, and underscore part is gRNA template, and lowercase is sgRNA skeleton.
(5) sgRNA in-vitro transcription:
With pcr amplification product I for template, carry out sgRNA in-vitro transcription by T7 RNA polymerase, obtain sgRNA; SgRNA makes its concentration be 1000ng/ul after dehydrated alcohol method precipitation.
Wherein: in-vitro transcription system refers to 5 × Transcription Buffer l0 μ L; L00Mm DTT 5 μ L; NTP mix (lOmM each) l0 μ L; Template (>l μ g) 20 μ L; T7 RNA polysaccharase 2 μ L; RNase Inhibitor (40U) l μ L DEPC water supplies system to 50 μ L, 37 DEG C of reaction 2h,
The agarose gel electrophoresis getting 2 μ L, 1 % detects transcription effects.
(6) Cas9 mRNA in-vitro transcription:
Be template with the humanized Cas9 encoding sequence (Mali et al., 2013. Science, 339 (6121): 823-6) that U7 drives, carry out Cas9 in-vitro transcription by U7 RNA polymerase, then to attach the names of pre-determined candidates and tailing, obtain Cas9 mRNA; Cas9 mRNA makes its concentration be 600ng/ul after dehydrated alcohol method precipitation.
Wherein: in-vitro transcription system refers to 5 × Tanscription Buffer l0 μ L, l00mMDTT 5 μ L, NTPmix (each l0mM of ATP/CTP/UTP, GTP:ImM): l0 μ L SP6 RNA Polymerase (SOU) 2 μ L, Rnase Inhibitor (SOU) l μ L, Template 17 μ L, CAP (lOmM) 5 μ L.37 DEG C, water-bath 1.5h.
Get l μ L and carry out 1% sepharose detection mRNA synthetic effect.
1. Cas9 mRNA template is digested: add DNasel 2 μ L, 37 DEG C of digestion 15min.
2. phenol chloroform and LiCl precipitation:
With DEPC water, Cas9 mRNA in-vitro transcription system is supplied to 100 μ L, add phenol: chloroform: primary isoamyl alcohol (25:24:1) 100 μ L, misfortune revolves 15s mixing, centrifugal 30 seconds of 12000rpm, draw in supernatant to new centrifuge tube, add chloroform: primary isoamyl alcohol (24:1) 100 μ L, misfortune revolves the mixed hook of 15s, centrifugal 30 seconds of 12000rpm, again supernatant is moved in new centrifuge tube, add 3 MNaAc (pH4.0) of 1/10 volume and the dehydrated alcohol of 2 times of volume precoolings, turn upside down ,-80 DEG C of standing 5min.The centrifugal 15min of 12000rpm, remove supernatant, thieving paper blots, add 400 μ L Ua, put upside down mixing, the centrifugal 15min of 12000rpm, draw supernatant, add 700 μ L 70%DEPC ethanol, the centrifugal 15min of 12000rpm, carefully outwell supernatant, add 700 μ L 70%DEPC ethanol again, recentrifuge 12000rpm15min, remove supernatant, room temperature leaves standstill 3 ~ 5 minutes and is thoroughly dissolved in l0 μ L Rnase Free water after volatilization ethanol, get 0.5 μ L for 1% agarose gel electrophoresis detect gRNA concentration.
(7) the microinjection of zebra fish zygote and abrupt climatic change:
After sgRNA and Cas9 mRNA balanced mix, the micro-wild-type zebrafish zygote being injected into 1 ~ 2 cell stage, puts into 28 DEG C of thermostat containers by the zebrafish embryo after injection and cultivates.General 1 μ L can inject 300 ovum.
When fetal development to 24 hpf, get 5 pieces of embryos, prepare genomic DNA template, then carry out pcr amplification with abrupt climatic change primers F-eda and abrupt climatic change primer R-eda, obtain pcr amplification product II; Described pcr amplification product II is subcloned in pEASY-T3 carrier.And with T7 and Sp6 universal primer, transformant is increased, by PCR primer ten group totally two groups directly send order-checking, sequencing primer is T7 or Sp6 wherein.
It is pEASY-T3 carrier that TA clones used carrier.Concrete steps:
In the EP pipe of 0.2mL, add following reaction solution second take turns PCR product 2 μ L, T4 DNA ligase 1 μ L, 10 × T4 DNA ligation buffer 1 μ L, pGM-T vector 1 μ L, ddH
2o 6 μ L, 16 DEG C of connections are spent the night, and within second day, turn in Trans-Tl competent cell.The single bacterium colony T7 of random picking 10 whites and SP6 universal primer carry out bacterium colony PCR, and expection size fragment is 350bp, is sent by positive colony sky one brightness far to check order.
(8) mutant scale Observation On The Development and dyeing qualification:
The scale developmental state of the zebra fish of EDA transgenation is had to carry out microscopic examination to detection, screening obtains EDA gene extron 4 target site introducing insertion mutation and causes scale loss mutant, scale dyeing qualification is carried out, to determine whether scale has developmental defect to scale heteroplasia individuality.
Concrete steps are as follows: be fixed 24h with 4% formalin solution, and 70% ethanol dehydration 5h, then carries out dyeing 24h in the alizarin red aqueous solution of 1g/L, after 1%KOH+5% glycerine carries out decolouring 48h, utilize ZESIS Discovery V13 microscope to carry out imaging.
embodiment 2this scale loss zebra fish pattern be applied to the checking of appendages of skin genes involved function and the screening of ectodermal dysplasia medicine.
PAM sequence
5’-GGNNNNNNNNNNNNNNNNNNNGG-3’
Targeting sequence
TTAGGCAAGAAAGGGCCCCC【TGG】
Abrupt climatic change primers F-eda
ttgttttgcttctcatcagttg
Abrupt climatic change primer R-eda
tttgctctgctgcttcactc
Template sequence
TAATACGACT CACTATAGTT AGGCAAGAAA GGGCCCCCgt tttagagcta gaaatagcaa gttaaaataa ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg gtgctttttt t
Claims (3)
1. a scale loss zebra fish pattern of being induced by Crispr/Cas9, is characterized in that: this pattern refers to the scale loss zebra fish comprising EDA gene extron 4 site base and insert.
2. the establishment method of a kind of scale loss zebra fish pattern of being induced by Crispr/Cas9 as claimed in claim 1, comprises the following steps:
(1) utilize Ensemble online database, search zebra fish EDA gene order no:ENSDARG00000074591 and download, PAM sequence i.e. 5 '-GGNNNNNNNNNNNNNNNNNNNGG-3 ' is searched in this sequence, the targeting sequence found at EDA gene extron is TTAGGCAAGAAAGGGCCCCC[TGG], and design abrupt climatic change primers F-eda:ttgttttgcttctcatcagttg and abrupt climatic change primer R-eda:tttgctctgctgcttcactc;
(2) the sequence verification of the wild-type allele of target sequence:
Random selecting 5 pieces of 24hpf wild-type zebrafish embryos, extract genomic DNA template, then pcr amplification is carried out with F-eda and R-eda, obtain the pcr amplification product I that fragment length is 358bp, this pcr amplification product I is with described abrupt climatic change primers F-eda direct Sequencing, consistent with the sequence in database to show target gene group sequence, overlapping without SNP application;
(3) build sgRNA:
(4) set up eda-sgRNA template:
Obtain the template of the in-vitro transcription of sgRNA with PCR method, this template sequence is as follows:
tAATACGACT CACTATA gTT AGGCAAGAAA GGGCCCCCgt tttagagcta gaaatagcaa gttaaaataa ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg gtgctttttt t;
(5) sgRNA in-vitro transcription:
With described pcr amplification product I for template, carry out sgRNA in-vitro transcription by T7 RNA polymerase, obtain sgRNA; Described sgRNA makes its concentration be 1000ng/ul after dehydrated alcohol method precipitation;
(6) Cas9 mRNA in-vitro transcription:
The humanized Cas9 encoding sequence driven with U7, for template, carries out Cas9 in-vitro transcription by U7 RNA polymerase, then attaches the names of pre-determined candidates and tailing, obtains Cas9 mRNA; Described Cas9 mRNA makes its concentration be 600ng/ul after dehydrated alcohol method precipitation;
(7) the microinjection of zebra fish zygote and abrupt climatic change:
After described sgRNA and described Cas9 mRNA balanced mix, the micro-wild-type zebrafish zygote being injected into 1 ~ 2 cell stage, when fetal development to 24 hpf, get 5 pieces of embryos, prepare genomic DNA template, then carry out pcr amplification with described abrupt climatic change primers F-eda and described abrupt climatic change primer R-eda, obtain pcr amplification product II; Described pcr amplification product II is subcloned in pEASY-T3 carrier; And with T7 and Sp6 universal primer, transformant is increased, by PCR primer ten group totally two groups directly send order-checking, sequencing primer is T7 or Sp6 wherein;
(8) mutant scale Observation On The Development and dyeing qualification:
The scale developmental state of the zebra fish of EDA transgenation is had to carry out microscopic examination to detection, screening obtains EDA gene extron 4 target site introducing insertion mutation and causes scale loss mutant, scale dyeing qualification is carried out, to determine whether scale has developmental defect to scale heteroplasia individuality.
3. the application of a kind of scale loss zebra fish pattern of being induced by Crispr/Cas9 as claimed in claim 1, is characterized in that: this checking of scale loss zebra fish model application in appendages of skin genes involved function and screening of ectodermal dysplasia medicine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510071972.4A CN104928321B (en) | 2015-02-12 | 2015-02-12 | A kind of scale loss zebra fish pattern and method for building up by Crispr/Cas9 inductions |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510071972.4A CN104928321B (en) | 2015-02-12 | 2015-02-12 | A kind of scale loss zebra fish pattern and method for building up by Crispr/Cas9 inductions |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104928321A true CN104928321A (en) | 2015-09-23 |
| CN104928321B CN104928321B (en) | 2018-06-01 |
Family
ID=54115748
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510071972.4A Expired - Fee Related CN104928321B (en) | 2015-02-12 | 2015-02-12 | A kind of scale loss zebra fish pattern and method for building up by Crispr/Cas9 inductions |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104928321B (en) |
Cited By (33)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9340799B2 (en) | 2013-09-06 | 2016-05-17 | President And Fellows Of Harvard College | MRNA-sensing switchable gRNAs |
| CN105594664A (en) * | 2016-02-16 | 2016-05-25 | 湖南师范大学 | Statla gene deletion type zebra fish |
| US9388430B2 (en) | 2013-09-06 | 2016-07-12 | President And Fellows Of Harvard College | Cas9-recombinase fusion proteins and uses thereof |
| US9526784B2 (en) | 2013-09-06 | 2016-12-27 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| CN106978445A (en) * | 2017-06-12 | 2017-07-25 | 内蒙古大学 | The method of the goat EDAR gene knockouts of CRISPER Cas9 System-mediateds |
| CN107217075A (en) * | 2017-06-28 | 2017-09-29 | 西安交通大学医学院第附属医院 | A kind of method and primer, plasmid and preparation method of structure EPO gene knockout zebra fish animal models |
| US9834791B2 (en) | 2013-11-07 | 2017-12-05 | Editas Medicine, Inc. | CRISPR-related methods and compositions with governing gRNAS |
| US9840699B2 (en) | 2013-12-12 | 2017-12-12 | President And Fellows Of Harvard College | Methods for nucleic acid editing |
| US10077453B2 (en) | 2014-07-30 | 2018-09-18 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| CN108707628A (en) * | 2018-05-28 | 2018-10-26 | 上海海洋大学 | The preparation method of zebra fish notch2 gene mutation bodies |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| CN109207523A (en) * | 2017-06-29 | 2019-01-15 | 南京尧顺禹生物科技有限公司 | The foundation and application of human obesity's zebra fish model based on UCP1 gene |
| US10227581B2 (en) | 2013-08-22 | 2019-03-12 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| CN109880827A (en) * | 2019-03-26 | 2019-06-14 | 杭州师范大学附属医院(杭州市第二人民医院) | The method for building up of hepatolenticular degeneration zebra fish model |
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| CN113416787A (en) * | 2021-07-08 | 2021-09-21 | 中国科学院西北高原生物研究所 | Method for detecting mutation of Acsl1a gene of zebra fish |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| CN115521899A (en) * | 2022-05-06 | 2022-12-27 | 西南大学 | An efficient Japanese green culture cell CRISPR/Cas9 genome editing method and application thereof |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| US11999947B2 (en) | 2023-02-24 | 2024-06-04 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103388006A (en) * | 2013-07-26 | 2013-11-13 | 华东师范大学 | Method for constructing gene site-directed mutation |
| CN104195177A (en) * | 2014-08-05 | 2014-12-10 | 南京大学 | Method for remarkably improving fish genome editing efficiency |
-
2015
- 2015-02-12 CN CN201510071972.4A patent/CN104928321B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103388006A (en) * | 2013-07-26 | 2013-11-13 | 华东师范大学 | Method for constructing gene site-directed mutation |
| CN104195177A (en) * | 2014-08-05 | 2014-12-10 | 南京大学 | Method for remarkably improving fish genome editing efficiency |
Non-Patent Citations (2)
| Title |
|---|
| MATTHEW P.HARRIS ET AL.: "Zebrafish eda and edar Mutants Reveal Conserved and Ancestral Roles of Ectodysplasin Signaling in Vertebrates", 《PLOS GENETICS》 * |
| NM_001115065.1: "Danio rerio ectodysplasin A (eda), mRNA", 《GENBANK》 * |
Cited By (63)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US10954548B2 (en) | 2013-08-09 | 2021-03-23 | President And Fellows Of Harvard College | Nuclease profiling system |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US11920181B2 (en) | 2013-08-09 | 2024-03-05 | President And Fellows Of Harvard College | Nuclease profiling system |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US10227581B2 (en) | 2013-08-22 | 2019-03-12 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US9526784B2 (en) | 2013-09-06 | 2016-12-27 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US10912833B2 (en) | 2013-09-06 | 2021-02-09 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US9737604B2 (en) | 2013-09-06 | 2017-08-22 | President And Fellows Of Harvard College | Use of cationic lipids to deliver CAS9 |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US9999671B2 (en) | 2013-09-06 | 2018-06-19 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US9388430B2 (en) | 2013-09-06 | 2016-07-12 | President And Fellows Of Harvard College | Cas9-recombinase fusion proteins and uses thereof |
| US9340799B2 (en) | 2013-09-06 | 2016-05-17 | President And Fellows Of Harvard College | MRNA-sensing switchable gRNAs |
| US9340800B2 (en) | 2013-09-06 | 2016-05-17 | President And Fellows Of Harvard College | Extended DNA-sensing GRNAS |
| US11299755B2 (en) | 2013-09-06 | 2022-04-12 | President And Fellows Of Harvard College | Switchable CAS9 nucleases and uses thereof |
| US9834791B2 (en) | 2013-11-07 | 2017-12-05 | Editas Medicine, Inc. | CRISPR-related methods and compositions with governing gRNAS |
| US10190137B2 (en) | 2013-11-07 | 2019-01-29 | Editas Medicine, Inc. | CRISPR-related methods and compositions with governing gRNAS |
| US10640788B2 (en) | 2013-11-07 | 2020-05-05 | Editas Medicine, Inc. | CRISPR-related methods and compositions with governing gRNAs |
| US11390887B2 (en) | 2013-11-07 | 2022-07-19 | Editas Medicine, Inc. | CRISPR-related methods and compositions with governing gRNAS |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US11124782B2 (en) | 2013-12-12 | 2021-09-21 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US9840699B2 (en) | 2013-12-12 | 2017-12-12 | President And Fellows Of Harvard College | Methods for nucleic acid editing |
| US11053481B2 (en) | 2013-12-12 | 2021-07-06 | President And Fellows Of Harvard College | Fusions of Cas9 domains and nucleic acid-editing domains |
| US10077453B2 (en) | 2014-07-30 | 2018-09-18 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US11578343B2 (en) | 2014-07-30 | 2023-02-14 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| CN105594664B (en) * | 2016-02-16 | 2018-10-02 | 湖南师范大学 | A kind of method of gene knockout selection and breeding stat1a Gene Deletion zebra fish |
| CN105594664A (en) * | 2016-02-16 | 2016-05-25 | 湖南师范大学 | Statla gene deletion type zebra fish |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11702651B2 (en) | 2016-08-03 | 2023-07-18 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US11820969B2 (en) | 2016-12-23 | 2023-11-21 | President And Fellows Of Harvard College | Editing of CCR2 receptor gene to protect against HIV infection |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| CN106978445A (en) * | 2017-06-12 | 2017-07-25 | 内蒙古大学 | The method of the goat EDAR gene knockouts of CRISPER Cas9 System-mediateds |
| CN107217075B (en) * | 2017-06-28 | 2021-07-02 | 西安交通大学医学院第一附属医院 | Method for constructing EPO gene knockout zebra fish animal model, primer, plasmid and preparation method |
| CN107217075A (en) * | 2017-06-28 | 2017-09-29 | 西安交通大学医学院第附属医院 | A kind of method and primer, plasmid and preparation method of structure EPO gene knockout zebra fish animal models |
| CN109207523A (en) * | 2017-06-29 | 2019-01-15 | 南京尧顺禹生物科技有限公司 | The foundation and application of human obesity's zebra fish model based on UCP1 gene |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11932884B2 (en) | 2017-08-30 | 2024-03-19 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| CN108707628A (en) * | 2018-05-28 | 2018-10-26 | 上海海洋大学 | The preparation method of zebra fish notch2 gene mutation bodies |
| CN108707628B (en) * | 2018-05-28 | 2021-11-23 | 上海海洋大学 | Preparation method of zebra fish notch2 gene mutant |
| US11643652B2 (en) | 2019-03-19 | 2023-05-09 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11795452B2 (en) | 2019-03-19 | 2023-10-24 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| CN109880827A (en) * | 2019-03-26 | 2019-06-14 | 杭州师范大学附属医院(杭州市第二人民医院) | The method for building up of hepatolenticular degeneration zebra fish model |
| US12006520B2 (en) | 2019-06-14 | 2024-06-11 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| CN113416787A (en) * | 2021-07-08 | 2021-09-21 | 中国科学院西北高原生物研究所 | Method for detecting mutation of Acsl1a gene of zebra fish |
| CN115521899A (en) * | 2022-05-06 | 2022-12-27 | 西南大学 | An efficient Japanese green culture cell CRISPR/Cas9 genome editing method and application thereof |
| US11999947B2 (en) | 2023-02-24 | 2024-06-04 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104928321B (en) | 2018-06-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104928321A (en) | Crispr/Cas9-induced scale-missing zebra fish mode and establishment method | |
| Thompson et al. | A novel enhancer near the Pitx1 gene influences development and evolution of pelvic appendages in vertebrates | |
| BR112019025717A2 (en) | method to produce eukaryotic cell from edited dna and kit used in the same | |
| Blanco et al. | Roles of C/EBP class bZip proteins in the growth and cell competition of Rp (‘Minute’) mutants in Drosophila | |
| Yang et al. | Identification of a germ cell marker gene, the dead end homologue, in Chinese sturgeon Acipenser sinensis | |
| Lacin et al. | Genome-wide identification of Drosophila Hb9 targets reveals a pivotal role in directing the transcriptome within eight neuronal lineages, including activation of nitric oxide synthase and Fd59a/Fox-D | |
| Awazu et al. | An enhancer trap in the ascidian Ciona intestinalis identifies enhancers of its Musashi orthologous gene | |
| Mohanta et al. | Molecular cloning, characterization and functional assessment of the myosin light polypeptide chain 2 (mylz2) promoter of farmed carp, Labeo rohita | |
| CN109207524A (en) | The foundation and application of human obesity's zebra fish model based on FTO gene | |
| Chen et al. | Evolutionarily conserved boule and dazl identify germ cells of Coilia nasus | |
| Huang et al. | Molecular characterization, sexually dimorphic expression, and functional analysis of 3′-untranslated region of vasa gene in half-smooth tongue sole (Cynoglossus semilaevis) | |
| US20200149063A1 (en) | Methods for gender determination and selection of avian embryos in unhatched eggs | |
| Kanamori et al. | Comparative genomics approach to the expression of figα, one of the earliest marker genes of oocyte differentiation in medaka (Oryzias latipes) | |
| CN103589717B (en) | Active transposon of fish Tc1-like and application of active transposon | |
| Meedel et al. | Muscle development and lineage-specific expression of CiMDF, the MyoD-family gene of Ciona intestinalis | |
| Liu et al. | Identification and characterization of DAZ family genes in Chinese soft‐shell turtle (Pelodiscus sinensis) | |
| CN109652459A (en) | A kind of honeybee gene editing method and editor's material based on CRISPR/Cas9 | |
| Chen et al. | Molecular cloning of a plasma membrane Ca2+ ATPase (PMCA) from Y-organs of the blue crab (Callinectes sapidus), and determination of spatial and temporal patterns of PMCA gene expression | |
| CN107881200A (en) | A kind of rapid screening method applied to model animal zebra fish transgenosis | |
| Yang et al. | Alternative splice variants and differential relative abundance patterns of vasa mRNAs during gonadal development in the Chinese mitten crab Eriocheir sinensis | |
| Zhang et al. | The regulation of retina specific expression of rhodopsin gene in vertebrates | |
| Minařík et al. | Atoh1 is required for the formation of lateral line electroreceptors and hair cells, whereas Foxg1 represses an electrosensory fate | |
| Wang et al. | Molecular characterization of Pod1 during sex development in Chinese tongue sole (Cynoglossus semilaevis) | |
| Costa et al. | Sea urchin neural α2 tubulin gene: isolation and promoter analysis | |
| Xu et al. | Characterization of the fast skeletal troponin C (TNNC2) gene in three Chinese native sheep breeds |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180601 Termination date: 20190212 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |