CN104928321B - A kind of scale loss zebra fish pattern and method for building up by Crispr/Cas9 inductions - Google Patents
A kind of scale loss zebra fish pattern and method for building up by Crispr/Cas9 inductions Download PDFInfo
- Publication number
- CN104928321B CN104928321B CN201510071972.4A CN201510071972A CN104928321B CN 104928321 B CN104928321 B CN 104928321B CN 201510071972 A CN201510071972 A CN 201510071972A CN 104928321 B CN104928321 B CN 104928321B
- Authority
- CN
- China
- Prior art keywords
- eda
- zebra fish
- scale
- sgrna
- cas9
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Abstract
The present invention relates to a kind of scale loss zebra fish pattern induced by Crispr/Cas9, which refers to the scale loss zebra fish for including the 4 site base insertion of EDA gene extrons.Meanwhile the method for building up the invention also discloses the pattern and application.The scale loss zebra fish pattern that the present invention establishes has very big application value in ectodermal dysplasia drugs such as the functional study of appendages of skin related gene, screening treatment human hair's rareness etc..
Description
Technical field
The present invention relates to gene engineering technology field more particularly to a kind of scale loss spots induced by Crispr/Cas9
Horse fish pattern and method for building up.
Background technology
The hair of the mankind and mammal, tooth, nail, sweat gland, the feather of birds, scale, hypopharynx tooth, the antenna of fish
Etc. belonging to the appendages of skin, and the development of the appendages of skin is most important for the mankind, and appendages of skin depauperation is suffered from
Person has Familial Occurrence, at present in mouse, fish etc. it has also been found that having such phenomenon, by genetics research it has proven convenient that skin is attached
The development of part is mainly regulated and controled by EDA family genes.
Eda (Eetodysplasin) and receptor Edar are associated with TNF, belong to TNF superfamily members, and EDA signals are
It is adjusted by Eetodysplasin, EDAR, EDARADD, is formed in the vertebrate appendages of skin regulation and control of fish to the mankind
One tnf ligand-receptor-aptamer family.EDA signal paths are found for the first time in the ectodermal dysplasia syndrome of the mankind.Nothing
Sweat or hypohidrosis type are ectodermal dysplasia（EDA）It is most common a kind of symptom in ectodermal dysplasia group, it is main to influence
The form of two or more appendages of skin occurs.
EDA, which mainly influences exocrine gland in hair, tooth sum aggregate, includes sweat gland, Meibomian gland and preputial gland.As a kind of something lost
It passes and learns disease, EDA is occurred in the form of X- linked recessives, autosomal dominant and recessiveness etc..Darwin is for the first time his within 1875
Book《The variations of animals and plants under domestication》In describe the chain shapes of X-
Formula has recorded the phenotype and the distinctive hereditary pattern of male of impacted Indian family's appendages of skin in detail.More than 100 years
Three kinds of various forms of variations of gene are found that in patient later, wherein X- is chainEDAGene mutation account in the case 90% with
On, remaining case is mainlyEDARWithEDARADDThe rare autosomal dominant inheritance of genetic comparison.Substantial amounts of result provesEDA、EDARWithEDARADDGene code participates in tnf ligand-receptor-aptamer family of appendages of skin development.
Eetodysplasin is one chain by X sex chromosomeEDATwo type transmembrane proteins of gene code, in extracellular space
Include a short collagenous portion（collagen）With a TNF domain.There is furin close to collagen areas（furin）
Site generates soluble EDA ligands, re-forms active ligand trimer.Have now been found that TNF, collagen,
Furin cuts the deletion mutation occurred with cross-film site in missense or reading frame, can cause EDA syndromes.TNF is
The functional domain of Eetodysplasin, however some the mutation displays found in patient, collagen areas also have critically important
Effect, which includes 19 G-X-Y and repeats, though the missing that 2 G-X-Y in reading frame are repeated or 4 G-X-Y are repeated
The function in TNF domains is not so influenced, but can equally cause EDA syndromes.Comparative genomics and genetics research finder,
Mouse, fish, Africa xenopus, chicken, ox, chimpanzee etc.EDA, EDAR, EDARADD geneIt is highly conserved during evolution.
Have now been found that similar spontaneous mutation animal model hasEDARThe medaka of mutation,EDAThe dog and ox of mutation,
Tabby, Downless/Sleek and Crinkled mouse mutant.People'sEDAGene mutation and the tabby of natural mutation
The phenotype of mouse is consistent, shows as the decline of hair follicle quantity or missing and sweat duct and the defects of tooth development.The appendages of skin
Species specificity is shown as, compared with the hair of mammal, sweat gland, fish are mainly bone plate, scale etc..Colosimo etc.
（2005）The study found that EDA also assists in the adaptive evolution of bone plate pattern in transition of the three-spined stickleback from ocean to fresh water.It is small
The EDA-A1 of mouse can make fresh water three-spined stickleback bone plate recover the consistent pattern with ocean three-spined stickleback, further point outEDAGene
For the adaptability of appendages of skin parallel evolution（Plasticity）.
The content of the invention
The technical problems to be solved by the invention are to provide a kind of scale loss zebra fish mould induced by Crispr/Cas9
Formula.
Another technical problem to be solved by this invention is to provide the method for building up of the scale loss zebra fish pattern.
To solve the above problems, a kind of scale loss zebra fish pattern induced by Crispr/Cas9 of the present invention,
It is characterized in that：The pattern refers to the scale loss zebra fish for including the 4 site base insertion of EDA gene extrons.
A kind of method for building up of scale loss zebra fish pattern by Crispr/Cas9 inductions as described above, including with
Lower step：
(1), using Ensemble online databases, zebra fish EDA gene orders no is searched：ENSDARG00000074591 is simultaneously
It downloads, searches the PAM i.e. 5 '-GGNNNNNNNNNNNNNNNNNNNGG-3 ' of sequence in the sequence, found in EDA gene extrons
Targeting sequence is TTAGGCAAGAAAGGGCCCCC【TGG】, and design and design abrupt climatic change primers F-eda:
Ttgttttgcttctcatcagttg and abrupt climatic change primer R-eda: tttgctctgctgcttcactc；
(2) the sequence verification of the wild-type allele of target sequence：
5 pieces of pf wild-type zebrafish embryos for 24 hours are randomly selected, genomic DNA template are extracted, then with F-eda and R-eda
PCR amplification is carried out, obtains the pcr amplification product I that fragment length is 358bp, which is drawn with the abrupt climatic change
Object F-eda direct Sequencings, to show that target gene group sequence is consistent with the sequence in database, no SNP applications overlapping；
(3) sgRNA is built：
(4) eda-sgRNA templates are established：
The template of the in-vitro transcription of sgRNA is obtained with PCR methods, the template sequence is as follows：TAATACGACT CACTATA GTT AGGCAAGAAA GGGCCCCCgt tttagagcta gaaatagcaa gttaaaataa ggctagtccg
ttatcaactt gaaaaagtgg caccgagtcg gtgctttttt t；
(5) sgRNA in-vitro transcriptions：
It is template with the pcr amplification product I, carries out sgRNA in-vitro transcriptions with T7 RNA polymerases, obtain sgRNA；Institute
State sgRNA makes its concentration be 1000ng/ul after absolute ethyl alcohol method precipitation；
(6) Cas9 mRNA in-vitro transcriptions：
With the Cas9 coded sequences of the humanization of U7 drivings（Mali et al., 2013. Science, 339(6121):
823-6）For template, Cas9 in-vitro transcriptions are carried out with U7 RNA polymerases, simultaneously tailing of then attaching the names of pre-determined candidates obtains Cas9 mRNA；It is described
Cas9 mRNA make its concentration be 600ng/ul after absolute ethyl alcohol method precipitation；
(7) the microinjection of zebra fish fertilized egg and abrupt climatic change：
After the sgRNA and the Cas9 mRNA mixed in equal amounts, the micro- wild type zebra for being injected into 1 ~ 2 cell stage
Fish fertilized egg when embryonic development is to 24 hpf, takes 5 pieces of embryos, prepares genomic DNA template, then with the abrupt climatic change
Primers F-eda and abrupt climatic change primer the R-eda carries out PCR amplification, obtains pcr amplification product II；The PCR amplification is produced
Object II is subcloned into pEASY-T3 carriers；And transformant is expanded with T7 and Sp6 universal primers, by PCR product ten
One group totally two groups directly send sequencing, sequencing primer is T7 or Sp6 wherein one；
(8) mutant scale Observation On The Development and dyeing identification：
The scale developmental state for having the zebra fish of EDA gene mutations to detection carries out microexamination, and screening obtains EDA bases
Cause scale loss mutant because 4 target site of extron introduces insertion mutation, scale dyeing is carried out to scale dysplasia individual
Identification, to determine whether scale has developmental defect.
A kind of application of scale loss zebra fish pattern by Crisper/Cas9 inductions as described above, feature exist
In：The scale loss zebra fish pattern is applied to the verification of appendages of skin related gene function and ectodermal dysplasia drug
Screening.
The present invention has the following advantages compared with prior art：
1st, the present invention is for zebra fish EDA genes (containing 8 extrons), and design targeting is in 4 site of extron
EDA-sgRNA（See Fig. 1）, by building EDA-sgRNA and Cas9 mRNA carriers, fertilized eggs are injected after reverse transcription, are expanded through PCR
Increasing and sequence verification detect the insertion mutation in 4 12 bases of site primer of extron（See Fig. 2）.
2nd, the present invention carries out the observation of scale developmental state and dyeing to individual and the wild type individual of EDA gene insertion mutations
Identification finds that the mutant there is no that scale is developed, and wild type individual scale covering whole body（See Fig. 3）.
3rd, the scale loss zebra fish pattern that the present invention establishes is in the functional study of appendages of skin related gene, screening treatment people
Class exiguous human hair etc. is ectodermal dysplasia, and drug etc. has very big application value.
Description of the drawings
The specific embodiment of the present invention is described in further detail below in conjunction with the accompanying drawings.
Fig. 1 is the zebra fish EDA genes of the present invention and Crispr/Cas9 target sites.Zebra fish EDA genes are shared outside 8
Aobvious son, the Crispr target sites at 4 site of extron have been screened by Photographing On-line.
Fig. 2 is the zebra fish of Crispr/Cas9 of the present invention inductionsEDADetection in Gene Mutation.F1 individual extractions to foundation
Genome is expanded using abrupt climatic change primers F-eda and R-eda, and carries out direct Sequencing to PCR product, is detected whether
There is mutation to introduce（A and B）；In addition the specific mutation type of TA clone identifications is carried out to the PCR product for having mutation to introduce（C and D）.
Wherein：
A figures are that wild-type zebrafish EDA genes include target site region PCR product sequencing result, are target site in frame；
B figures are that PCR product the bimodal saltant type zebra fish testing result for indicating insertion or deletion mutation occurs；
C figures are the individual PCR product T-A cloning and sequencings of B figure detections as a result, relatively there is base insertion with wild type；
D target site sequences compare, wild type individual target site sequence（WT）With there is the saltant type individual of 15 base insertions
Sequence (MT+15bp).
Fig. 3 is zebra fish individual Alizarin red staining of the present invention.To EDA processing zebra fish wild type and saltant type individual into
Row scale dyeing identification scale developmental state, wherein A is mutant zebra fish, and scale lacks substantially；B is wild-type zebrafish,
Whole body covers scale.
Specific embodiment
A kind of scale loss zebra fish pattern induced by Crispr/Cas9 of embodiment 1, the pattern refer to comprising EDA bases
Because of the scale loss zebra fish of 4 site base insertion of extron.
The method for building up of the scale loss zebra fish pattern, comprises the following steps：
(1), using Ensemble online databases, zebra fish EDA gene orders no is searched：ENSDARG00000074591 is simultaneously
It downloads, PAM is searched in the sequence（protospacer-adjacent motif ）Sequence i.e. 5 '-
GGNNNNNNNNNNNNNNNNNNNGG-3 ' is in the targeting sequence that EDA gene extrons are found
TTAGGCAAGAAAGGGCCCCC【TGG】, and design and design abrupt climatic change primers F-eda:
Ttgttttgcttctcatcagttg and abrupt climatic change primer R-eda: tttgctctgctgcttcactc.
(2) the sequence verification of the wild-type allele of target sequence：
5 pieces of pf wild-type zebrafish embryos for 24 hours are randomly selected, genomic DNA template are extracted, then with F-eda and R-eda
Carry out PCR amplification, obtain fragment length be 358bp pcr amplification product I, the pcr amplification product I with abrupt climatic change primers F-
Eda direct Sequencings, sequencing work well, and chromatogram readability is good.The result shows that the sequence in target gene group sequence and database
Row are consistent, no SNP applications overlapping.
(3) sgRNA is built：
1. carrier and Insert Fragment processing：
SgRNA carrier constructions are usedBbsL digestions pT7-gRNA, gel extraction obtain sgRNA clone's skeletons pT7-gRNA_BbsIoFollowing processing is done as Insert Fragment, the Insert Fragment in IE sites：Use ddH2The Oligo of target site is dissolved as 10 μ by O
M respectively takes the 5 isometric mixings of μ L, anneals by following procedure：95 DEG C of 5min, -1 DEG C/30sec/cycle, 4 DEG C of to.
2. linked system：
Take target site Oligo and sgRNA clone's skeleton pT7-gRNA_ after annealingBbsEach luL of I run glue, to Insert Fragment
It is carried out with carrier after quantifying, the target site Oligo after annealing is connected with gRNA carriers.Because Insert Fragment is smaller, final institute
Determining linked system is：Oligo l μ L, pT7-gRNA_Bbs2 μ L, T4 ligase l of I l μ L, 5 × T4 ligase buffer
μ L, totally 10 μ L systems, 25 DEG C of 3 ~ 4h of connection.5 μ L are taken, are transformed into Trans-Tl competent cells.
3. bacterium colony PCR is verified：
5 ~ 10 monoclonals of picking take l μ L to be used as template and carry out PCR amplification, primer is into l0 μ L LB fluid nutrient mediums
Carrier universal primer RV-M and target site specific mutagenesis detection primer R-eda, with EsayTaq DNA Polymerase, l0 μ L bodies
System is expanded.Purpose band about 130bp.Picking positive colony send sequencing, chooses sequence and correctly clones progress glycerine guarantor bacterium,
Extract plasmid.
(4) eda-sgRNA templates are established：
The template of the in-vitro transcription of sgRNA is obtained with PCR methods, the template sequence is as follows：TAATACGACT CACTATA GTT AGGCAAGAAA GGGCCCCCgt tttagagcta gaaatagcaa gttaaaataa ggctagtccg
ttatcaactt gaaaaagtgg caccgagtcg gtgctttttt t。
Wherein：Italicized capitals part for T7 start subdivision, underscore part be gRNA templates, lowercase sgRNA
Skeleton.
(5) sgRNA in-vitro transcriptions：
It is template with pcr amplification product I, carries out sgRNA in-vitro transcriptions with T7 RNA polymerases, obtain sgRNA；sgRNA
It is 1000ng/ul to make its concentration after absolute ethyl alcohol method precipitation.
Wherein：In-vitro transcription system refers to 5 × Transcription Buffer l0 μ L；l00Mm DTT 5μL；NTP
mix (lOmM each) l0μL；Template (>lμg) 20μL；2 μ L of T7 RNA polymerases；RNase Inhibitor
(40U) l μ L DEPC water supplies system to 50 μ L, 37 DEG C of reaction 2h,
2 μ L is taken to detect transcription effects with the agarose gel electrophoresis of 1 %.
(6) Cas9 mRNA in-vitro transcriptions：
With the Cas9 coded sequences of the humanization of U7 drivings（Mali et al., 2013. Science, 339(6121):
823-6）For template, Cas9 in-vitro transcriptions are carried out with U7 RNA polymerases, simultaneously tailing of then attaching the names of pre-determined candidates obtains Cas9 mRNA；Cas9
MRNA makes its concentration be 600ng/ul after absolute ethyl alcohol method precipitation.
Wherein：In-vitro transcription system refers to 5 × Tanscription Buffer l0 μ L, l00mMDTT 5 μ L, NTPmix
(ATP/CTP/UTP each l0mM, GTP：ImM)：L0 μ L SP6 RNA Polymerase (SOU) 2 μ L, Rnase
Inhibitor (SOU) l μ L, Template 17 μ L, CAP (lOmM) 5 μ L.37 DEG C, water-bath 1.5h.
L μ L is taken to carry out 1% Ago-Gel detection mRNA synthetic effects.
1. Cas9 mRNA templates are digested：Add in DNasel 2 μ L, 37 DEG C of digestion 15min.
2. phenol chloroform and LiCl precipitations：
Cas9 mRNA in-vitro transcription systems are supplied to 100 μ L with DEPC water, add in phenol：Chloroform：Isoamyl alcohol（25：24：
1）100 μ L, misfortune rotation 15s mixings, 12000rpm are centrifuged 30 seconds, are drawn supernatant into new centrifuge tube, add in chloroform：Isoamyl alcohol（24：
1）100 μ L, misfortune rotation 15s mix hook, and 12000rpm is centrifuged 30 seconds, again moved to supernatant in new centrifuge tube, adds in 1/10 volume
3 MNaAc (pH4.0) and the absolute ethyl alcohol of 2 times of volume precoolings, turn upside down, -80 DEG C of standing 5min.12000rpm is centrifuged
15min removes supernatant, is blotted on blotting paper, 400 μ L Ua of addition, reverse mixing, 12000rpm centrifugation 15min, in absorption
Clearly, 700 μ L 70%DEPC ethyl alcohol are added in, 12000rpm centrifugation 15min carefully outwell supernatant, add 700 μ L 70%DEPC second
Alcohol centrifuges 12000rpm15min again, removes supernatant, is dissolved in l0 μ L Rnase after being stored at room temperature the ethyl alcohol that thoroughly volatilizees for 3 ~ 5 minutes
In Free water, 0.5 μ L is taken to detect gRNA concentration for 1% agarose gel electrophoresis.
(7) the microinjection of zebra fish fertilized egg and abrupt climatic change：
After sgRNA and Cas9 mRNA mixed in equal amounts, the micro- wild-type zebrafish fertilized eggs for being injected into 1 ~ 2 cell stage,
Zebrafish embryo after injection is put into 28 DEG C of insulating boxs and is cultivated.General 1 μ L can inject 300 ovum.
When embryonic development is to 24 hpf, takes 5 pieces of embryos, prepare genomic DNA template, then with abrupt climatic change primers F-
Eda and abrupt climatic change primer R-eda carries out PCR amplification, obtains pcr amplification product II；The pcr amplification product II is subcloned
Into pEASY-T3 carriers.And transformant is expanded with T7 and Sp6 universal primers, by ten one group totally two groups of PCR product
Sequencing is directly sent, sequencing primer is T7 or Sp6 wherein one.
TA clone's used carriers are pEASY-T3 carriers.Specific steps：
Following reaction solution second is added in the EP pipes of 0.2mL and takes turns 2 μ L, T4 DNA ligase of PCR products, 1 μ L, 10
1 μ L, pGM-T vector of × T4 DNA ligation buffer 1 μ L, ddH26 μ L of O, 16 DEG C of connections overnight, turn for second day
In Trans-Tl competent cells.The random white single bacterium colony of picking 10 carries out bacterium colony PCR with T7 and SP6 universal primers, in advance
Phase size segment is 350bp, one brightness of day is sent far to be sequenced positive colony.
(8) mutant scale Observation On The Development and dyeing identification：
The scale developmental state for having the zebra fish of EDA gene mutations to detection carries out microexamination, and screening obtains EDA bases
Cause scale loss mutant because 4 target site of extron introduces insertion mutation, scale dyeing is carried out to scale dysplasia individual
Identification, to determine whether scale has developmental defect.
It is as follows：It is fixed for 24 hours with 4% formalin solution, 70% ethanol dehydration 5h, then in the madder of 1g/L
It is dyed for 24 hours in the red solution of element, it is micro- using ZESIS Discovery V13 after 1%KOH+5% glycerine carries out decoloration 48h
Mirror is imaged.
The verification applied to appendages of skin related gene function of the scale loss zebra fish pattern of embodiment 2 and outer embryo
The screening of layer depauperation drug.
PAM sequences
5’-GGNNNNNNNNNNNNNNNNNNNGG-3’
Targeting sequence
TTAGGCAAGAAAGGGCCCCC【TGG】
Abrupt climatic change primers F-eda
ttgttttgcttctcatcagttg
Abrupt climatic change primer R-eda
tttgctctgctgcttcactc
Template sequence
TAATACGACT CACTATAGTT AGGCAAGAAA GGGCCCCCgt tttagagcta gaaatagcaa
gttaaaataa ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg gtgctttttt t
Claims (2)
1. a kind of method for building up of scale loss zebra fish pattern by Crispr/Cas9 inductions, it is characterised in that：The pattern is
Refer to the scale loss zebra fish for including the 4 site base insertion of EDA gene extrons；
Comprise the following steps：
(1), using Ensemble online databases, zebra fish EDA gene orders no is searched：ENSDARG00000074591 and under
It carries, the PAM i.e. 5 '-GGNNNNNNNNNNNNNNNNNNNGG-3 ' of sequence is searched in the sequence, in the target that EDA gene extrons are found
It is TTAGGCAAGAAAGGGCCCCC to acting sequences【TGG】, and design abrupt climatic change primers F-eda:
Ttgttttgcttctcatcagttg and abrupt climatic change primer R-eda: tttgctctgctgcttcactc；
(2) the sequence verification of the wild-type allele of target sequence：
5 pieces of pf wild-type zebrafish embryos for 24 hours are randomly selected, genomic DNA template is extracted, is then carried out with F-eda and R-eda
PCR amplification, obtain fragment length be 358bp pcr amplification product I, the pcr amplification product I with the abrupt climatic change primers F-
Eda direct Sequencings, to show that target gene group sequence is consistent with the sequence in database, no SNP applications overlapping；
(3) sgRNA is built：
(4) eda-sgRNA templates are established：
The template of the in-vitro transcription of sgRNA is obtained with PCR methods, the template sequence is as follows：TAATACGACT CACTATA GTT AGGCAAGAAA GGGCCCCCgt tttagagcta gaaatagcaa gttaaaataa ggctagtccg ttatcaactt
gaaaaagtgg caccgagtcg gtgctttttt t；
(5) sgRNA in-vitro transcriptions：
It is template with the pcr amplification product I, carries out sgRNA in-vitro transcriptions with T7 RNA polymerases, obtain sgRNA；It is described
SgRNA makes its concentration be 1000ng/ul after absolute ethyl alcohol method precipitation；
(6) Cas9 mRNA in-vitro transcriptions：
Using the Cas9 coded sequences of the humanization of U7 drivings as template, Cas9 in-vitro transcriptions are carried out with U7 RNA polymerases, then
It attaches the names of pre-determined candidates and tailing, obtains Cas9 mRNA；The Cas9 mRNA make its concentration be 600ng/ul after absolute ethyl alcohol method precipitation；
(7) the microinjection of zebra fish fertilized egg and abrupt climatic change：
By after the sgRNA and the Cas9 mRNA mixed in equal amounts, the micro- wild-type zebrafish for being injected into 1 ~ 2 cell stage by
Smart ovum when embryonic development is to 24 hpf, takes 5 pieces of embryos, prepares genomic DNA template, then with the abrupt climatic change primer
The F-eda and abrupt climatic change primer R-eda carries out PCR amplification, obtains pcr amplification product II；By the pcr amplification product II
It is subcloned into pEASY-T3 carriers；And transformant is expanded with T7 and Sp6 universal primers, by ten one group of PCR product
Directly send sequencing for totally two groups, sequencing primer is T7 or Sp6 wherein one；
(8) mutant scale Observation On The Development and dyeing identification：
The scale developmental state for having the zebra fish of EDA gene mutations to detection carries out microexamination, and screening is obtained outside EDA genes
4 target sites of aobvious son, which introduce insertion mutation, causes scale loss mutant, and scale dyeing identification is carried out to scale dysplasia individual,
To determine whether scale has developmental defect.
2. a kind of scale loss zebra fish pattern by Crispr/Cas9 inductions that method as described in claim 1 is established is answered
With, it is characterised in that：The scale loss zebra fish pattern is applied to the verification of appendages of skin related gene function and ectoderm hair
Educate the screening of bad drug.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510071972.4A CN104928321B (en) | 2015-02-12 | 2015-02-12 | A kind of scale loss zebra fish pattern and method for building up by Crispr/Cas9 inductions |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510071972.4A CN104928321B (en) | 2015-02-12 | 2015-02-12 | A kind of scale loss zebra fish pattern and method for building up by Crispr/Cas9 inductions |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104928321A CN104928321A (en) | 2015-09-23 |
| CN104928321B true CN104928321B (en) | 2018-06-01 |
Family
ID=54115748
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510071972.4A Expired - Fee Related CN104928321B (en) | 2015-02-12 | 2015-02-12 | A kind of scale loss zebra fish pattern and method for building up by Crispr/Cas9 inductions |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104928321B (en) |
Families Citing this family (32)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP6261500B2 (en) | 2011-07-22 | 2018-01-17 | プレジデント アンド フェローズ オブ ハーバード カレッジ | Evaluation and improvement of nuclease cleavage specificity |
| US20150044192A1 (en) | 2013-08-09 | 2015-02-12 | President And Fellows Of Harvard College | Methods for identifying a target site of a cas9 nuclease |
| US9359599B2 (en) | 2013-08-22 | 2016-06-07 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US9526784B2 (en) | 2013-09-06 | 2016-12-27 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US9322037B2 (en) | 2013-09-06 | 2016-04-26 | President And Fellows Of Harvard College | Cas9-FokI fusion proteins and uses thereof |
| US9340800B2 (en) | 2013-09-06 | 2016-05-17 | President And Fellows Of Harvard College | Extended DNA-sensing GRNAS |
| AU2014346559B2 (en) | 2013-11-07 | 2020-07-09 | Editas Medicine,Inc. | CRISPR-related methods and compositions with governing gRNAs |
| US9840699B2 (en) | 2013-12-12 | 2017-12-12 | President And Fellows Of Harvard College | Methods for nucleic acid editing |
| CA2956224A1 (en) | 2014-07-30 | 2016-02-11 | President And Fellows Of Harvard College | Cas9 proteins including ligand-dependent inteins |
| IL310721A (en) | 2015-10-23 | 2024-04-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| CN105594664B (en) * | 2016-02-16 | 2018-10-02 | 湖南师范大学 | A kind of method of gene knockout selection and breeding stat1a Gene Deletion zebra fish |
| KR20230095129A (en) | 2016-08-03 | 2023-06-28 | 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 | Adenosine nucleobase editors and uses thereof |
| CN109804066A (en) | 2016-08-09 | 2019-05-24 | 哈佛大学的校长及成员们 | Programmable CAS9- recombination enzyme fusion proteins and application thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| KR20240007715A (en) | 2016-10-14 | 2024-01-16 | 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 | Aav delivery of nucleobase editors |
| WO2018119359A1 (en) | 2016-12-23 | 2018-06-28 | President And Fellows Of Harvard College | Editing of ccr5 receptor gene to protect against hiv infection |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| WO2018165629A1 (en) | 2017-03-10 | 2018-09-13 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| IL269458B2 (en) | 2017-03-23 | 2024-02-01 | Harvard College | Nucleobase editors comprising nucleic acid programmable dna binding proteins |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| CN106978445A (en) * | 2017-06-12 | 2017-07-25 | 内蒙古大学 | The method of the goat EDAR gene knockouts of CRISPER Cas9 System-mediateds |
| CN107217075B (en) * | 2017-06-28 | 2021-07-02 | 西安交通大学医学院第一附属医院 | Method for constructing EPO gene knockout zebra fish animal model, primer, plasmid and preparation method |
| CN109207523A (en) * | 2017-06-29 | 2019-01-15 | 南京尧顺禹生物科技有限公司 | The foundation and application of human obesity's zebra fish model based on UCP1 gene |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| EP3676376A2 (en) | 2017-08-30 | 2020-07-08 | President and Fellows of Harvard College | High efficiency base editors comprising gam |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| CN108707628B (en) * | 2018-05-28 | 2021-11-23 | 上海海洋大学 | Preparation method of zebra fish notch2 gene mutant |
| WO2020191248A1 (en) | 2019-03-19 | 2020-09-24 | The Broad Institute, Inc. | Method and compositions for editing nucleotide sequences |
| CN109880827B (en) * | 2019-03-26 | 2021-05-18 | 杭州师范大学附属医院(杭州市第二人民医院) | Method for establishing hepatolenticular degeneration zebra fish model |
| JP2023525304A (en) | 2020-05-08 | 2023-06-15 | ザ ブロード インスティテュート，インコーポレーテッド | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| CN113416787A (en) * | 2021-07-08 | 2021-09-21 | 中国科学院西北高原生物研究所 | Method for detecting mutation of Acsl1a gene of zebra fish |
| CN115521899A (en) * | 2022-05-06 | 2022-12-27 | 西南大学 | An efficient Japanese green culture cell CRISPR/Cas9 genome editing method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103388006A (en) * | 2013-07-26 | 2013-11-13 | 华东师范大学 | Method for constructing gene site-directed mutation |
| CN104195177A (en) * | 2014-08-05 | 2014-12-10 | 南京大学 | Method for remarkably improving fish genome editing efficiency |
-
2015
- 2015-02-12 CN CN201510071972.4A patent/CN104928321B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103388006A (en) * | 2013-07-26 | 2013-11-13 | 华东师范大学 | Method for constructing gene site-directed mutation |
| CN104195177A (en) * | 2014-08-05 | 2014-12-10 | 南京大学 | Method for remarkably improving fish genome editing efficiency |
Non-Patent Citations (2)
| Title |
|---|
| Danio rerio ectodysplasin A (eda), mRNA;NM_001115065.1;《Genbank》;20140928;全文 * |
| Zebrafish eda and edar Mutants Reveal Conserved and Ancestral Roles of Ectodysplasin Signaling in Vertebrates;Matthew P.Harris et al.;《PLOS Genetics》;20081031;第4卷(第10期);第1-15页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104928321A (en) | 2015-09-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104928321B (en) | A kind of scale loss zebra fish pattern and method for building up by Crispr/Cas9 inductions | |
| Gutiérrez-Gil et al. | An interpretive review of selective sweep studies in Bos taurus cattle populations: identification of unique and shared selection signals across breeds | |
| Peifer et al. | The segment polarity gene armadillo encodes a functionally modular protein that is the Drosophila homolog of human plakoglobin | |
| Rijnkels et al. | Multispecies comparative analysis of a mammalian-specific genomic domain encoding secretory proteins | |
| Rossi et al. | Two novel/ancient myosins in mammalian skeletal muscles: MYH14/7b and MYH15 are expressed in extraocular muscles and muscle spindles | |
| Minguillon et al. | Hox genes regulate the onset of Tbx5 expression in the forelimb | |
| Xu et al. | Analysis of the erythropoietin of a Tibetan Plateau schizothoracine fish (Gymnocypris dobula) reveals enhanced cytoprotection function in hypoxic environments | |
| Domené et al. | Enhancer turnover and conserved regulatory function in vertebrate evolution | |
| Farkašová et al. | Identification of a GC-rich leptin gene in chicken | |
| Bian et al. | Morphological characteristics and comparative transcriptome analysis of three different phenotypes of Pristella maxillaris | |
| Kusakabe et al. | Computational discovery of DNA motifs associated with cell type-specific gene expression in Ciona | |
| Mohanta et al. | Molecular cloning, characterization and functional assessment of the myosin light polypeptide chain 2 (mylz2) promoter of farmed carp, Labeo rohita | |
| An et al. | The period gene in two species of tephritid fruit fly differentiated by mating behaviour | |
| Lang et al. | A BAC library of the East African haplochromine cichlid fish Astatotilapia burtoni | |
| Li et al. | Differential evolution of duplicated medakafish mitf genes | |
| Liu et al. | Global characterization and expression analysis of interferon regulatory factors in response to Aeromonas hydrophila challenge in Chinese soft-shelled turtle (Pelodiscus sinensis) | |
| Tomlinson et al. | Ectoderm nuclei from sea urchin embryos contain a Spec–DNA binding protein similar to the vertebrate transcription factor USF | |
| Zhu et al. | Functional analysis of two MyoDs revealed their role in the activation of myomixer expression in yellowfin seabream (Acanthopagrus latus)(Hottuyn, 1782) | |
| Zhang et al. | cDNA cloning and expression analysis of the myosin heavy chain (MYH) gene of the mandarin fish Siniperca kneri | |
| Rourke et al. | Characterization of the cholecystokinin and gastrin genes from the bullfrog, Rana catesbeiana: evolutionary conservation of primary and secondary sites of gene expression | |
| Galal et al. | Identification of single nucleotide polymorphism in heat shock protein HSP70 and HSP90 after four selection generations in two lines of chickens | |
| Iwabuchi et al. | Molecular cloning and characterization of avian bombesin‐like peptide receptors: new tools for investigating molecular basis for ligand selectivity | |
| Chen et al. | Molecular cloning of a plasma membrane Ca2+ ATPase (PMCA) from Y-organs of the blue crab (Callinectes sapidus), and determination of spatial and temporal patterns of PMCA gene expression | |
| Kajiura-Kobayashi et al. | The cloning of cyclin B3 and its gene expression during hormonally induced spermatogenesis in the teleost, Anguilla japonica | |
| Liu et al. | Genome‐wide identification and transcriptome‐based expression profiling of the Sox gene family in the spinyhead croaker (Collichthys lucidus) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180601 Termination date: 20190212 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |