CN1196785C - Beta-amyloid peptdie-binding proteins and polynucleotides encoding the same - Google Patents

Abstract

Novel proteins which bind human beta-amyloid peptide, polynucleotides which encode these proteins, and methods for producing these proteins are provided. Diagnostic, therapeutic, and screening methods employing the polynucleotides and polypeptides of the present invention are also provided.

Description

Beta amyloid peptide-binding proteins and coding polynucleotide thereof

The application has benefited from receiving the U.S. Provisional Application of submitting to into 16 days April in 1997 of reference 60/064,583 at this.

Invention field

The present invention relates to a kind of new polynucleotide and encoded protein matter thereof, also relate to described polynucleotide and the protein purposes aspect treatment, prevention and research.Specifically, the protein bound beta amyloid peptide that polynucleotide involved in the present invention is coded, this peptide are one of major ingredient of the amyloid beta deposition thing relevant with degenerative brain disorder (Alzheimer's disease).

Background of invention

Alzheimer's disease (AD) is a kind of senile dementia that carries out, and is feature with a series of brain textural anomalies.Neurone generation dysfunction or death in the many zones of central nervous system (CNS), the crossover (alterations) that causes cynapse to be imported.These fragile neuron cell bodies and contiguous dendron contain the nerve fiber winding that paired spirial filaments constitutes, and major ingredient wherein is the microtubule bindin of phosphorylation, claims Protein tau again.One of feature that this is sick is that brain includes the sedimentary accumulation of amyloid, is called aging (nerve) spot.The major ingredient of amyloid plaque is beta amyloid peptide (hereinafter with " BAP " expression, claiming A β, β AP etc. in the literature again), and it forms fine and close aggregate in the course of disease of AD.

BAP is the amino acid whose peptide of a kind of 39-43, is got through proteolytic cleavage by amyloid precursor protein (hereinafter with " APP " expression), has membrane-spanning domain and luminol,3-aminophthalic acid cyclic hydrazide (the luminal)/extracellular domain of APP.Comprising that 42 amino acid whose BAP peptides (BAP42) are considered to may be aggregate more malicious in the human body.APP occurs with the isotype form that several contain BAP.Principal mode comprises 695,751 and 770 amino acid, and the structural domain that back two kinds of APP contain has homology with the Kunitz serpin in structure and function.In normal individual, BAP does not accumulate, and is removed rapidly from instrument for circulation of body fluid.But this peptide can form spot on underfed dendron and aixs cylinder surface, little Microglial cell and active stellate cell.It may be one of early ambulant of AD that the gathering of the interior BAP of neuritic plaque and deposition are considered to.It is a principal focal point of Neuroscience Research that research causes the effect among BAP expression and consequence and their each comfortable AD.Especially, it is critical understanding the pathology of this disease and may introduce new therapeutic goal for promotion in conjunction with the proteic discovery of BAP.

Before the present invention, also do not identify in conjunction with people BAP and may relate to protein and the fragment thereof that BAP acts in AD.

Summary of the invention

The invention provides a kind of new isolating polynucleotide, the gene product of its coding selective binding beta amyloid peptide (BAP) aminoacid sequence.

In one of embodiment, the invention provides a kind of composition, wherein contained isolating polynucleotide is selected from:

(a) comprise the polynucleotide of nucleotide sequence SEQ ID NO:1;

(b) comprise the polynucleotide of beta amyloid peptide-binding proteins (BBP) nucleotide sequence, described BBP is the clone BBP-fl of ATCC98617 from preserving number;

(c) polynucleotide of coding beta amyloid peptide-binding proteins (BBP), described BBP are that the cDNA in the clone BBP-fl of ATCC98617 inserts fragment coding by preserving number;

(d) comprise among the sequence SEQ ID NO:1 Nucleotide 202 to the polynucleotide of Nucleotide 807;

(e) comprise the polynucleotide of beta amyloid peptide-binding proteins (BBP) nucleotide sequence, described BBP is the clone pEK196 of ATCC98399 from preserving number;

(f) polynucleotide of coding beta amyloid peptide-binding proteins (BBP), described BBP inserts fragment coding by the cDNA of the clone pEK196 of preserving number ATCC98399;

(g) coding contains the proteinic polynucleotide of aminoacid sequence SEQ ID NO:2;

(h) the following proteinic polynucleotide of coding, this protein comprises the fragment of aminoacid sequence SEQ ID NO:2, has the activity in conjunction with the human beta-amyloid peptide, and described fragment comprises among the aminoacid sequence SEQ ID NO:2 amino acid 68 to amino acid 269;

(j) polynucleotide is the allelic variation body of above polynucleotide (a)-(f);

(k) the encode polynucleotide of ethnic homologue of above-mentioned protein (g)-(h);

(l) under rigorous condition can with (a)-(h) in the polynucleotide of arbitrary polynucleotide hybridization.

Be preferably, described polynucleotide comprises nucleotide sequence SEQ ID NO:1; Preserving number is the nucleotide sequence of beta amyloid peptide-binding proteins (BBP) of the clone BBP-fl of ATCC98617; Or by preserving number the polynucleotide that the cDNA of the clone BBP-fl of ATCC98617 inserts the beta amyloid peptide-binding proteins (BBP) of fragment coding.The gene that another embodiment provides is corresponding to the cDNA of sequence SEQ ID NO:1.

In another embodiment, the invention provides a kind of proteinic composition that comprises, the contained aminoacid sequence of wherein said protein is selected from:

(a) aminoacid sequence SEQ ID NO:2

(b) amino acid 68 among the aminoacid sequence SEQ ID NO:2 is to amino acid 269;

(c) be the aminoacid sequence that the cDNA of the clone BBP-fl of ATCC98617 inserts fragment coding by preserving number;

(d) fragment of aminoacid sequence SEQ ID NO:2 comprises among the aminoacid sequence SEQ ID NO:2 amino acid/11 85 to the aminoacid sequence of amino acid 217.

Be preferably, described protein comprises aminoacid sequence SEQ ID NO:2, or amino acid wherein 68 is to amino acid 269.The present invention also comprises fusion rotein.

In some preferred embodiment, described polynucleotide is connected with the expression regulation sequence operability.The present invention also provides with this oligonucleotide composition transformed host cells, comprises bacterium, yeast, insect and mammalian cell.

The present invention also provides the method for preparing BBP, and it comprises: (a) cultivate the described host cell culture of claim 3 in suitable medium; (b) protein purification from substratum.

The present invention also provides the composition that comprises with the antibody of described BBP specific reaction.

The present invention also provides certain methods and diagnostic method, is used for detecting the method for regulating the active compound of BBP with disease that is expressed as feature and the evaluation of people BAP.

Another embodiment of the present invention also comprises transgenic animal, and they contain the polynucleotide of the coding BBP that is connected with the expression regulation sequence operability.

The accompanying drawing summary

Accompanying drawing has shown some embodiment of the present invention.They only are used for illustrating the present invention rather than limitation of the invention.

Fig. 1: the design of yeast 2-screening by hybridizationThe Y2H host strain is expressed and BAP42 (BAP BD; Contain the plasmid that TRP1 indicates) and non-fusion BAP42 (BAP; The plasmid that contains the URA3 sign) the Gal4 DNA-binding domains that merges transforms this bacterial strain with people's tire brain cDNA library of expressing described Gal4 activation domain fusion rotein (unknown AD) (plasmid that contains the LEU2 sign).So bacterial strain contains proteic shown in the expression (representing with annulus) three kinds of additive type plasmids.Protein-proteinic positive interaction has recovered the Gal4 activity of upstream activation sequences (GALUAS), induces transcribing of reporter gene HIS3 thus.

Fig. 2: the BBP/BAP bonded is showedAnalyze the Histidine prototroph of Y2H bacterial strain: prepare 10 times serial dilution, do not having tryptophane, leucine, Histidine but containing to put on the synthetic agar substratum of 25mM 3-aminothiazole to add 5 μ l.All bacterial strains all contain BAP Expression of Fusion Protein plasmid pEK162, shown in mark BAP.First row (carrier) comprise separate derivative strain, carry the carrier pACT2 of pEK162 and a kind of irrelevant fusion rotein of expression.Come to compare as weighing background with this with the bacterial strain of expressing target protein.Each tabulation that indicates with BBPDtm reaches the brachymemma BBP from pEK198, and is as described herein.Interaction between BAP and the BBPDtm fusion rotein has recovered the Gal4 activity, therefore induces transcribe (referring to Fig. 1) of reporter gene HIS3, can observe prototroph growth fraction control strain and strengthen.

Fig. 3: prove the interactional biological test of BBP and gThe extracellular domain of the BBP that estimates is expressed becomes Gal4 DNA binding domains, has the rat Gas that is expressed as Gal4 activation domain fusion rotein, Gao or Gai2 part.Reply with the replying of cell that does not have G albumen composition (carrier) and compare by derive respectively two clones' that obtain Y2H of bacterial strain separately.In the legend of Fig. 2 method has been described.

The position of Fig. 4: BBP and BAP interphase interactionBBP Δ tm two sections of the eclipsed that are divided into as described herein.Analyze the interaction of BBP Δ C or these two kinds of protein of BBP Δ N and BAP.Test method and the bacterial strain that indicates with carrier or BBP Δ tm have been described in the legend of Fig. 2.BBP fragment shown in the bacterial strain expressed fusion protein form that indicates with BBP Δ C or BBP Δ N.

Fig. 5: the expression of (A) and the interior BBP mRNA of brain (B) in the people organizesSeparation is that these are from CLONTECH from the nylon film that the 2 μ g points through size separation of described tissue are imprinted on poly-A RNA.They with through radiolabeled BBP cDNA probe hybridization.In all swimming lanes, all observe the band of an outstanding 1.25kb (determining that according to the molecular weight standard thing standard substance does not show).The band that molecular weight is bigger may be corresponding to heteronuclear RNA; The BBP gene contains several introns.Peel spot and contrast detection once more as loading and RNA integrity with the β Actin muscle; All swimming lanes all show equal signal (data not shown).

Fig. 6: the expression of BBP and APP in the hippocampal cellThe in situ hybridization autoradiogram(ARGM) has shown the phraseology of sea of faces's horse skin layer and interior BBP (A) of entorihnal cortex and APP (B).Be used for producing the after death autopsy sample of the section of these radiographies from two patients.Abbreviation: DG=dentation gyrus; CA1=hippocampus inferior segment; The EC=entorihnal cortex.

The interactional comparison of the BAP of Fig. 7: BBP and people or mouseAs described herein, mouse BAP is through the genetic engineering modified fusion rotein that is expressed as.The bacterial strain that indicates with people BAP identical with shown in Fig. 2.That the bacterial strain that indicates with mouse BAP is expressed is the mouse BAP of Gal4 DNA binding domains syzygy form.Carrier refers to only contain carrier and the control strain that do not contain the BAP fusion rotein; BBP indicates the bacterial strain of expressing BBP Δ tm fusion rotein

Detailed description of the present invention

The present invention relates to separation and the clone of human beta-amyloid peptide-binding proteins (BBP). Through the signature analysis that yeast 2 cross experiments carry out, BBP is a kind of fusion, in conjunction with 42 amino acid fragments (BAP42) of BAP. Find that BBP expresses (Fig. 5) in people's tissue and specific brain regional area. Importantly, in yeast 2 crossing systems, BBP is proved to be and has more optionally in conjunction with people BAP but not mouse BAP. These find to support following supposition, that is, BBP of the present invention can be for the diagnosis and treatment of presenile dementia, and are used for estimating and the medicine that brain includes the amyloid plaque accumulation is regulated in screening.

The BBP coded sequence

Initial people BBP clone (being called clone 14) utilizes yeast 2 hybridization (Y2H) genescreen methods to obtain, and the method is used for the protein of calibrating and people BAP42 effect, and BAP42 is the potentiality high toxicity form more of BAP. The Gal4 DNA binding structural domain of the BAP42 that gives expression to and yeast merges, and (Fig. 1) of being expressed as free peptide also arranged. Employment tire brain cDNA Y2H library transforms this bacterial strain. In about 106 independent transformant, only have No. 14 clone to produce stable reporter gene activity, and contain the main opening code-reading frame continuous with the GAL4 functional areas. The cDNA Insert Fragment comprises 984 base-pairs, with one section poly-A ending. 201 amino acid of this section sequential coding (amino acid 68 to 269 among the SEQ ID NO:2) have the zone that sufficient length and hydrophobicity are passed through cell membrane comprising two. The glycosylation site that also has potential asparagine to connect. Clone 14 is named as clone pEK196, and preserving number is ATCC 98399.

Separate the library plasmid from cloning 14, be used for making up the Y2H test organisms. Inspection to these bacterial strains shows that although be weak response, BAP fusion specific effect is in clone's 14 albumen. Reply (Ozenberger, unexposed) because strong-hydrophobicity protein structure domain (for example cross-film district) suppresses Y2H, remove the strongest zone (the BBP Δ tm of hydrophobicity so 14 Insert Fragments are cloned in brachymemma; Relevant further instruction is referring to table 2 hereinafter), again test the interaction of itself and BAP. It is much strong with replying of Y2H to observe BBP Δ tm, and this has supported such saying, and potential cross-film (" tm ") anchor position in the sequential coding of namely being clipped. Clone 14 has defined a kind of BBP of new fusion form.

Clone 14 contained BBP cDNA sequences through identifying 5 ' end of disappearance protein-coding region, because there is not potential initial methionine codon. The multiple trial that the Application standard reverse transcriptase carries out conventional 5 ' RACE (the terminal rapid amplifying of cDNA) has only increased by 27 nucleotides. So, separate 5 ' end with embodiment 2 described a kind of genomic clone methods hereinafter.

Because 5 ' end of coded sequence is from genomic library, so may contain introne in this zone. Hereinafter two kinds of methods of embodiment 2 usefulness have detected this possibility. The result confirmed should the zone in and upstream sequence (all from genome and cDNA source) all do not have introne. Plasmid BBP-fl contains the cDNA Insert Fragment of coding total length BBP protein-coding region, and this plasmid is deposited in American type culture collection, and preserving number is 98617. SEQ ID NO:1 and 2 shown be complete code area and infer protein sequence. Original clone 14 (pEK196) contains 3 ' untranslated nucleotide sequence.

According to the present invention, the nucleotide sequence of coding BBP and fragment, fusion or functional equivalence thing can be used for producing recombinant DNA molecules, at suitable host cell inner expression BBP or functional activity peptide. Perhaps, the nucleotide sequence with some the part hybridization of BBP sequence can be used for nucleic acid hybridization test, Southern and the test of Northern trace etc.

The present invention also comprises the polynucleotide of sequence and polynucleotide sequence complementation described in the invention.

The present invention also comprises and can be more preferably under rigorous condition reducing under the rigor condition, preferably under the rigorous condition of height with the polynucleotide of polynucleotide hybridization of the present invention. The example of rigorous condition can see table: high rigorous condition is rigorous as condition example A to F at least; Rigorous condition is rigorous as condition example G to L at least; Low rigorous condition is then rigorous as condition example M to R at least.

Rigorous condition

Rigorous condition	The polynucleotide hybridization body	Crossbred length (bp) l	Hybridization temperature and buffer system H	Wash temperature and buffer solution are H
					A	DNA:DNA	$50	65EC; 1XSSC or 42EC; 1XSSC, 50% formamide	65EC，0.3XSSC
B	DNA:DNA	＜50	TB *；1XSSC	TB *；1XSSC
					C	DNA:RNA	$50	67EC; 1XSSC or 45EC; 1XSSC, 50% formamide	67EC，0.3XSSC
D	DNA:RNA	＜50	TD *；1XSSC	TD *；1XSSC
					E	RNA:RNA	$50	70EC; 1XSSC or 50EC; 1XSSC, 50% formamide	70EC，0.3XSSC
F	RNA:RNA	＜50	TF *；1XSSC	TF *；1XSSC
					G	DNA:DNA	$50	65EC; 1XSSC or 42EC; 1XSSC, 50% formamide	65EC，1XSSC
H	DNA:DNA	＜50	TH *；4XSSC	TH *；4XSSC
					I	DNA:RNA	$50	67EC; 4XSSC or 45EC; 4XSSC, 50% formamide	67EC，1XSSC
J	DNA:RNA	＜50	TJ *；4XSSC	TJ *；4XSSC
					K	RNA:RNA	$50	70EC; 4XSSC or 50EC; 4XSSC, 50% formamide	67EC，1XSSC
L	RNA:RNA	＜50	TL *；2XSSC	TL *；2XSSC

M	DNA:DNA	$50	50EC; 4XSSC or 40EC; 6XSSC, 50% formamide	50EC，2XSSC
					N	DNA:DNA	＜50	TN；6XSSC	TN *；6XSSC
O	DNA:RNA	$50	55EC; 4XSSC or 42EC; 6XSSC, 50% formamide	55EC，2XSSC
					P	DNA:RNA	＜50	TP *；6XSSC	TP *；6XSSC
Q	RNA:RNA	$50	60EC; 4XSSC or 45EC; 6XSSC, 50% formamide	60EC，2XSSC
					R	RNA:RNA	＜50	TR *；4XSSC	TR *；4XSSC

1: crossbred length is the estimation to the polynucleotide hybridization district that hybridization occurs. When the target polynucleotide hybridization of one section polynucleotide and one section unknown nucleotide sequence, crossbred length is assumed to be the length of hybridization d polynucleotide. When the polynucleotide hybridization of known array, can be by arranging polynucleotide sequence and crossbred length is determined in the complementary best zone of calibrating sequence.

H: ((1XSSC is 0.15M NaCl and 15mM natrium citricum) replaces the available SSC of the SSPE in hybridization buffer and the lavation buffer solution (1XSSPE is 0.15M NaCl, 10mM NaH2PO4 and 1.25mM EDTA, pH7.4); After hybridization is finished, washed 15 minutes.

^*TB-TR: estimated length should hang down 5 to 10EC less than the hybridization temperature of the crossbred of 50 base-pairs than the fusing point (Tm) of crossbred, Tm calculates according to following formula: for the crossbred that is less than 18 base-pairs: Tm (EC)=2 (A+T base number)+4 (G+C base number); For the crossbred of 18 to 49 base-pairs, Tm (EC)=81.5+16.6 (log10[Na+]+0.41 (G+C) %-(600/N), N is the base number of crossbred, and [Na+] is Na ion concentration ([Na+]=0.165M) of 1XSSC in the hybridization buffer.

Other example of the rigorous condition of polynucleotide hybridization can be referring to Sambrook, J., E.F.Fritsch and T. Maniatis, 1989, Molecular Cloning:A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, the 9th Zhanghe Chapter 11, and Current Protocols in Molecular Biology, the volumes such as 1995, F.M.Ausubel, John Wiley ﹠ Sons, Inc., the 2.10th and 6.3-6.4 joint, receive at this and to be reference.

Be preferably, these hybridization with the length of polynucleotide all be at least polynucleotide of the present invention to be hybridized 25% (at least 50% is better, at least 75% is best), and, be at least 60% (at least 75% is better, and at least 90% or 95% is best) with the sequence homogeny of polynucleotide of the present invention to be hybridized, the sequence homogeny is following mensuration: arrange the relatively sequence of hybrid polynucleotide, overlapping as far as possible and consistent during arrangement, reduce as far as possible the sequence gap simultaneously.

The expression of BBP

For recombinant production protein, can be with separation polynucleotide of the present invention and such as Nucleic Acids Res. such as Kaufman19, the pMT2 among the 4485-4490 (1991) or pED expression vector and so on expression regulation sequence operability connects. Known in the art have many suitable expression regulation sequences. The conventional method of expressing recombinant protein also is known, can be referring to R.Kaufman, and Methods in Enzymology185, the example among the 537-566 (1990). The polynucleotide that " operability connection " separates in this expression the present invention and expression regulation sequence are in identical carrier or cell, so that the polynucleotide/expression regulation sequence that is joined together transforms this albumen of host cell expression of (transfection).

The expression system of BBP

Many kinds of cells can be used as suitable host cell and express albumen of the present invention. Mammalian cell comprises for example monkey COS cell, Chinese hamster ovary (CHO) cell, people's kidney 293 cell, people A431 epithelial cell, people Colo205 cell, 3T3 cell, CV-1 cell, the Primate clone that other is converted, normal double somatocyte is from the cell line of culture outside the former generation organizer, former generation explant, the HeLa cell, mouse cell, BHK, HL-60, U937, HaK or Jurkat cell.

Perhaps, can be at rudimentary eukaryotic yeast for example, or for example produce protein in the bacterium at prokaryotic. May suitable yeast strain be saccharomyces cerevisiae, pombe fission yeast, kluyveromyces, candida albicans or any other saccharomycete that can expressing heterologous albumen. May suitable bacterium comprise Escherichia coli, bacillus subtilis, salmonella typhimurium or other any bacterium that can expressing heterologous albumen. If in yeast or bacterium, produce protein, in order to obtain to have the albumen of function, may be necessary to modify the albumen that wherein produces by phosphorylation or the glycosylation of for example appropriate site. This type of covalently bound can finishing with known chemical method or enzyme process.

Can also following production protein: separation polynucleotide of the present invention is connected with suitable regulating and controlling sequence operability in one or more insect expression vectors, and adopts insect expression system. The materials and methods of baculoviral/insect cell expression system can be with the form of kit available from for example Invitrogen, San Diego, California, USA (MaxBac7 kit), these class methods are well known in the art, referring to what receive as reference at thisSummers & Smith，Texas Agricultual Experiment Station Bulletin No.1555(1987) At this, the insect cell that can express polynucleotide of the present invention is exactly " being converted ".

Albumen of the present invention can be converted host cell by cultivation under the suitable condition of expressing recombinant protein and prepare. Then, can adopt known purification methods (for example gel filtration and the ion-exchange chromatography) albumen that purification Table is reached from culture (for example culture medium or cell extract). The purifying of albumen may also comprise the compatible column chromatography, comprises in the post and this protein bound material; Column chromatography on one step or the following affine resin of multistep: concanavalin A-agarose, the blue 3GA Sepharose7 of heparin-toyopearl7 or Cibacrom; One step or multistep are used the hydrophobic interaction chromatography of following resin: phenylate, butyl ether or propyl ether; Or immunoaffinity chromatography.

Perhaps, albumen of the present invention can be expressed as the form that helps purification process. For example, can be expressed as fusion, such as with maltose-binding protein (MBP), glutathione S-transferase (GST) or thioredoxin (TRX) etc. The kit of expression and these fusions of purifying can be available from New England Biolab (Beverly, MA), Pharmacia (Piscataway, NJ) and InVitrogen. Can also add epitope tag to albumen, then use the specific antibody for this epi-position to come purifying protein. One of this type of epi-position (" Flag ") can be bought to Kodak (New Haven, CT).

At last, an available step or multistep RPHPLC (RP-HPLC) step are further purified albumen, and used is hydrophobicity RP-HPLC medium, and for example side chain is the silica dioxide gel of methyl or other aliphatic group. For basic uniformly separating recombinant proteins is provided, can be used in combination several or whole in the above purification step with various forms. So the albumen behind the purifying there is no other mammalian proteins,, is " protein isolate " according to the present invention.

Albumen of the present invention can also be expressed as the transgenic animals product, one of milk component of transgenic dairy, goat, pig or sheep for example, and these animals are characterised in that its body cell or blastocyte contain the nucleotide sequence of this albumen of encoding.

Albumen of the present invention can also be produced by known conventional chemical synthesis method.It is well known by persons skilled in the art utilizing synthesis method to make up method of protein of the present invention.The protein sequence that synthesis method makes up because have identical protein one-level, secondary or tertiary structure and/or conformational characteristic, so may have identical with it biological nature, comprises protein active.So they can be used as the biological activity of natural, purifying protein or the immunization method that the immunity substitute is used for screening medicine and development antibody.

But albumen of the present invention also comprises the similar protein that contains the modification of spontaneous or the specific adding of genetically engineered to purifying protein of aminoacid sequence.For example, those skilled in the art can utilize known technology to come modified peptides or dna sequence dna.Significant modification comprises change, replacement, displacement, insertion or the disappearance of certain selected amino-acid residue in the encoding sequence in the protein sequence.Disappearance that for example can be by one or more halfcystines or changed the conformation of molecule by other amino-acid substitution.These changes, replacement, displacement, insertion or disappearance technology are those skilled in the art well-known (referring to USP No.4,518,584).Be preferably, above-mentioned change, replacement, displacement, insertion or disappearance have kept proteinic required activity.

Other fragment of protein sequence and derivative possibility retaining protein are active all or part of, so can be used for screening or other immunological method, with reference to content of the present invention, also are that those skilled in the art make easily.This class is modified and is considered to forgive within the present invention.

Yeast 2 cross experiments

Y2H tests demonstration, and BAP is specific with combining of BBP fusion rotein.BBP points out the BBP activity to have certain effect by tool in the pathology of Alzheimer's disease with combining of BAP.

Utilize base local arrangements research tool (BLAST; Altsehul etc., 1990) the BBP sequence is compared with Genbank.The sequence label that gives expression to BBP albumen and gained is arranged, and searches conservative fragments, and utilizes MoST (Tatusov etc., 1994) protein motif searching algorithm to estimate.More than analyze to have disclosed and exist the potential evolutionary relationship with g protein coupled receptor (GPCR) family.Specifically, more than analyze demonstration, BBP contains two potential film (tm) structural domains of striding, and is equivalent to the 3rd and the 4th membrane spaning domain of g protein coupled receptor.Interleave hydrophilic loop and contain evident characteristic 3 amino acid motifs: aspartate (D) or L-glutamic acid, after connect an arginine (R) and an aromatic residue (Y or F) (being commonly referred to as the DRY sequence), this is conservative in the nearly all member of this family, and the known triggering molecularity (Acharya﹠amp that plays the G protein-active; Karnik, 1996).

The data (seeing Fig. 2 to 4) that the Y2H test draws show that BBP has represented a kind of new protein, may have one and each member's identical functions module of g protein coupled receptor superfamily.As if specifically, BBP has kept the key DRF sequence of estimating between the tm structural domain at two (amino acid/11 99 to 201 among the SEQ ID NO:2), and may; The ability that connects the signal path that is subjected to the G protein regulation.

APP known on function relevant (Nishnoto etc., 1993 with G α o; Yamatsuji etc., 1996), and the structural motif that BBP has known be one section g activation sequences in the g protein coupled receptor of being correlated with.In addition, the hypothesis of being done based on the estimated position of BBPtm structural domain and orientation claims: in the protein and the zone that BAP acts on mutually on topological framework, may be confined to APP in the identical position of BAP.

Y2H test strain is carried out genetic engineering modified, be used for estimating combining of BBP intracellular region and g.Fusion rotein is reached in sequence table in the BBP born of the same parents that infer, and analyzes the interaction of itself and three kinds of g C-terminal.Table 2 has been listed used protein fragments in these tests.Ring all reacts (Fig. 3) with three kinds of gs in the BBP born of the same parents, and this has supported such hypothesis: BBP may play a part G protein-active conditioning agent.More than each Y2H test prompting, attractive this polyprotein mixture model constitutes by complete membranin BBP with the APP of heterotrimer G albumen coupling at least.

Table 2: the plasmid that uses in yeast 2 cross experiments

Expression plasmid	Protein	Fragment
				BAP
pEK162	(people)	1-42
			pEK240	(mouse)	1-42
	BBP
			pEK196	(clone 14)	68-269
pEK198	(Δtm)	68-202
			pEK219	(ΔC)	68-175
pEK216	(ΔN)	123-202
			pOZ339	(in the born of the same parents)	185-217
	Gα
			pOZ345	(Gαs)	235-394
pOZ346	(Gαo)	161-302
			pOZ348	(Gαi2)	213-355

Further analyze BBP with Y2H.Two lap amplifications of the BBP sequence that BBP Δ tm clone is contained also are cloned among the Y2H carrier pACT2 (expression plasmid pEK216 and pEK219 in the table 2 are corresponding to PROTEIN B BP Δ N and BBP Δ C (Fig. 4)).Two tm structural domains all lack in the Δ C-structure; 52 amino acid of first tm structural domain of Δ N structured coding and front.With the BAP fusion rotein these fusion roteins are tested, and it is replied and express big replying of the proteic bacterial strain of BBP Δ tm and compare.The protein induced weak Y2H of BBP Δ C replys that (C compares with carrier with the BBP Δ, Fig. 4), but contains replying only than a little less than the observed summary of usefulness BBP Δ tm (Fig. 4) that first tm structural domain and adjacent nearly amino sequence BBP Δ N produce.Above results suggest, cause with BAP bonded major decision base be contained in according to infer on topological framework with wild-type APP albumen in the similar BBP of BAP district.

Prove selectivity and the specificity of BBP with the Y2H system in conjunction with people BAP (BAP compares with mouse).Compare with the human sequence, have in the mouse BAP sequence 3 place's aminoacid replacement (G5R, F10Y, R13H).In the described Y2H test of embodiment 6, the mouse peptide shows as that neurotoxicity reduces and in conjunction with the forfeiture (Maggio etc., 1992) of people's brains ability.So estimating BAP in the Y2H system is significant with combining of BBP.The mutagenesis that utilizes oligonucleotide guiding through PCR with the mouse peptide of encoding of the people BAP sequence among the pEK162 instead.The plasmid pEK240 of gained is identical with the used people BAP fusion protein expression plasmid of this report except the aminoacid replacement of mouse peptide sequences takes place for three codons.Utilize the Y2H biological test to come the interaction of comparison BBP fusion rotein and mouse and people BAP fusion rotein.The bacterial strain of expressing BBP and mouse BAP can not produce growth and reply (Fig. 7).This discovery support hypothesis: BBP may be the specificity mediation person of BAP neurotoxicity effect, and the mechanism of explaining that mouse BAP neurotoxicity reduces is provided.Importantly, above data have also shown the interactional high degree of specificity of BBP/BAP in the Y2H test, because three amino acid whose replacements are enough to suppress fully keying action (Fig. 7).

Isolating BBP polypeptide

Protein of the present invention and protein fragments comprise length amino acid sequence be the proteinic length of this announcement at least 25% (at least 50% is better, at least 75% is best), and (at least 75% is better to be at least 60% with proteinic sequence homogeny in this announcement, at least 90% or 95% is best), the sequence homogeny determines by arranging the comparing amino acid sequence, and is overlapping as far as possible and consistent during arrangement, reduce the sequence gap as far as possible.The present invention also comprises following protein and protein fragments, it is (better more than 20 that the fragment that they comprise comprises more than 8 of disclosed any protein fragments, best more than 30) and the adjacent amino acid of sequence homogeny at least 75% (at least 85% is better, and at least 95% is best).

The present invention also provides polynucleotide and the proteinic ethnic homologue (specieshomologues) that is disclosed.Race's homologue refers to that at this source of species is different with given protein or polynucleotide, still have obvious sequence similarity protein or polynucleotide.Be preferably, (at least 75% homogeny is better for the sequence homogeny at least 60% of polynucleotide race's homologue and given polynucleotide, at least 90% homogeny is best), protein race's homologue and given proteinic sequence homogeny are at least 30%, and (at least 45% is better, at least 60% is best), the sequence homogeny is to determine by arranging relatively the nucleotide sequence and the proteinic aminoacid sequence of polynucleotide, obtain as far as possible during arrangement overlapping and consistent, reduce the sequence gap as far as possible.Can utilize in this sequence that provides to prepare suitable probe or primer, and the suitable nucleic acid source of screening separates and identifies ethnic homologue from required species.Be preferably from various Mammalss and separate the ethnic homologue that obtains.Best is that those separate from specific mammiferous ethnic homologue, these kinds are chimpanzee for example, gorilla, Pongo pygmaeus, gibbon, macaque, baboon, Papio hamadryas, the Africa macaque, capuchin monkey, Aotus trivirgatus, Sanguinus oedipus, stump-tailed macaque, the Taiwan house mouse, brown rat, hamster, tom, the weasel mouse, domesticated dog, rabbit, ox, Ovis aries, wild boar and wild horse, their gene mapping is known, thus can determine between the genomic organization mode of genes involved in the intragentic genomic organization mode of species and another species relation (O ' Brien ﹠amp; Seuanez, 1988, Ann.Rev.Genet.22:323-351; O ' Brien etc., 1993, Nature Genetics 3:103-112; Johansson etc., 1995, Genomics25:682-690; Lyons etc., 1997, Nature Genetics 15:47-56; O ' Brien etc., 1997, Trendsin Genetics 13 (10): 393-399; Carver ﹠amp; Stubbs, 1997, Genome Research 7:1123-1137; Above document is all received at this and is reference.)

The present invention also comprise the polynucleotide that discloses or proteinic allelic variation body; That is, other form of naturally occurring separation polynucleotide, their coded protein with in coded identical of the polynucleotide of this announcement or have the obvious sequence similarity.Be preferably, allelic variant is at least 60% (at least 75% for good, and at least 90% is best) with the sequence homogeny that provides polynucleotide, and the sequence homogeny is that the arrangement by Nucleotide relatively comes to determine, overlapping as far as possible and consistent during arrangement, reduce the sequence gap simultaneously as far as possible.Can following separation and identify allelic variant: prepare suitable probe or primer according to the sequence that provides at this, the suitable nucleic acid source of screening from the individuality of corresponding species.

The present invention also comprise sequence with at the polynucleotide sequence complementary polynucleotide of this announcement.

Use

BBP albumen of the present invention can be used for various uses, and these purposes are that those skilled in the art can conventionally realize according to this paper content.Specifically, BBP can be used as the immunogen that produces antibody, and this antibody has specificity to clone's polypeptide.Can adopt the whole bag of tricks known in the art to produce the proteic antibody of anti-BBP.These antibody include, but are not limited to, polyclone, mono-clonal, chimeric, strand, Fab fragment and Fab expression library.For producing antibody, inject various host animals (including, but not limited to rabbit, mouse and rat) with BBP.In an example, with the fragment and the immunogenic carrier coupling of this polypeptide or this polypeptide that can specific immune response.Also can give adjuvant and polypeptides in combination, to improve the immunne response of host animal.The example of adoptable adjuvant comprises, but be not limited to complete and incomplete Freund's adjuvant, mineral rubber such as aluminium hydroxide, surfactant such as lysolecithin, compound poly alcohol, polyanion, peptide, oil-emulsion, keyhole limpet hemocyanin and dinitrophenol(DNP).

The proteic monoclonal antibody of anti-BBP of the present invention can make with cultivate any technology that produces antibody by continuous cell line.These technology are well-known to those skilled in the art, including, but not limited to, Kohler and Milstein are at first at Nature 1975,256, the hybridoma technology of describing among the 4202-497, the human B cell hybridoma technology that people such as Kosbor describe in Immunology Today 1983,4,72, and people such as Cole is at Monoclonal Antibodies and Cancer Therapy, Alan R.Liss, Inc., the EBV-hybridoma technology of describing in the 77-96 page or leaf.

Then, available existence and ubcellular distribution of screening similar polypeptide in the biological sample with the immunoreactive antibody of polypeptide of the present invention.In addition, for the proteic monoclonal antibody specific useful as therapeutics of BBP of the present invention.

The antigen that BBP albumen also can be used as in the solid phase test is measured the existence that plays immunoreactive antibody with described peptide.The immunity amount of clone 14-related antigen in the biological sample is measured in available solid phase competitive trials.This mensuration not only can be used to promote intactly to identify the cell function of polypeptide of the present invention, but also can be used to determine to have these proteic patients of abnormal amount.

BBP albumen of the present invention also can be used as the capture agent in the affinity chromatography, detects BAP and BAP aggregation as the AD mark.

In addition, these BBP can be used as the candidate molecules that the reagent in the test is determined to influence BAP and cloned protein-interacting.Specificity is sealed this bonded compound and be can be used to treatment or prevention AD.

These BBP also can be used for acellular external in conjunction with test, and this test is to measure the bonded change situation of compound to these beta amyloid peptide associated protein and BAP or BAP aggregation.Cell free assay is highly suitable for screening the compound of proper amt, because these tests are than tangible also easier the carrying out of the testing expenses of adopting viable cell.After disclosing polypeptide of the present invention, the development of these tests is conventional to those skilled in the art.In these trials, BBP or BAP are marked.These marks include, but are not limited to, radio-labeling, antibody and fluorescence or ultraviolet mark.At first measure combining of BBP and BAP or BAP aggregation in the presence of not in any test compounds.Then compound to be tested is added in the test to determine whether these compounds have changed this interaction.

Embodiment

The present invention is further described with reference to the following example.Embodiment just describes the present invention by the reference specific examples.Although these examples have been described some concrete aspect of the present invention, boundary is not described or limits scope of the present invention.

Yeast two-hybrid system (then claim " Y2H "): structure Y2H expression plasmid in carrier pAS2 and pACT2 people such as (, 1993) WadeHarper and pCUP (at Ozenberger and Young, 1995 in describe to some extent).Yeast strain CY770 (Ozenberger and Young, 1995) is as the host of all Y2H tests.

Genescreen: with polymerase chain reaction (PCR) amplification and modification BAP encoding sequence.With the people APP of pCLL621-modification clone (people such as Jacobsen, 1994) as template, BAP increases with oligonucleotide #1 (5 '-CCATG GAT GCA GAA TTC CGA C) and #3 (5 '-AAGCTTGTCGAC TTA CGCTATGAC AAC ACC GC), use pCLL621, a kind of people APP clone (Jacobsen etc. 1994) of modified makes template.The DNA of amplification comprises codon 389 to 430 (the coding BAP of the APP precursor protein with following modification ₄₂).The sense strand primer has added 5 ' NcoI restriction site in the translation frame identical with the NcoI site in pAS2.The antisense strand primer has added terminator codon and HindIII and SalI site so that the clone.With this amplified production be connected to the TA cloning system (Invitrogen Corp., Carlsbad, CA) in, remove by NcoI and SalI digestion subsequently.With this fragment cloning in the pAS2 of NcoI and SalI cutting.Dna sequencing whole GAL4/BAP joint, confirm gained plasmid pEK162.PEK162 expressed proteins (BAP ^BDFig. 1) comprised a fusion rotein, this fusion rotein contains the yeast transcription activating protein Gal4 DNA binding domains of (lacking functional activation sequence), and carboxyl terminal has also added 42 amino acid of BAP.Develop a kind of expression plasmid and mediated unmodified BAP ₄₂Expression.With the oligonucleotide #3 pairing among oligonucleotide #2 (5 '-AAGCTTAAG ATG GAT GCA GAA TTC CGA C) and the above-mentioned PCR.The translation initiation signal that this amplified production contains 5 ' HindIII site and is adapted at expressing in the S. cervisiae most.Once more dna fragmentation is cloned in the TA system.Separating on the HindIII fragment and be cloned in the pCUP of HindIII cutting then.Confirm gained plasmid pEK149 (BAP with dna sequencing; The orientation of BAP gene Fig. 1).BAP expression plasmid pEK149 (with URA3 as selective marker) and pEK162 (with TRP1 as selective marker) are transformed among the yeast host CY770 (Ozenberger and Young, 1995).The bacterial strain called after CY2091 that contains two kinds of plasmids.Yeast 2-hybridization expression vector pACT2 (using LEU2 as selective marker) is available from Clontech Laboratories, and (Palo Alto CA), is cloned into the plasmid library that separates the cDNA fragment composition that obtains from people's tire brain to Inc. in this carrier.Library deutero-albumen is shown as the Unkown among Fig. 1 ^ADTransform CY2091 with this library.Sample is deployed on complete (SC) yeast growth substratum of synthetic, and this substratum lacks uridylic, tryptophane and leucine, so that select to contain the cell of all three kinds of plasmids.This substratum also lacks Histidine, and contains 3-amino-triazole that concentration is 25mM (inhibitor of yeast HIS3 gene product).Reduce the activity of the low-level constitutive expression of HIS3 reporter gene with 3-amino-triazole.Cultivated dull and stereotyped 12 days for 30 ℃.Separate and obtain 24 bacterium colonies that show the increase of Histidine prototroph.Transform contrast and shown this screening assay 10 ⁶Individual independent clone.Content with PCR method rapid test positive colony.From each positive strain, isolate total RNA with standard method.With the template of this material as PCR, the oligonucleotide #4 in the clone district of PCR employing side joint carrier library pACT2 (5 '-TTTAATACCACTACAATGGA T) and #5 (5 '-TTTTCAGTAT CTACGATTCA T).Dna fragmentation is connected in the TA system and with dna sequencing checks.By shuttling back and forth in intestinal bacteria, isolate the library plasmid that contains among the clone #14 (as mentioned above).Measure human cDNA sequence's nucleotide sequence, confirm the sequence of initial p CR product.

Biological test: grow overnight to density is about 7 * 10 in 2 milliliters of SC substratum of leucine and tryptophane lacking to make bacterial strain ⁷Individual cells/ml.Counting cells, with sterilized water from 10 ⁸Individual cells/ml to 10 ⁴Individual cells/ml is done 10 times of serial dilutions.5 μ l equal portions of these samples are dropped on the SC substratum of the shortage leucine, tryptophane and the Histidine that contain 25mM 3-amino-triazole.Cultivated dull and stereotyped 2 to 3 days for 30 ℃.The contrast strain of the increase by prototroph growth (with expressing Gal4 DNA integrated structure domain fusion protein and uncorrelated transcriptional activation domain fusion rotein (or contain the pACT carrier simply and do not contain insertion sequence)) is compared) determined male albumen/protein-interacting.These control strains are represented with mark " carrier " in above-mentioned accompanying drawing.The circulation ratio height of this test method, and proof can detect the trickle growth inducing effect that specificity interacts and mediates between the target protein that is subjected to.Initial BBP clone called after pEK196 also saves as ATCC 98399 (it is referred to herein as clone 14), comes the truncated protein product to express BBP Δ tm with it as pcr template.Make the GAL4 sequence annealing among adopted primer #6 (5 '-TTTAATACCA CTACAATGGA T) and the pACT2.Antisense primer #7 (5 '-CTCGAG TTA AAA TCG ATC TGC TCC CAA CC) adds 3 ' terminator codon and XhoI site at 3 ' end of the sequence of the DRF motif of coding BBP.The PCR product is connected in the TA cloning vector, subsequently with EcoRI and XhoI digestion and be cloned among the pACT2.The hybridization product called after BBP Δ tm that this plasmid (pEK198) is expressed.Equally, make primer #7 and primer #8 (5 '-GAATT CCA AAA ATAAAT GAC GCT ACG) pairing, with engineered BBP Δ N expression plasmid pEK216.Once more the PCR product is connected in the TA system, will be connected in the pACT2 of same enzyme digestion through the gained plasmid that contains BBP fragment (codon 123-202) of EcoRI and XhoI digestion at last.BBP Δ C makes with pACT-2 specific oligonucleotide #6 and antisense oligonucleotide #9 (5 '-CTCGAG TCA AGA TAT GGG CTT GAAAAA AC).Behind the TA clone, separate the EcoRI-XhoI fragment, and be cloned among the pACT2, gained plasmid pEK219 expresses the residue 68-175 of BBP.Sequence with ring in oligonucleotide #10 (5 '-CCTTCC ATG GAAGTG GCA GTC GCA TTG TCT) and #11 (5 '-AACACTCGAG TCA AAA CCC TACAGT GCA AAA C) the amplification coding BBP born of the same parents.Contain this product of BBP codon 185-217 with NcoI and XhoI digestion, and be cloned in the pAS2 of NcoI+SalI cutting, produce pOZ339.The structure of all g expression plasmids utilizes BamHI site near each rat cdna sequence people such as (, 1990) Kang center as the position of fusion among the pACT2.5 ' terminal sequence annealing in adopted primer and BamHI site is arranged; 3 ' terminal sequence annealing of antisense primer and terminator codon, and comprise a SalI restriction site.Primer is: G α 0, have justice (#17)=5 '-GTGGATCCAC TGCTTCGAGG AT, antisense (#18)=5 '-GTCGACGGTT GCTATACAGG ACAAGAGG; Gas, have justice (#19)=5 '-GTGGATCCAG TGCTTCAATG AT, antisense (#20)=5 '-GTCGACTAAATTTGGGCGTT CCCTTCTT; Gai2, have justice (#21)=5 '-GTGGATCCAC TGCTTTGAGGGT, antisense (#22)=5 '-GTCGACGGTC TTCTTGCCCC CATCTTCC.With the PCR product cloning in the TA carrier.Isolate G α sequence (BamHI-SalI fragment) and be cloned in the pACT2 of BamHI+SalI digestion.See Table 2 plasmid digestion.At last, synthetic oligonucleotide #23 is so that change into the mouse sequence with people BAP.The sequence of this primer is 5 '-ATATGGCCATG GAT GCA GAA TTC GGA CATGAC TCA GGA T TT GAA GTT C GT.Triplet is represented preceding 13 codons of BAP; Being used for changing three Nucleotide that produce the mouse sequence represents with underscore.With among the PCR of pEK162 as template, make oligonucleotide #23 and oligonucleotide #24 (5 '-TGACCTACAG GAAAGAGTTA) (its with the Y2H carrier in 3 ' end regions of cloning site anneal) match.Product cuts and is connected to NcoI+SalI and produces pEK240 among the pAS2.Confirm the nucleotide sequence of the sections of coding mouse BAP.

Genomic clone; RACE (rapid amplifying of cDNA end): use corresponding to the EcoRI/ClaL fragment probe screening of the guiding at random of Nucleotide 187-600 corresponding to ^a2.0 * 10 ⁶The people's gene group λ library (Stratagene) of pfu (Fig. 2).With ^T7The QuickPrimer test kit according to manufacturer's specification sheets with [ ³²P]-the CTP label probe.Filter membrane is hybridized under the height preciseness: 40 ℃, at 50% methane amide, 0.12M NaHPO ₄, 0.25MNaCl, 7%SDS and 25mg/ml supersound process salmon sperm DNA in, and 65 ℃, clean with the 0.1 * SSC that contains 0.1% sodium lauryl sulphate, and exposure is in Kodak BioMax MS film.With progressively paving plate and screening again the lambda particles phage clone with probe hybridization is carried out plaque purification.Purifying 10 positive colonies, and with the hybridization of the oligonucleotide probe (this probe is cloned known most of 5 ' sequence at original cDNA) of 45 Nucleotide to do further analysis.This oligonucleotide is the reverse complement (Fig. 2) of Nucleotide 157-201, sequence is 5 '-CCAGGCGGCC GCCATCTTGG AGACCGACAC TTTCTCGCCA CTTCC.Separate lambda bacteriophage dna with standard molecular biological technique, and be used on ABI 373 sequenators with the two deoxidation cycle sequencings of fluorescence and check order.

RACE: carry out DNA first chain with rTth heat-stabilised poly synthase systems (Perkin Elmer) and synthesize.In following reagent mix to 1.5 milliliter test tube, produce 10 microlitre volumes: 1X reverse transcription damping fluid, 1mMMnCl ₂, the poly-A of 1.6mM dNTP mixture, 2.5U rTth polysaccharase, 100ng people hippocampus ⁺RNA (Clontech), 10mM oligonucleotide (Nucleotide 429-452, Fig. 2; 5 '-GTTATGTTGGGTGCTGGAAA ACAG).Reactant places on ice immediately in 70 ℃ of cultivations 15 minutes.Produce cDNA second chain with Marathon cDNA synthetic agent box (Clontech).Whole 10 μ l and following reagent mix: the 1X second chain damping fluid, 0.8mM dNTP mixture, the 4X second chain mixture (e. coli dna polymerase I, e. coli dna ligase, e. coli rna enzyme H) and dH with the first chain reaction thing ₂It is 80 μ l that O adds to volume.Test tube adds T4 archaeal dna polymerase (10U) subsequently in 16 ℃ of cultivations 1.5 hours, cultivates 45 minutes for 16 ℃ again.For termination reaction, in reaction mixture, add 4 μ l 20XEDTA/ glycogen (0.2M EDTA/2mg/ml glycogen), carry out phenol/chloroform/primary isoamyl alcohol extracting then, remove enzyme and other impurity.Add 0.1X volume 3M sodium-acetate (pH5.2) and 2.5X volume reagent grade ethanol, and place DNA is precipitated.With 70 ℃ of washing with alcohol DNA once, dry and be resuspended in 10 μ l dH ₂Among the O.Half DNA is used for the Marathon adapter and connects, to be used for RACE PCR reaction subsequently, this reaction is carried out according to following Clontech method: connect adding 5 μ l cDNA in damping fluid and 1 μ l (1U) the T4 dna ligase at 2 μ l (10mM) Marathon (5 '-CTAATACGACTCACTATAGG GCTCGAGCGG CCGCCCGGGC AGGT), 1XDNA.16 ℃ of cultivation reaction mixtures spend the night.For initial RACE reaction, 1: 50 diluted mixture thing, and and following material be mixed together in the 0.2ml PCR test tube: 40 μ l dH ₂O, 1 μ l 10X Klentaq archaeal dna polymerase (Clontech), l μ l (10mM) AP1 primer (5 '-CCATCCTAAT ACGACTCACT ATAGGGC), 1 μ l (10mM) BBP-Auele Specific Primer are (corresponding to Nucleotide 187-209, Fig. 2; 5 '-CCAGACGGCCAGGCGGCCGCC AT), the cDNA of the dilution of 5 μ l 10XKlentaq polymerase buffers, 1 μ l 10mM dNTP mixture, the above-mentioned reaction of 1 μ l.Implement following cycling condition with Perking Elmer GeneAmp PCR system 2400 thermal cyclers: 94 ℃ of sex change 1 minute, 94 ℃ 30 then ", 72 ℃ 3 ' carry out 5 to take turns; 94 ℃ 30 ", 70 ℃ 3 ' carry out 5 to take turns 94 ℃ 30 then "; 68 ℃ 3 ' carry out 25 to take turns, last 72 ℃ extend 7 '.The following then nested PCR that carries out reacts: 40 μ ldH ₂O, 1 μ l (1U) 10X AmplitaqGold archaeal dna polymerase (Perkin Elmer), 1 μ l (10mM) AP2 primer (5 '-ACTCACTATA GGGCTCGAGC GGC), 1 μ l (10mM) BBP-1 Auele Specific Primer is (corresponding to Nucleotide 172-194, Fig. 2; 5 '-GCCGCCATCT TGGAGACCGA CAC), 5 μ l 10XAmplitaq polymerase buffers, 1 μ l 10mM dNTP mixture, the preliminary RACE product of 1 μ l.The PCR cycling condition is: initial 94 ℃ of sex change 9 ', 94 ℃ 30 ", 68 ℃ 30 ", 72 ℃ 2 ' carry out 25 to take turns, then 72 ℃ extend 7 '.The PCR product is leakage of electricity swimming on 1% agarose in the 1XTBE damping fluid.Gel-purified obtains 350 base pair products, and clones directly clone of test kit (Invitrogen) with TA.To connect mixture is transformed in the OneShot cell (Invitrogen) and places on LB-penbritin (the 100 μ g/ml) agar plate that contains X-gal.Obtain DNA micropreparation thing, on ABI 373 sequenators, measure with the two deoxidation cycle sequencings of fluorescence.

Northern analyzes.(Palo Alto CA) obtains a plurality of tissues of people and a plurality of cerebral tissue mRNA Northern trace from Clontech.Isolate the BBP sequence on pEK196 deutero-TA clone's EcoRI fragment, this sequence meets the boundary from the primary fusion and extends to poly-A district.Beta-actin DNA is provided by the manufacturer.Mix with bootstrap technique at random ³²(Pharmacia Biotech, Piscataway NJ), produce radiolabeled probe from these DNA to P-dCTP.According to manufacturer (Clontech) specification sheets, in Express Hyb solution, hybridize under 68 ℃.At room temperature, wash trace with 2XSSC (1XSSC is a 0.15M sodium-chlor, the 0.015M Trisodium Citrate), 0.05%SDS, then under 50 ℃ in 0.1 * SSC, 0.1%SDS washed twice.Exposure Kodak BioMax film develops hybridization signal.

In situ hybridization.Prepare riboprobe synthetic dna profiling with the plasmid clone that contains total length people BBPcDNA as PCR.Adopt the single riboprobe of 3 ' UTR of target cDNA.Contrast GenBank database is verified probe sequence, only discerns suitable target in all sequences of preservation to guarantee them.In order to produce the riboprobe that is used for BBP, design a pair of Oligonucleolide primers and increase and add the promoter sequence of T7 (justice is arranged) and T3 (antisense) polysaccharase from the 275 base pair zones of 3 ' UTR of BBP cDNA.These primers contain following sequence: 5 '-TAATACGACT CACTATAGGG TTAGAAGAAACAGATTTGAG (forward); 5 '-ATTAACCCTC ACTAAAGGGA CAAGTGGCAACTTGCCTTTG (oppositely).Gel-purified PCR product on 1.5% low melting-point agarose gel downcuts the band that contains product, carries out phenol and phenol-chloroform extracting and ethanol sedimentation.Drying precipitated and be resuspended in the 1XTE damping fluid (10mM Tris-HCl, 1mM EDTA, pH7.4) in.APP riboprobe template is formed (described in people such as Jacobsen (1991)) by the DdeI-XhoI fragment from protein-coding region.The 50ng dna profiling is used for responsive transcription, the reaction employing ( ³⁵S)-(New England Nuclear, Boston is MA) with Riboprobe Gemini for CTP ^TMSystem (Promega, Madison, WI).

(Rhodes, 1996) carry out in situ hybridization histological chemistry with people hippocampus section after death as previously mentioned.On the Hacker-Brights freezing-microtome, do 10 μ m section, and the coating that places of the section that will thaw Vectabond reagent (Vector Labs, Burlingame is on refrigeration CA) (20 ℃) slide.All solution are with dH ₂The O preparation is handled and autoclaving with 0.1% (v/v) diethyl coke hydrochlorate.Section is immersed in 4% Paraformaldehyde 96 that PBS (pH7.4) joins, is immersed in 2XSSC, dH then successively ₂Fix in O and the 0.1M trolamine (pH8.0).Section is immersed in the 0.1M trolamine that contains 0.25% (v/v) diacetyl oxide then and carries out acetylize, clean at 0.2XSSC again, in 50,70 and 90% ethanol, dewater, and dry rapidly.1 milliliter of prehybridization solution is pipetted on each slide, prehybridization solution contains 0.9M NaCl, 1mM EDTA, 5X Denhardt ' s reagent, the smart DNA (GIBCO/BRL of 0.25mg/ml strand Pacific herring, Gaithersberg, MD), 50% deionized formamide (EM Sciences, Gibbstown, NJ) (with 10mM Tris, pH7.6 joins), make slide in moistening tank 50 ℃ cultivated 3 hours.Section is immersed in 50,70 and 90% ethanol then and makes its dehydration, and dry air.Riboprobe to the final concn that adds mark in hybridization solution is 50,000cpm/ μ l, this hybridization solution contains 0.9M NaCl, 1mM EDTA, 1XDenhardt ' s reagent, 0.1mg/ml yeast tRNA, 0.1mg/ml strand salmon sperm DNA, dextran sulfate (10%), 0.08%BSA, 10mM DTT (Boehringer Mannheim, Indianapolis, IN) and 50% deionized formamide (with 10mM Tris, pH7.6 joins).Make probe in 95 ℃ of sex change 1 minute then, placed 5 minutes on ice, being pipetted into cuts into slices upward and it is hybridized under 55 ℃ in moistening tank spends the night.Make subsequently section in the 2 * SSC that contains 10mM DTT 37 ℃ cleaned 1 time 45 minutes, in 37 ℃ of 1XSSC that contain 50% methane amide, cleaned 1 time 30 minutes then, in 37 ℃ of 2XSSC, cleaned 1 time 30 minutes.The riboprobe of strand and non-specific hybridization contains ox pancreas RNA enzyme A (Boehringer Mannheim by being immersed in; 40mg/ml), digest among the 10mM Tris (pH8.0) of 0.5MNaCl and 1mM EDTA.Make section in 2XSSC 60 ℃ washed 1 hour, then in the 0.1XSSC that contains 0.5% (w/v) Sulfothiorine 60 ℃ washed 2 hours.Section is dewatered in containing 50,70 and 90% ethanol of 0.3M ammonium acetate, and dry.Slide is packed in the X ray box, be exposed to Hyperfilm b-Max (Amersham) 14-30 days down.In case obtained gratifying exposure, just with nuclear track emulsion (NTB-2; Kodak) apply slide and 4 ℃ and expose 7-21 days down.According to manufacturer's specification sheets, make the emulsion radioautograph and develop and print, with phenodin to the lower-hierarchy section statining.In order to estimate nonspecific mark, from Riboprobe Gemini ^TMThe template that provides in system's test kit (Promega) produces the contrast probe.Make this carrier linearizing with ScaI, and transcribe with the T3 polysaccharase.Due to responsive transcription produce two products, the riboprobe of one 250 base and one 1525 base only contains the carrier sequence.As mentioned above this contrast probe mixture is marked, and join in the hybridization solution to ultimate density be 50,000cpm/ μ l.Do not observe specific hybridization in the contrast section, i.e. these sections provide the hybridization signal of very weak homogeneous, and this signal is not according to neuroanatomy boundary mark (data not shown).

Embodiment 1: The clone of BAP conjugated protein (BBP) with separate

Developed yeast two-hybrid (Y2H) genescreen method and identified BAP with the people ₄₂(42 amino acid whose proteolytic fragments of APP, being considered to may be to have more toxic BAP aggregated forms) interacting proteins.BAP ₄₂With yeast Gal4 DNA-binding domains amalgamation and expression, also express (Fig. 1) as free peptide.Personnel selection tire brain cDNA Y2H library transforms this bacterial strain.From about 10 ⁶There is a clone (above the called after clone 14) to produce consistent all the time reporter gene activity in the individual independent transformant, and contains and the consecutive important opening code-reading frame of GAL4 structural domain.The cDNA inset comprises 984 base pairs, ends at poly-A sequence.201 amino acid of this sequence encoding (SEQ ID NO:2; Amino-acid residue 68-269), its two zones that have have enough length and hydrophobicity to cross over cytolemma.

Isolate deutero-plasmid from the library from cloning 14, and be used for rebuilding Y2H test strain.Detect these strains confirmations, the BAP fusion rotein interacts with clone's 14 protein-specifics, although should react very weak.Because the strong protein structure domain (as striding the film district) of hydrophobicity has suppressed Y2H reaction (Ozenberger, undocumented data), brachymemma is cloned 14 insets (back claims BBP Δ tm) and is removed the strongest zone of hydrophobicity, the interaction of test and BAP again.Observing with BBP Δ tm has much better than Y2H reaction (Fig. 2), and this has supported following opinion, i.e. Que Shi sequence encoding potential stride film (tm) anchor position.Search clone 14 nucleotide sequence in GenBank; It seems that the BAP of Que Dinging conjugated protein (BBP) be new like this.

Embodiment 2: The separation and the affirmation of BBP5 ' end

Contained BBP cDNA sequence lacks 5 of encoding histone zone ' end among the foregoing description 1 described clone 14, because there is not potential initiator codon methionine(Met) to exist.Carry out conventional 5 ' end RACE (rapid amplifying of cDNA end) with the reversed transcriptive enzyme of standard and repeatedly attempt only having added 27 Nucleotide.These sequences comprise an ATG, but in same translation frame, do not have the upstream terminator codon to believe that this is an initiator codon.Promotor gene group cloning process separates 5 ' end of BBP gene.

The probe hybridization that people's gene group λ library and 400 base pairs (bp) corresponding to clone's 5 ' sequence of 14 are guided at random, thus identify 10 positive colonies.Use corresponding to 45 nucleotide base probes of clone's 14 upstream BBP sequences 5 ' upstream sequence of 400 base pair probes (and corresponding to) these clones are made further specificity analysis, having disclosed among 10 clones has 6 to comprise 5 contained ' terminal sequence in the sequence of determining the front.After measured, on behalf of other exon, these exons, other 4 λ clone be included in the cDNA deutero-probe that 400 base pairs originally guide at random (data not shown).The lambda bacteriophage dna of cloning corresponding to the representativeness of BBP 5 ' end is carried out direct cycle sequencing, and the result has disclosed the upstream to be had ^a500 Nucleotide and overlapping with clone 14 known array.62 additional amino acid in upstream that this additional sequence may be in there is a frame (arrival) front has been encoded and has been positioned at the MET that understands fully characteristic before the MET of terminator codon.Although in the MET downstream of upstream farthest two MET residues are arranged, according to standard normal, we suppose that temporarily the amino terminal sequence of people BBP gene has comprised that there is first 5 ' MET of terminator codon in the frame the back.Whole coding region and the protein sequence of deriving are presented in SEQ ID NO:1 and 2.The plasmid (called after BBP-fl) that contains this aminoacid sequence has been deposited in the American type culture collection, and preserving number is 98617.

Because 5 ' encoding sequence obtains from genomic library, so intron might be contained in this zone.Study this possibility with two kinds of methods.At first, use sequence at the forward primer in 5 ' MET district and amplification brain cDNA of the reverse primer in original clone 14 and genomic dna.The product size of two sample generations is identical, and showing in this zone does not have intron, and confirms that upstream sequence links to each other with original series.The second, isolated cDNA sequence is identical with the sequence that obtains from genomic clone in improved 5 ' RACE test (material that sees above and method).These discoveries have been confirmed upstream sequence (from genome and cDNA source) and should have been lacked intron in the zone.

Embodiment 3: The specificity analysis of BBP

With base local arrangements contrast research tool (BLAST; People such as Altschul, 1990) BBP sequence and Genbank are compared.Identify the sequence mark of two Caenorhabditis elegans and a Drosophilamelanogaster genome sequence and a large amount of people, mouse and the expression of other Mammals.Yet, do not obtain cDNA sequence completely, do not obtain the functional data that gene is given yet.The translation product of the expressed sequence mark of BBP albumen and acquisition is carried out the sequence contrast, search conservative property sections, and with MoST (protein motif searching algorithm) people such as (, 1994) Tatusov evaluation.These analyses disclosed and the receptor family of G albumen coupling between potential evolutionary relationship.Specifically, these analysis revealeds BBP contains two potential and strides film (tm) structural domain, and the tm structural domain 3 and 4 of these two structural domains and g protein coupled receptor is suitable.Intermediary wetting ability ring contains characteristic clearly triamino acidic group preface-aspartic acid (D) or L-glutamic acid, be arginine (R) and aromatic residue (Y or F) (being commonly referred to the DRY sequence) thereafter, this guards in nearly all member of this receptor family, and shown it is that G albumen activated molecule triggers thing (Acharya and Karnik, 1996).These data show that BBP has represented a kind of new albumen, and it may contain the functional module that the g protein coupled receptor superfamily member is had jointly.Specifically, BBP it seems and kept crucial DRF sequence between two prediction tm structural domains, therefore may have and the channel attached potentiality of G albumen conditioning signal.

The structural analysis of BBP shows that it contains a structural motif, and known this motif is the g activation sequence in the g protein coupled receptor of being correlated with.The Y2H evidence interaction between the different members of BBBP and g protein coupled receptor, in Fig. 3, describe to some extent.According to structure prediction, BBP is described as transmembrane twice, and two end is indoor in the alveolus.Can not discharge other orientation fully.In the Y2H test, studied above-mentioned potential protein-interacting.Two laps of the BBP sequence that amplification BBP Δ tm clone contains, and be cloned among the Y2H carrier pACT2 (corresponding proteins matter BBP Δ N and BBP Δ C among the expression plasmid pEK216 in the table 2 and pEK219 and Fig. 4).Δ C construction lacks two tm structural domains; Δ N construction first tm structural domain of encoding adds 52 amino acid of front.These fusion roteins are measured with the BAP fusion rotein, and its reaction and the reaction of bigger BBP Δ tm protein expression strain are made comparisons.These results suggest, the major decision related with BAP bunch are included in the BBP district, estimate similar to the BAP in the wild-type app protein on topology.

Embodiment 4: The tissue distribution that people BBP expresses

When describing gene and its lytic activity thereof, the first step is to estimate the expression of BBP mRNA.Observe the main transcript (Fig. 5 A) of 1.25kb in a organized way.Expression level in heart is very high.The expression that full brain shows medium level.The sample that obtains from the brain district that separates all demonstrates BBP and expresses (Fig. 5 B).Interesting is that fringe region contains the BBP mRNA of relatively large amount.These are to produce BAP at first to assemble and the toxic brain of related neural zone.The in situ hybridization radioautographic analysis result who obtains with BBP-1 specific ribonucleic acid probe shows, in people hippocampus and retina in (entorhinal) cortex, BBP mRNA expresses to big cell medium, phraseology conforms to opposite with the colloid neurocyte (Fig. 6) with expression in neurone.And BBP mRNA expresses in nearly all hippocampus and retinochrome neurone, does not promptly present any true or stratified difference on hybridization signal intensity.Interesting is, the phraseology of BBP is to use the viewed mode of riboprobe (Fig. 6) at the mRNA of amyloid precursor protein APP to have surprising similar.In a word, all observe BBP mRNA in a organized way with in all brain zones in the institute that checks.The original position analysis that BBP mRNA expresses has also disclosed hippocampus expression widely.

Embodiment 5: The clone that BBP expresses distributes

Also studied the expression of BBP in various kinds of cell system, data obtain from dbEST (the biotechnology infonation center expressed sequence mark council).Come the BBP mRNA of quantitative evaluation in clone that is usually used in expression of recombinant proteins and various cancerous cell line to express with RT-polymerase chain reaction (RT-PCR) method.In hamster CHO and people HEK293 cell, observe BBP.In embryonic stem cell line Ntera-2 and neuroblastoma clone IMR32 and SK-N-SH, observe signal.Observing BBP in having represented following tissue-derived cancerous cell line expresses: colon (Cx-1, Colo205, MIP101, SW948, CaCo, SW620, LS174T), ovary (A2780S, A2780DDP), breast (MCF-7, SKBr-3, T47-D, B7474), lung (Lx-1, A5439), melanoma (Lox, Skmel30), leukemia (HL60, CEM), prostate gland (LNCAP, Dul45, PC-3).From following cancerous cell line, isolate the mRNA that the Northern trace is surveyed, confirm that the BBP expression is present in all samples: promyelocytic leukemia (HL-60), cancer (HeLa S3), chronic myelocytic leukemia (K-562), lymphoblastic leukemia (MOLT-4), Burkitt ' s lymphoma (Raji), colorectum gland cancer (SW480), lung cancer (A549) and melanoma (G361).

Embodiment 6:BBP and people's selectivity interacts

BAP is to rodents BAP

Muroid BAP sequence has been compared three aminoacid replacement (G5R, F10Y and R13H) with the human sequence.Muroid peptide proof neurotoxicity reduces, and does not combine people such as (, 1992) Maggio with people's brain homogenate.Therefore, interested is to estimate combining of muroid BAP and BBP in the Y2H system.Carry out oligonucleotide-directed mutagenesis with above-mentioned PCR method, make the people BAP sequence among the pEK162 become coding muroid peptide.People BAP fusion protein expression plasmid used among gained plasmid pEK240 and the present invention is identical, and just these three codons have produced the alternative amino acid of muroid peptide sequence.Compared interaction between BBP fusion rotein and mouse and the people BAP fusion rotein with the Y2H biological test.The bacterial strain of expressing BBP and mouse BAP can not produce growth response (Fig. 7).Following hypothesis has been supported in this discovery, and promptly BBP may work as the specificity medium of BAP neurotoxicity effect, and this discovery also provides a secondary mechanism to explain the reason that mouse BAP neurotoxicity reduces.Importantly, these data have also been described the interactional high degree of specificity of BBP/BAP in the Y2H test, because three amino acid whose replacements are enough to eliminate fully this combination (Fig. 7).

Clearly, the present invention also can otherwise implement specifically describing in noted earlier and embodiment.Can do various changes and variation to the present invention according to above-mentioned theory, therefore, these change all within the scope of the appended claims.

Reference

Acharya, S., and Karnik, S. (1996). conservative GIul 34-Argl 35 sequences are regulated release (the Modulation of GDP release from transducin by the conserved GIul 34-Argl 35 sequence in rhodopsin.) J.BIO.Chem 271 of transducin GCP, 25406-25411. in the Visual purple

Altschul, S., Gish, W., Miller, W., Myers, E., and Lipman, D. (1990). base local arrangements gopher (Basic Local alignment search tool.) J Mol Biol 215,403-410.

Chartier-Harlin，M.，Crawford，F.，Houiden，H.，Warren，A.，Hughes，D.，

Fidani, L., GOate, A., Rossor, M., RoqueS, P., Hardy, J., and Mullan, M. codon 717 changes early onset Alzheimer's disease (Early-onset presenile dementia ' s disease caused by mutations at codon 717 of the B～amyioid precursor protein gene.) Nature 353 that causes, 844-846. in (1991) .B-amyloid precursor protein gene

Duyan, S., Chen, X., Fu, J., Chen, M., Zhu, H., ROher, A., Slattery, T., Zhao, L., Nagashima, M., Morser, J., Migheli, A., Nawroth, P., Stern, D., and Schmidt, neurotoxicity (the RAGE and amyloid-β peptideneurotoxicity in presenile dementia ' s disease.) Nature 382 of A. (1996) .RAGE and amyloid-β peptide in Alzheimer's disease, 685-691.

EI Khoury, J., Hickman, S., Thomas, C., Cao, L., Silverstein, S., and Loike, J. (1996). bonding (Scavenger receptor-mediatedadhesion of microglia to β-amyloid fibrils.) Nature 382 of receptor-mediated microgliacyte of scavenging agent and beta amyloid fiber, 716-719.

Goate, A., Chartier-Harlin.M., Mullan, M..Brown, J., Crawford, F..Fidani, L., Giuffra, L., Haynes, A., lrving, N., James, L., Mant, R., Newton, P., Rooke, K., Roques, P., Talbot, C., Pericak-Vance, M., Roses, A., Williamson, R., Rossor, M., Owen, M., and Hardy, J. (1991). in the sick amyloid precursor protein gene of familial inheritance alzheimer-separation of error code sudden change (Nature 349 of Segregation of amissense mutation in the amyloid precursor protein gene with familial presenile dementia ' sdisease.), 704-706.

Hendriks, L., van Duijn, C., Cras, P., Cruts, M., van Hul, W., van.Harskamp, F., Martin, J.-J., Hofman, A. and van Broeckhoven, C. (1992). with related presenile dementia and cephalemia (the Presenile dementia and cerebral haemorrhagelinked to a mutation of 692 sudden changes of codon in the beta amyloid precursor protein gene

at codon 692 of the β-amyloid precursor protein gene.)Nat Genet 1，218-221.

Jacobsen, J., Spruyt, M., Brown, A., Sahasrabudhe, S., Blume, A., Vitek, M., Muenkel, H., and Sonnenberg-Reines, J. (1994). not the treatment of ripple alcohol has reduced beta-amyloyd peptide release (The release of presenile dementia ' s disease β amyloid peptide is reduced by phorbol treatment.J.Bio.Chem 269, the 8376-8382. of Alzheimer's disease

Jacobsen, J, Muenkel, H, Blume, A, and Vitek, M (1991). a kind of novel species group specificity RNA (A novel species-specific RNA related toalternatively spliced amyloid precursor protein mRNAs.) the Neurobiol of Aging 12 relevant, 575-583. with different montage amyloid precursor protein m RNA

Kang, Y.-S., Kane, J., Kurjan, J., Stadel, J., and Tipper, D. (1990). the Mammals of Mammals Ga albumen and hybridization-yeast Ga protein expression is to effect (Effectsof expression of mammalian Ga and hybrid mammalian-yeast Ga proteins on the yeastpheromone response signal transduction pathway.) the MoI Cell BioI IO in zymic pheromone acknowledge signal transduction path, 2582～2590.

LaFerla, F., Tinkle, B., Bieberich, C., Haudenschild, C., and Jay, G. (1995). presenile dementia A β peptide is induced deterioration of neurons and apoptosis (The presenile dementia ' s A β peptide induces neurodegeneration and apoptotic cell death in transgenic mice.) NatureGenetics 9,21-30. in transgenic mice

Lassmann, H., Bancher, C., Breitschopf, H., Wegiel, J., Bobinski, M., Jellinger, K., and Wisniewski, H. (1995). utilize the fracture of DNA original position to estimate necrocytosis (Cell death in presenile dementia ' s disease evaluated by DNA fragmentation in situ.) the Acta Neuropathol 89,35～41. of Alzheimer's disease

Levy, E., Carman, M., Fernandez-Madrid, l., Power, M., Lieberburg, l., vanDuinen, S., Bots, G., Luyendijk, W., and Frangione, B.{1990). the Alzheimer's disease amyloid transgenation in the hereditary cerebral hemorrhage (Mutation of the presenile dementia ' s disease amyloid gene in hereditarycerebral hemorrhage) Dutch type.Science 248,1124-1126.

Loo, D., Copani, A., Pike, C., Whittemore, E., Walencewicz, A., and Cotman, C. (1993). amyloid-beta is inducing apoptosis (Apoptosis isinduced by β-amyloid in cultured central nervous system neurons.) Proc Natl Acad SciUSA 90 in the central nervous system neurons culture, 7951-7955.

Maggio, J., Stimson, E., Ghilardi, J., Allen, C., Dahl, C., Whitcomb, D., Vigna, S., Vinters, H., Labenski, M., and Mantyh, P. (1992). the Alzheimer's disease amyloid beta spot that mark 4 amyloid deposition causes is at external reversibility development (Reversible in vitro growth of presenile dementia diseaseb-amyloid plaques by deposition of Iabeled amyloid peptide.) Proc Natl Acad Sci USA 89,5462-5466.

Mullan, M., Crawford, F., Axelman, K., Houlden, H., Lilius, L., Winblad.W., and Lannfelt, L. (1992). may cause in the amyloid beta N-terminal of Alzheimer's disease cause a disease sudden change (the Nat Genet 1 of Apathogenic mutation for probable presenile dementia ' s disease in the N-terminus of β-amyloid.), a 345-347.

MurreJI, J., Farlow, M., Ghetti, B., and Benson, M. (1991). place sudden change and heredity related to alzheimer's disease (A mutation in the amyloid precursor protein associatedwith hereditary presenile dementia disease.) Science 254,97-99. in the amyloid precursor protein

Nishimoto, I., Qkamoto, T., Matsuura, Y., Takahashi, S., Okamoto, T., Murayama, Y., and Ogata, E. (1993). the mixture of presenile dementia amyloid protein precursor and brain gtp binding protein Go (Atzheimer amyioid protein precursor complexes with brain GTP～binding protein Go.) Nature 362,75-79.

Ozenberger, B., and Young, K. (1995). the part and the functional effect between acceptor (Functional interaction of ligands and receptors of the hematopoieticsuperfamily in yeast.) the Mol Endoerinol9 of the hematopoietic cell superfamily in the yeast cell, 1321-1329.#

Rhodes K., Monaghan M., Barrezueta N., Nawoschik S., Bekele-Arcuri Z., Matos M., Nakahira K., Schechter L. and Trimmer J. (1996). valtage-gated K ⁺Passage β subunit: Kv β 1 and Kv β 2 expression and distribution (the Voltage-gated K in Adult Rat Brain ⁺Channel beta subunits:expressionand distribution of Kv beta 1 and Kv beta 2 in adult rat brain.) J Neurosci 16,4846-4860.

Scheuner.D., Eckman, C., Jensen, M., Song, X., Citron, M., Suzuki, N., Bird, T., Hardy, J., Hutton, M., Kukull, W., Larson, E., Levy-Lahad, E., Viitanen, M., Peskind, E., Poorkaj, P., Schellenberg, G., Tanzi, R., Wasco, W., Lannfelt, L., Selkoe, D., and Younkin, S. (1996). with the PSI/2 of familial related to alzheimer's disease and interior (A β 42 (43) is increased in vivo by the PSI/2 and APP mutations linked to familial presenile dementia ' s disease.) Nat Med 2, the 864-870. of increasing of body of APP sudden change AB42 (43)

Selkoe, D. (1997). Alzheimer's disease: genotype, phenotype and treatment thereof (presenile dementia ' s Disease:Genotypes, phenotype, and treatments.) Science 275,630-631.

Smale, G., Nichols, N., Brady, D., Finch, C., and Jr, W.H. (1995). the evidence of apoptosis in the Alzheimer's disease (Evidence for apoptotic cell death in presenile dementia ' s disease.) ExpNeurol 133,225-230.

Tanzi, R., Gusella, J., Watkins, P., Bruns, G., George-HysIop, P.S., vanKeuren, M., Patterson, D., Pagan, S., Kurnit, D., and Neve, R. (1987). near the amyloid beta protein gene presenile dementia locus, cDNA, the distribution of mRNA and genetic linkage (Amyloid β protein gene.cDNA, mRNAdistribution and genetic linkage near the presenile dementia locus.) Science 235,880-884.

Tatusov, R., Altschul, S., and Koonin, E. (1994). the segmental detection of conservative property in the protein: utilize arranged blocks multiple scanning sequence library (Detection of conserved segments in proteins:Iterativescanning of sequence databases with alignment blocks.) Proc Natl Acad Sci USA 91,12091-12095.

Wade Harper, J., Adami, G.R., Wei, N., Keyomarsi, K., and Elledge, S.J. (1993) .p21Cdk-proteins C reactive Cipl is potent inhibitor (the The p21 Cdk-interacting protein Cipl is a potent inhibitor of GI cyclin-dependent kinases.) Cell 75 of G1 cell cycle protein dependent kinase, 805-816.

Watt, J., Pike, C., WalencewicZ-Wasserman, A., and Cotman, C. (1994). to analysis (Ultrastructuralanalysis of β-amyloid-Induced apoptosis in cultured hippocampaf neurons.) the Brain Res661 of the superstructure of amyloid-beta inductive apoptosis in the artificial culture hippocampus neurone, 147-156.

Yamatsuji, T..Matsui.T., Okamoto, T., Komatsuzaki, K., Takeda, S., Fukumoto, H., lwatsubo, T., Suzuki, N., Asami～Odaka, A., Ireland, S, Kinane, T., Giambarella, U., and Nishimoto, I. (1996). familial presenile dementia APP in conjunction with the sudden change inductive by the protein mediated neurone dna break of G (G protein-mediated neuronal DNA fragmentation induced by familialAlzheimer Disease-binding mutants of APP.) Science 272,1349-1352.

Yan, S., Fu, J., Soto, C., Chen, X., Zhu, H., Al-Mohanna, F., ColliSOn, K., Zhu, A., Stern, E., SaidO, T., Tohyama, M., Ogawa, S., Roher, A., and Stern, D. (1997). in conjunction with amyloid beta and mediate neurovirulent a kind of intracellular protein in the Alzheimer's disease (An intracellular protein that bindsamyloid-β peptide and mediates neurotoxicity in presenile dementia ' s disease.) Nature 389,689-695.

Sequence table

(1) general information:

(i) thing people: Ozenberger, Brad A.

Jacobsen，J.S.

Kajkowski，Eileen

(ii) denomination of invention: beta amyloid peptide-binding proteins and coding polynucleotide thereof

(iii) sequence quantity: 2

(iv) contact address:

(A) addressee: American Home Products

(B) street: One Campus Drive

(C) city: Parsippany

(D) continent: NJ

(E) country: USA

(F) postcode: 07054

(v) computer-reader form:

(A) media type: floppy disk

(B) computer: IBM PC compatible

(C) operating system: PC-DOS/MS-DOS

(D) software: PatentIn Release#1.0, version #1.30

(vi) current request for data:

(A) application number: US

(B) applying date:

(C) classification:

(viii) lawyer/proxy's information:

(A) name: Walsh, Andrea C.

(B) number of registration: 34,988

(C) reference/file number: 98126

(ix) telecommunication information:

(A) phone: 973-683-2169

(B) fax: 973-683-4117

(2) information of SEQ ID NO:1:

(i) sequence signature:

(A) length: 810 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topology: linearity

(ii) molecule type: mRNA

(ix) feature:

(A) title/code: CDS

(B) position: 1..807

(xi) sequence description: SEQ ID NO:1:

ATG CAT ATT TTA AAA GGG TCT CCC AAT GTG ATT CCA CGG GCT CAC GGG 48

Met His Ile Leu Lys Gly Ser Pro Asn Val Ile Pro Arg Ala His Gly

1 5 10 15

CAG AAG AAC ACG CGA AGA GAC GGA ACT GGC CTC TAT CCT ATG CGA GGT 96

Gln Lys Asn Thr Arg Arg Asp Gly Thr Gly Leu Tyr Pro Met Arg Gly

20 25 30

CCC TTT AAG AAC CTC GCC CTG TTG CCC TTC TCC CTC CCG CTC CTG GGC 144

Pro Phe Lys Asn Leu Ala Leu Leu Pro Phe Ser Leu Pro Leu Leu Gly

35 40 45

GGA GGC GGA AGC GGA AGT GGC GAG AAA GTG TCG GTC TCC AAG ATG GCG 192

Gly Gly Gly Ser Gly Ser Gly Glu Lys Val Ser Val Ser Lys Met Ala

50 55 60

GCC GCC TGG CCG TCT GGT CCG TCT GCT CCG GAG GCC GTG ACG GCC AGA 240

Ala Ala Trp Pro Ser Gly Pro Ser Ala Pro Glu Ala Val Thr Ala Arg

65 70 75 80

CTC GTT GGT GTC CTG TGG TTC GTC TCA GTC ACT ACA GGA CCC TGG GGG 288

Leu Val Gly Val Leu Trp Phe Val Ser Val Thr Thr Gly Pro Trp Gly

85 90 95

GCT GTT GCC ACC TCC GCC GGG GGC GAG GAG TCG CTT AAG TGC GAG GAC 336

Ala Val Ala Thr Ser Ala Gly Gly Glu Glu Ser Leu Lys Cys Glu Asp

100 105 110

CTC AAA GTG GGA CAA TAT ATT TGT AAA GAT CCA AAA ATA AAT GAC GCT 384

Leu Lys Val Gly Gln Tyr Ile Cys Lys Asp Pro Lys Ile Asn Asp Ala

115 120 125

ACG CAA GAA CCA GTT AAC TGT ACA AAC TAC ACA GCT CAT GTT TCC TGT 432

Thr Gln Glu Pro Val Asn Cys Thr Asn Tyr Thr Ala His Val Ser Cys

130 135 140

TTT CCA GCA CCC AAC ATA ACT TGT AAG GAT TCC AGT GGC AAT GAA ACA 480

Phe Pro Ala Pro Asn Ile Thr Cys Lys Asp Ser Ser Gly Asn Glu Thr

145 150 155 160

CAT TTT ACT GGG AAC GAA GTT GGT TTT TTC AAG CCC ATA TCT TGC CGA 528

His Phe Thr Gly Asn Glu Val Gly Phe Phe Lys Pro Ile Ser Cys Arg

165 170 175

AAT GTA AAT GGC TAT TCC TAC AAA GTG GCA GTC GCA TTG TCT CTT TTT 576

Asn Val Asn Gly Tyr Ser Tyr Lys Val Ala Val Ala Leu Ser Leu Phe

180 185 190

CTT GGA TGG TTG GGA GCA GAT CGA TTT TAC CTT GGA TAC CCT GCT TTG 624

Leu Gly Trp Leu Gly Ala Asp Arg Phe Tyr Leu Gly Tyr Pro Ala Leu

195 200 205

GGT TTG TTA AAG TTT TGC ACT GTA GGG TTT TGT GGA ATT GGG AGC CTA 672

Gly Leu Leu Lys Phe Cys Thr Val Gly Phe Cys Gly Ile Gly Ser Leu

210 215 220

ATT GAT TTC ATT CTT ATT TCA ATG CAG ATT GTT GGA CCT TCA GAT GGA 720

Ile Asp Phe Ile Leu Ile Ser Met Gln Ile Val Gly Pro Ser Asp Gly

225 230 235 240

AGT AGT TAC ATT ATA GAT TAC TAT GGA ACC AGA CTT ACA AGA CTG AGT 768

Ser Ser Tyr Ile Ile Asp Tyr Tyr Gly Thr Arg Leu Thr Arg Leu Ser

245 250 255

ATT ACT AAT GAA ACA TTT AGA AAA ACG CAA TTA TAT CCA TAA 810

Ile Thr Asn Glu Thr Phe Arg Lys Thr Gln Leu Tyr Pro

260 265

(2) information of SEQ ID NO:2:

(i) sequence signature:

(A) length: 269 amino acid

(B) type: amino acid

(D) topology: linearity

(ii) molecule type: protein

(xi) sequence description: SEQ ID NO:2:

Met His Ile Leu Lys Gly Ser Pro Asn Val Ile Pro Arg Ala His Gly

1 5 10 15

Gln Lys Asn Thr Arg Arg Asp Gly Thr Gly Leu Tyr Pro Met Arg Gly

20 25 30

Pro Phe Lys Asn Leu Ala Leu Leu Pro Phe Ser Leu Pro Leu Leu Gly

35 40 45

Gly Gly Gly Ser Gly Ser Gly Glu Lys Val Ser Val Ser Lys Met Ala

50 55 60

Ala Ala Trp Pro Ser Gly Pro Ser Ala Pro Glu Ala Val Thr Ala Arg

65 70 75 80

Leu Val Gly Val Leu Trp Phe Val Ser Val Thr Thr Gly Pro Trp Gly

85 90 95

Ala Val Ala Thr Ser Ala Gly Gly Glu Glu Ser Leu Lys Cys Glu Asp

100 105 110

Leu Lys Val Gly Gln Tyr Ile Cys Lys Asp Pro Lys Ile Asn Asp Ala

115 120 125

Thr Gln Glu Pro Val Asn Cys Thr Asn Tyr Thr Ala His Val Ser Cys

130 135 140

Phe Pro Ala Pro Asn Ile Thr Cys Lys Asp Ser Ser Gly Asn Glu Thr

145 150 155 160

His Phe Thr Gly Asn Glu Val Gly Phe Phe Lys Pro Ile Ser Cys Arg

165 170 175

Asn Val Asn Gly Tyr Ser Tyr Lys Val Ala Val Ala Leu Ser Leu Phe

180 185 190

Leu Gly Trp Leu Gly Ala Asp Arg Phe Tyr Leu Gly Tyr Pro Ala Leu

195 200 205

Gly Leu Leu Lys Phe Cys Thr Val Gly Phe Cys Gly Ile Gly Ser Leu

210 215 220

Ile Asp Phe Ile Leu Ile Ser Met Gln Ile Val Gly Pro Ser Asp Gly

225 230 235 240

Ser Ser Tyr Ile Ile Asp Tyr Tyr Gly Thr Arg Leu Thr Arg Leu Ser

245 250 255

Ile Thr Asn Glu Thr Phe Arg Lys Thr Gln Leu Tyr Pro

260 265

Claims (18)

1. an isolating polynucleotide comprises the proteinic nucleotide sequence that coding has aminoacid sequence SEQ ID NO:2.

2. polynucleotide according to claim 1 comprises nucleotide sequence SEQ ID NO:1.

3. isolating polynucleotide, it comprises following nucleotide sequence: the coded protein of this nucleotide sequence comprises the amino acid 68 of aminoacid sequence SEQ ID NO:2 to amino acid 269 fragments, and this fragment has the activity in conjunction with the human beta-amyloid peptide.

4. polynucleotide according to claim 2 comprises among the nucleotide sequence SEQ ID NO:1 Nucleotide 202 to Nucleotide 807.

5. according to each described polynucleotide in the claim 1 to 4, described polynucleotide reaches the regulating and controlling sequence operability with at least one segment table and is connected.

6. a host cell is transformed by the described polynucleotide of claim 5.

7. host cell according to claim 6, described cell are eukaryotic cell or prokaryotic cell prokaryocyte.

8. coded method of protein of the described polynucleotide of production claim 5, it comprises that (a) cultivates the culture of the described host cell of claim 6 in suitable medium; (b) purifying protein from substratum.

9. a protein is made by the described method of claim 8.

10. a protein comprises amino acid/11 23 to 202 among the aminoacid sequence SEQ ID NO:2.

11. protein according to claim 10 comprises amino acid 68 to 202 among the aminoacid sequence SEQ ID NO:2.

12. protein according to claim 10 comprises the 68th to 269 amino acids among the aminoacid sequence SEQ ID NO:2.

13. protein according to claim 10 comprises aminoacid sequence SEQ ID NO:2.

14. a fusion rotein, comprise be connected with allogenic albumen or peptide sequence as each described beta amyloid peptide-binding proteins among the claim 9-13.

15. a monoclonal antibody, its specificity is in conjunction with each described aminoacid sequence among the claim 12-13.

16. whether there is the method for beta amyloid peptide-binding proteins homology polypeptide in the test sample, it is 90% homogeny that one section zone that described polypeptide is contained and the aminoacid sequence of SEQ ID NO:2 have at least, described method comprises: (a) causing under the specificity bonded condition for validity, the described monoclonal antibody of claim 15 is cultivated with sample; (b) detect the situation that combines of described antibody and polypeptide described in the sample.

17. whether test sample exists the method for beta amyloid peptide-binding proteins homology polypeptide, cDNA inserts the coded protein-bonded aminoacid sequence homogeny of beta amyloid peptide of fragment and is at least 90% in contained one section zone of described polypeptide and the ATCC98617, described method comprises: (a) causing under the specificity bonded condition for validity, the described monoclonal antibody of claim 15 is cultivated with sample; (b) detect the situation that combines of described antibody and polypeptide described in the sample.

18. each described protein suppresses the purposes of beta amyloid peptide cumulative medicine in the brain among the claim 9-13 as preparation.

Images