CN118272423A - Application of transcription factor OsbZIP05 in negative regulation of rice seed vigor - Google Patents
Application of transcription factor OsbZIP05 in negative regulation of rice seed vigor Download PDFInfo
- Publication number
- CN118272423A CN118272423A CN202410366903.5A CN202410366903A CN118272423A CN 118272423 A CN118272423 A CN 118272423A CN 202410366903 A CN202410366903 A CN 202410366903A CN 118272423 A CN118272423 A CN 118272423A
- Authority
- CN
- China
- Prior art keywords
- osbzip05
- rice
- vigor
- transcription factor
- seed
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 235000007164 Oryza sativa Nutrition 0.000 title claims abstract description 46
- 235000009566 rice Nutrition 0.000 title claims abstract description 46
- 108091023040 Transcription factor Proteins 0.000 title claims abstract description 17
- 102000040945 Transcription factor Human genes 0.000 title claims abstract description 17
- 230000003828 downregulation Effects 0.000 title claims abstract description 10
- 240000007594 Oryza sativa Species 0.000 title 1
- 241000209094 Oryza Species 0.000 claims abstract description 45
- 230000000694 effects Effects 0.000 claims abstract description 16
- 239000013604 expression vector Substances 0.000 claims abstract description 7
- 230000035784 germination Effects 0.000 claims description 37
- 241000894006 Bacteria Species 0.000 claims description 4
- 238000003259 recombinant expression Methods 0.000 claims description 4
- 238000012216 screening Methods 0.000 claims description 4
- 241000588724 Escherichia coli Species 0.000 claims description 3
- 230000009261 transgenic effect Effects 0.000 abstract description 23
- 230000002018 overexpression Effects 0.000 abstract description 18
- 239000000463 material Substances 0.000 abstract description 17
- 241000196324 Embryophyta Species 0.000 abstract description 16
- 230000032683 aging Effects 0.000 abstract description 13
- 238000001514 detection method Methods 0.000 abstract description 7
- 230000002068 genetic effect Effects 0.000 abstract description 7
- 241000589158 Agrobacterium Species 0.000 abstract description 6
- 238000012163 sequencing technique Methods 0.000 abstract description 6
- 230000009466 transformation Effects 0.000 abstract description 6
- 238000013461 design Methods 0.000 abstract description 5
- 230000001404 mediated effect Effects 0.000 abstract description 5
- 238000004458 analytical method Methods 0.000 abstract description 4
- 230000033228 biological regulation Effects 0.000 abstract description 4
- 238000009395 breeding Methods 0.000 abstract description 3
- 230000001488 breeding effect Effects 0.000 abstract description 3
- 206010020649 Hyperkeratosis Diseases 0.000 description 9
- 239000007788 liquid Substances 0.000 description 9
- 239000002609 medium Substances 0.000 description 8
- 238000002474 experimental method Methods 0.000 description 6
- 238000000034 method Methods 0.000 description 6
- 108090000623 proteins and genes Proteins 0.000 description 6
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 6
- 238000012258 culturing Methods 0.000 description 5
- 239000013612 plasmid Substances 0.000 description 5
- 239000007787 solid Substances 0.000 description 5
- 230000001580 bacterial effect Effects 0.000 description 4
- 230000014509 gene expression Effects 0.000 description 4
- 239000001963 growth medium Substances 0.000 description 4
- 238000005286 illumination Methods 0.000 description 3
- 239000000203 mixture Substances 0.000 description 3
- 230000001105 regulatory effect Effects 0.000 description 3
- 239000000243 solution Substances 0.000 description 3
- 239000002699 waste material Substances 0.000 description 3
- IJGRMHOSHXDMSA-UHFFFAOYSA-N Atomic nitrogen Chemical compound N#N IJGRMHOSHXDMSA-UHFFFAOYSA-N 0.000 description 2
- 108010001572 Basic-Leucine Zipper Transcription Factors Proteins 0.000 description 2
- 102000000806 Basic-Leucine Zipper Transcription Factors Human genes 0.000 description 2
- 238000000692 Student's t-test Methods 0.000 description 2
- 238000001784 detoxification Methods 0.000 description 2
- 230000037361 pathway Effects 0.000 description 2
- 230000008569 process Effects 0.000 description 2
- 239000000047 product Substances 0.000 description 2
- 102000004169 proteins and genes Human genes 0.000 description 2
- 230000001954 sterilising effect Effects 0.000 description 2
- 238000004659 sterilization and disinfection Methods 0.000 description 2
- 238000012353 t test Methods 0.000 description 2
- 238000012360 testing method Methods 0.000 description 2
- 238000011282 treatment Methods 0.000 description 2
- 239000013598 vector Substances 0.000 description 2
- 238000005406 washing Methods 0.000 description 2
- 108091032973 (ribonucleotides)n+m Proteins 0.000 description 1
- 102000049273 1-Cys peroxiredoxin Human genes 0.000 description 1
- 108091026890 Coding region Proteins 0.000 description 1
- 108020004414 DNA Proteins 0.000 description 1
- 108090000790 Enzymes Proteins 0.000 description 1
- 102000004190 Enzymes Human genes 0.000 description 1
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 1
- 108020005004 Guide RNA Proteins 0.000 description 1
- 240000002582 Oryza sativa Indica Group Species 0.000 description 1
- 101000724249 Oryza sativa subsp. japonica bZIP transcription factor ABI5 homolog Proteins 0.000 description 1
- 238000012408 PCR amplification Methods 0.000 description 1
- 101710185569 Peroxiredoxin-6 Proteins 0.000 description 1
- 238000003559 RNA-seq method Methods 0.000 description 1
- 238000011529 RT qPCR Methods 0.000 description 1
- 239000005708 Sodium hypochlorite Substances 0.000 description 1
- 230000036579 abiotic stress Effects 0.000 description 1
- 239000003963 antioxidant agent Substances 0.000 description 1
- 230000003078 antioxidant effect Effects 0.000 description 1
- 108091067354 bZIP family Proteins 0.000 description 1
- 102000039554 bZIP family Human genes 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 235000013339 cereals Nutrition 0.000 description 1
- 238000006243 chemical reaction Methods 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 238000004140 cleaning Methods 0.000 description 1
- 238000003776 cleavage reaction Methods 0.000 description 1
- 238000003501 co-culture Methods 0.000 description 1
- 239000012881 co-culture medium Substances 0.000 description 1
- 238000010276 construction Methods 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 230000004069 differentiation Effects 0.000 description 1
- 238000001035 drying Methods 0.000 description 1
- 239000013613 expression plasmid Substances 0.000 description 1
- 230000002431 foraging effect Effects 0.000 description 1
- 239000011521 glass Substances 0.000 description 1
- 230000006872 improvement Effects 0.000 description 1
- 230000006698 induction Effects 0.000 description 1
- 238000002347 injection Methods 0.000 description 1
- 239000007924 injection Substances 0.000 description 1
- 108020004999 messenger RNA Proteins 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000009456 molecular mechanism Effects 0.000 description 1
- 239000013642 negative control Substances 0.000 description 1
- 229910052757 nitrogen Inorganic materials 0.000 description 1
- 235000015097 nutrients Nutrition 0.000 description 1
- 150000002978 peroxides Chemical class 0.000 description 1
- 238000004321 preservation Methods 0.000 description 1
- 230000000644 propagated effect Effects 0.000 description 1
- 230000009467 reduction Effects 0.000 description 1
- 230000004044 response Effects 0.000 description 1
- 239000012883 rooting culture medium Substances 0.000 description 1
- 230000007017 scission Effects 0.000 description 1
- 230000007226 seed germination Effects 0.000 description 1
- 230000035945 sensitivity Effects 0.000 description 1
- SUKJFIGYRHOWBL-UHFFFAOYSA-N sodium hypochlorite Chemical compound [Na+].Cl[O-] SUKJFIGYRHOWBL-UHFFFAOYSA-N 0.000 description 1
- 230000007480 spreading Effects 0.000 description 1
- 239000006228 supernatant Substances 0.000 description 1
- 230000034512 ubiquitination Effects 0.000 description 1
- 238000010798 ubiquitination Methods 0.000 description 1
- 230000003827 upregulation Effects 0.000 description 1
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides an application of a transcription factor OsbZIP05 in negative regulation of rice seed vigor, belonging to the technical field of seed biology. In the early stage, 3 varieties with different storability (a non-storable variety No. 2, a medium storable variety Fuhui 7185 and a storable variety Fuxiang account) are subjected to artificial aging and transcriptome sequencing analysis, so that two core transcription factors which can regulate and control the activity of seeds are obtained, wherein one of the core transcription factors is Os01g0658900 (OsbZIP 05). According to the invention, through the steps of constructing knockout and over-expression vectors, agrobacterium-mediated genetic transformation, knockout and over-expression transgenic plant detection and the like, homozygous transgenic plant materials are obtained firstly, then seed vigor phenotype observation is carried out on the homozygous transgenic plant materials, and finally, the negative regulation and control effect of the OsbZIP05 in the regulation and control of the vigor of rice seeds is clarified. The invention can lay a theoretical foundation for tamping for molecular design breeding of rice seed vitality.
Description
Technical Field
The invention belongs to the technical field of seed biology, and particularly relates to application of a transcription factor OsbZIP05 in negative regulation of rice seed vigor.
Background
It is known in the art that bZIP transcription factors are involved in seed germination and abiotic stress responses, among other processes, including in regulating seed vigor in plants. For example ZouM et al found that over-expression of rice OsABI5 resulted in sensitivity of rice to ABA, thereby reducing rice seed vigor. In addition, a recent study such as WangW-Q illustrates the detoxification pathway of the activity of the rice bZIP seeds, RNA-seq is carried out on rice varieties with different seed activities, through analysis of sequencing results, the OsbZIP23 is obtained as a candidate gene, experiments show that the overexpression of the OsbZIP23 enhances the activity of the rice seeds, the knockout of the OsbZIP23 reduces the activity of the rice seeds, the protein of the OsbZIP23 has positive regulation effect, and the peroxide reduction protein (1-CYSPEROXIREDOXIN, PER 1) is a seed-specific antioxidant in plants and is a key role in encoding the detoxification pathway, so that experiments of over-expression PER1A and knockout PER1A are carried out, and as a result, the over-expression PER1A is found to increase the activity of the rice seeds, and the knockout of PER1A reduces the activity of the rice seeds, so that the conclusion is obtained: osbZIP23 can be directly combined with a promoter of PER1A to activate the expression of PER1A, and an ABA signal path possibly participates in the OsbZIP23-PER1A, so that the regulation and control of the activity of rice seeds are mediated.
However, there are few studies on the bZIP family involved in regulating seed vigor, and the molecular mechanism thereof is still to be further studied.
Disclosure of Invention
In order to solve the technical problems, the invention provides application of the transcription factor OsbZIP05 in negative regulation of the vigor of rice seeds for the first time. In the early stage, 3 varieties with different storability (a non-storable variety No. 2, a medium storable variety Fuhui 7185 and a storable variety Fuxiang account) are subjected to artificial aging and transcriptome sequencing analysis, so that two core transcription factors which can regulate and control the activity of seeds are obtained, wherein one of the core transcription factors is Os01g0658900 (OsbZIP 05). According to the invention, through the steps of constructing knockout and over-expression vectors, agrobacterium-mediated genetic transformation, knockout and over-expression transgenic plant detection and the like, homozygous transgenic plant materials are obtained firstly, then seed vigor phenotype observation is carried out on the homozygous transgenic plant materials, and finally, the negative regulation and control effect of the OsbZIP05 in the regulation and control of the vigor of rice seeds is clarified. The invention can lay a theoretical foundation for tamping for molecular design breeding of rice seed vitality.
In order to achieve the above purpose, the invention adopts the following technical scheme:
The invention aims at providing an application of a transcription factor OsbZIP05 in the negative regulation of rice seed vigor, and the base sequence of the transcription factor OsbZIP05 is shown as SEQ ID No. 1.
Furthermore, in the application, the knocking out of the transcription factor OsbZIP05 can improve the activity of rice seeds, so that the germination rate of the rice seeds is improved.
The second purpose of the invention is to provide an application of the recombinant expression vector for knocking out the transcription factor OsbZIP05 in screening/cultivating rice varieties with high seed vigor.
The invention further provides application of host bacteria containing the recombinant expression vector in screening/cultivating rice varieties with high seed vigor, wherein the host bacteria are escherichia coli.
Compared with the prior art, the invention has the following beneficial effects:
The invention firstly obtains homozygous transgenic plant material through the steps of constructing knockout and over-expression vectors, agrobacterium-mediated genetic transformation, knockout and over-expression transgenic plant detection and the like, and then carries out seed vigor phenotype observation on the homozygous transgenic plant material, and the result shows that: (1) When artificial aging is not performed, the germination rates of all groups of strains are consistent, and no obvious difference exists; (2) The germination rate of each strain is slightly reduced after artificial aging for 14d, the germination rate of the over-expression strain is 81.3 percent which is slightly lower than that of the wild type, and the knocked-out strain has no obvious difference; (3) The germination rate of the wild type of the control group is reduced to about 82 percent, the germination rate of the over-expression strain is reduced to 64.6 percent and 66.4 percent, which is obviously lower than that of the wild type, the germination rate of the knocked-out strain is still 89.3 percent and 89.6 percent, which is higher than that of the wild type and has obvious difference; (4) The germination rate of each strain is obviously reduced after artificial aging for 28d, the germination rate of a wild type strain is about 61%, the germination rate of an over-expressed strain is only 30% and 32%, the germination rate is far lower than that of a wild type strain, the germination rate of a knocked-out strain is still 86% and 81%, and the germination rate is obviously higher than that of the wild type strain. The knockout strain is not significantly different from the wild type when artificially aged 14d, the strain starts to be significantly different when aged 21d and 28d, the germination rate of the over-expression strain is significantly reduced when artificially aged 14d, and the germination rate is greatly reduced when aged 21d and 28 d. The invention firstly defines the negative regulation and control function of the OsbZIP05 in the regulation and control of the activity of the rice seeds, and lays a more tamped theoretical foundation for molecular design breeding of the activity of the rice seeds.
Drawings
FIG. 1 is a schematic diagram of the cleavage ligation system used in example 1 of the present invention;
FIG. 2 shows the results of measuring the expression level of OsbZIP05 in the over-expressed transgenic line of example 1 according to the present invention, and is given below: data are mean ± error (n=3), t-test determines significance of the difference, P <0.05; * P <0.01;
FIG. 3 shows the results of the test of the knockout transgenic line in example 1 of the present invention, wherein: … and-are deleted bases; red as an increased base; #1- #5 are transgenic lines of OsbZIP 05; target1/2 is a knockout Target of OsbZIP 05;
FIG. 4 is an artificial aging and germination test of the OsbZIP05 knockout and overexpressing strain in example 2 of the present invention, wherein: (a) an artificially aged 21d phenotype; (B) a germination rate statistics line graph; (C, D, E) OsbZIP05 knockout and overexpressing strain artificial aging treatments 0, 14, 21 and 28D germination rate; and (3) injection: data are mean ± error (n=3), t-test determines significance of the difference, P <0.05; * P <0.01.
Detailed Description
The following examples further illustrate specific steps and features of the invention, which are intended to be illustrative only and not limiting. The methods used in the present invention are conventional in the art unless otherwise specified. The reagents, materials, and instruments and the like referred to in the present invention are not particularly described and are commercially available.
The invention is described in further detail below with reference to the examples and the attached drawings:
example 1 obtaining of Rice OsbZIP05 transgenic Material
Construction of OsbZIP05 knockout and overexpression vectors
In order to obtain an OsbZIP05 over-expressed transgenic plant, the full length of a coding region (the sequence is shown as SEQ ID No. 1) is constructed on pCUBi-1390 driven by a ubiquitination promoter, and enzyme cutting sites are PstI and BamHI. The 1390-OsbZIP05 recombinant plasmid is obtained according to the method of homologous grouping. In order to obtain an OsbZIP05 knockout transgenic PLANT, a CRISPR-PLANT website is utilized to predict an exon gRNA target of the OsbZIP05, then CRISPRRGENTools website is utilized to conduct off-target analysis on the screened target, and a target design primer is selected (the sequences are shown as SEQ ID No.2 and SEQ ID No. 3). The pCBC-MT1T2 plasmid is used as a template to amplify the target gene. The product was subjected to ligation using the ligation protocol of FIG. 1, followed by E.coli competent to obtain recombinant knockout vector plasmid.
SEQ ID No.1：
ATGCAGGCATATTACGGCCCAGGGATCTTGCCACCAACATTTTTTAGCCCTGGAATAGCCGCTGGTCATACCCCTCCTCCATTTATCTTGGGTCCTCAGCCTCTGGTGCCATCCGCTTTTGGGAAGCCATATGCCGCAATTTATCCTCCTGGTGGAGCTTTTTCACATCCGTTCATGCCCCTAATGGTGAGCCCATTGAGCATGGAGCCAGCAAAGTCTGTCAACAGCAAGGATAGCTGTTCAAATAAGAAAATGAAGGAAATTGATGGTGCGGCTGTGTCAACTGGCAGTGGCAACAGTGAAAAAACAAGTGGAGATTGCAGCTTAGAAGGATCCAGTGATGGAAACAACCAGAAGGCAAGTGGAACTCCCAAGAAAAGGAGCATAGATGATAGGCCTAAATCAGGCGTGGAAACTGGTGGAGCTTTAACACCTAATGATAGACCTAGCGAACAAGCAGCTTTGCCAAATCTATGCATTCCGGTTACAGCAATCAAACCAGACGTGAGCACTGCTAGTGACTTCAGAGTTATTGCCACCCCAGTAACTGAAGTGCCAACTAAGGATGATAAGGAATCGAAGCGCGAGAGAAGGAAGCAATCAAACAGGGAGTCTGCTCGGAGGTCAAGGTTGAGGAAGCAGGCCGAGACTGAGGAACTGGCTAGAAAAGTTGAGCTATTGACTGCGGAGAACACATCCCTTAGACGTGAAATAAGCAGGCTAACGGAAAGCTCCAAGAAACTTAGATTAGAGAATTCTGCTCTAATGGAGAAACTAACGGAAACCGGGCCTGATGAAGCACAAGAAGTGCCTCCAGTCAAAACAAAAGCACAGCAAGCTCGAGGCGTCGAAAATTTCCTGTCAATGATAGACAAGACTGGCACGCCGAGAAGCAGCGGGCACATGGATCATGCCATTGCCACGCCCAAGCTTCGTCAACTCCTGGGCTCTGGTCTGGCGACTGATGCTGTAGCCGCAAGGTAA
SEQ ID No.2：
AATAATGGTCTCAGGCGATGGTGCGGCTGTGTCAACGTTTTAGAGCTAGAAATAGCSEQ ID No.3：
ATTATTGGTCTCTAAACTGTTTTTTCACTGTTGCCACGCTTCTTGGTGCC
2. Agrobacterium-mediated genetic transformation
The recombinant plasmid obtained above is transformed into agrobacterium according to the following steps:
(1) The EHA105 Agrobacterium competence was placed on ice to melt, 2.5. Mu.g of plasmid was added to the competence, and the mixture was gently blown and mixed for 25min in an ice bath.
(2) The water bath is heated to 37 ℃ in advance, the reaction tube is quickly frozen to liquid nitrogen for 3min, and then immediately heated to 37 ℃ for 3min.
(3) 500. Mu.L of the non-resistant LB liquid medium was added thereto, followed by shaking culture at 28℃and 220rpm for 5-6 hours.
(4) After the cultivation is finished, the mixture is centrifuged at 1500rpm for 1min, part of supernatant is discarded on an ultra-clean workbench, the residual liquid is blown and mixed uniformly, a solid culture medium containing Kan and Rif resistance is coated, and the mixture is cultivated for 2-3d at 28 ℃ in an inverted mode.
(5) And (3) performing bacterial liquid PCR detection on the clones, and performing bacterial preservation after reactivating positive clones successfully detected, and storing at-80 ℃.
And (3) taking the Fuxiang of indica rice as a genetic background material to carry out genetic transformation of rice. The following operations were all performed on an ultra clean sterile bench.
First, rice callus induction is performed. Peeling off the shell of the rice seeds, placing the rice seeds into a sterilization conical flask, adding about 100mL of sterilization water, shaking the flask body at a constant speed for 3min, then discarding waste liquid, and repeating for 3 times; then adding 100mL of 75% absolute ethyl alcohol, shaking the bottle body at a constant speed for 3min, discarding waste liquid, adding sterilized water for washing, and repeating the above operation for 3 times; then adding 100mL 25% sodium hypochlorite, shaking at 220rpm for 10min, discarding the waste liquid, adding sterilized water, washing, and repeating the above operation for 8-10 times; spreading the cleaned seeds on sterilized qualitative filter paper, drying with water, placing rice seeds in NB solid medium, and culturing at 28deg.C in dark place for 15d to obtain callus.
Secondly, removing buds of rice callus and performing subculture. Removing the induced rice tissue buds, leaving light yellow callus in a new culture medium, and culturing for 2d; the calli were then divided into small pieces in new medium for subculture using sterile forceps, and the culture was continued for 15d and then subcultured again 1-2 times.
Finally, genetic transformation of rice is carried out, and the specific steps are as follows:
(6) First, the agrobacteria from which the expression plasmids were knocked out and overexpressed, which were previously stored, were cultured for 1-2d on a solid medium of Kan and Rif, while rice calli of about 2mm were selected and pre-cultured for 2d in a new medium.
(7) The agrobacteria were rinsed with AAM solution, the OD value was adjusted according to the status of the callus, and then they were cultured at 28℃for 1-2 hours.
(8) The pre-cultured callus is soaked in the activated bacterial liquid for 10min.
(9) The bacterial liquid on the surface of the callus is sucked by qualitative filter paper and is kept for 5min.
(10) The calli were transferred to co-culture solid medium and incubated at 28℃for 2d.
(11) The calli in the co-culture medium were transferred to Hyg selection medium containing 50mg/L and incubated at 28℃for 15d, co-selection for 3 times.
(12) Transferring the callus grown in the screening process into a pre-differentiation culture medium, and culturing for 15d under illumination until the callus is differentiated into green young seedlings.
(13) Transferring the green seedlings into rooting culture medium, culturing with light for 15d (light time: 14h light/10 h dark; light intensity: 200 μmol× -2*s-1; temperature: 25deg.C, humidity: 75%), carefully cleaning the solid culture medium of the roots, and culturing with rice nutrient solution.
3. Knock-out and over-expression transgenic plant detection
When the over-expressed transgenic material is detected, RNA is extracted from the rice leaves of the seedling, specific primers (the sequences are shown as SEQ ID No.4 and SEQ ID No. 5) of a target gene are designed, the expression level of OsbZIP05 on the mRNA level is detected by qRT-PCR, and the corresponding wild type material is used as a control. The detection results are shown in FIG. 2.
SEQ ID No.4：TGCCTTCATACGCTATTTATTTGC
SEQ ID No.5：TATGGACTAAGGGCTGGAT
The results showed that the expression level of OsbZIP05 gene was up-regulated in the corresponding oe#1, oe#2 and oe#3 overexpressing transgenic lines, and finally oe#1 and oe#2 were selected for phenotypic experiments (fig. 2).
When the knocked-out transgenic material is detected, DNA is extracted from the rice leaves of the seedling, a specific primer (the sequences are shown as SEQ ID No.6 and SEQ ID No. 7) near a target point is designed by a2 XCTAB method, PCR amplification is carried out, then a product is sent to a sequencing company for sequencing, the sequencing result of the knocked-out transgenic material is compared with a wild type sequence by Snapgene, and a homozygous transgenic plant is propagated for subsequent phenotypic experiments. The detection results are shown in FIG. 3.
SEQ ID No.6：CTGTAGAAGGAAGCTGGATT
SEQ ID No.7：GGCCTATCATCTATGCTCCT
The results showed that 5 positive clones were obtained by knocking out OsbZIP05, 2, 7, 19bp were deleted from OsbZIP05, 1 and 2bp were added, and the deleted 7 and 19bp material was expressed as bzip05#1 and bzip05#2 for the subsequent phenotypic experiments (fig. 3).
Example 2OsbZIP05 negative control Rice seed vigor experiment
After the homozygous transgenic plant material is obtained, the seed vitality phenotype observation is carried out. Selecting homozygous transgenic seeds and wild seeds which are mature and full in appearance and consistent in seed size, setting 3 repeats for each of 2 lines of OsbZIP05 knockout and over-expression materials, setting 100 grains for each of the lines, placing a seed net bag, and carrying out artificial accelerated seed aging treatment in a high-temperature and high-humidity (temperature 42 ℃ and humidity 88%) incubator for aging for 0d, 14 d, 21d and 28d respectively. After aging, counting the germination rate of the seeds, wherein the germination method comprises the following steps: the rice seeds are placed in a glass culture dish filled with two layers of filter paper, a standard illumination culture room (16 h in 28 ℃ illumination environment and 8h in 26 ℃ dark environment) is placed for clear water culture, and the germination rate of the seeds is counted after 10 d.
The germination rates of the OsbZIP05 knockout and overexpression material and the control group Fuxiang of the wild type at 0d, 14d, 21d and 28d were counted and analyzed, and the results are shown in fig. 4.
The results show that: (1) The germination rates of the groups of strains were consistent without significant differences when no artificial aging was performed (fig. 4B); (2) Artificial aging 14d, the germination rate of each strain was slightly reduced, the germination rate of the overexpressed strain was 81.3% slightly lower than that of the wild-type, and the knocked-out strain was not significantly different (fig. 4C); (3) Artificial aging 21D, the germination rate of the wild type of the control group is reduced to about 82%, the germination rate of the over-expressed strain is reduced to 64.6% and 66.4%, which is obviously lower than that of the wild type, the germination rate of the knocked-out strain is still 89.3% and 89.6%, which is higher than that of the wild type and has obvious difference (figure 4D); (4) The germination rate of each strain is obviously reduced after artificial aging for 28d, the germination rate of a wild type strain is about 61%, the germination rate of an over-expressed strain is only 30% and 32%, the germination rate is far lower than that of a wild type strain, the germination rate of a knocked-out strain is still 86% and 81%, and the germination rate is obviously higher than that of the wild type strain (figure 4E). The knockout strain is not significantly different from the wild type when artificially aged 14d, the strain starts to be significantly different when aged 21d and 28d, the germination rate of the over-expression strain is significantly reduced when artificially aged 14d, and the germination rate is greatly reduced when aged 21d and 28 d. Taken together, osbZIP05 negatively regulates rice seed vigor.
The above embodiments are only illustrative of the preferred embodiments of the present invention and are not intended to limit the scope of the present invention, and various modifications and improvements made by those skilled in the art to the technical solutions of the present invention should fall within the protection scope defined by the claims of the present invention without departing from the design spirit of the present invention.
Claims (4)
1. The application of the transcription factor OsbZIP05 in the negative regulation of the activity of rice seeds is characterized in that the base sequence of the transcription factor OsbZIP05 is shown as SEQ ID No. 1.
2. The use according to claim 1, wherein knocking out the transcription factor OsbZIP05 increases the vigor of rice seeds and thus the germination rate.
3. Use of a recombinant expression vector for knocking out the transcription factor OsbZIP05 in claim 1 in screening/cultivating rice varieties with high seed vigor.
4. Use of a host bacterium comprising the recombinant expression vector of claim 3 in the selection/cultivation of high seed vigor rice varieties, wherein the host bacterium is escherichia coli.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410366903.5A CN118272423A (en) | 2024-03-28 | 2024-03-28 | Application of transcription factor OsbZIP05 in negative regulation of rice seed vigor |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410366903.5A CN118272423A (en) | 2024-03-28 | 2024-03-28 | Application of transcription factor OsbZIP05 in negative regulation of rice seed vigor |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN118272423A true CN118272423A (en) | 2024-07-02 |
Family
ID=91641639
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202410366903.5A Pending CN118272423A (en) | 2024-03-28 | 2024-03-28 | Application of transcription factor OsbZIP05 in negative regulation of rice seed vigor |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN118272423A (en) |
-
2024
- 2024-03-28 CN CN202410366903.5A patent/CN118272423A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20080229447A1 (en) | Transformation of immature soybean seeds through organogenesis | |
| CN109609527B (en) | Application of CDPK18L gene as negative regulatory factor in improving resistance to bacterial leaf spot and high temperature resistance of tomato | |
| CN117757836A (en) | Application of OsHR mutant gene in improving resistance of rice to brown planthopper | |
| WO2023005160A1 (en) | Method for genetic transformation of gramineous plants | |
| CN113462689B (en) | Application of soybean gene promoters pEIF1 and pEIF1-I in soybeans, arabidopsis thaliana and tobaccos | |
| CN113265403A (en) | Soybean Dt1 gene editing site and application thereof | |
| CN116790625A (en) | Betel nut ERF116 gene and application thereof in plant organ abscission | |
| CN107557384B (en) | Genetic transformation system for inducing plant dwarfing and construction and application thereof | |
| CN113481176B (en) | Application of GA3ox1 protein in regulating alfalfa plant type | |
| CN114164229B (en) | Method for obtaining novel strawberry germplasm with high regeneration efficiency by using CRISPR/Cas9 gene knockout vector of FvePILS5 gene and application | |
| CN118272423A (en) | Application of transcription factor OsbZIP05 in negative regulation of rice seed vigor | |
| CN118086370A (en) | Application of transcription factor OsbZIP62 in negative regulation of rice seed vigor | |
| CN106086063B (en) | RNAi vector constructed based on isocaudarner and application thereof | |
| CN114958866B (en) | Gene for regulating soybean branch number and application thereof | |
| CN116769799B (en) | Soybean mutant gene for improving yield of leguminous crops and application thereof | |
| CN116286850B (en) | Negative regulation gene for false smut resistance of rice and application thereof | |
| CN113136388B (en) | Application of rice OsMAPKKK5 gene in aspect of improving plant height and grain type of rice | |
| CN114231556B (en) | Application of GmECT2 in regulating plant height | |
| WO2023216046A1 (en) | Gene for regulating and controlling number of soybean branches, and use thereof | |
| CN116751791B (en) | Application of PvPSK3 gene in improving genetic transformation efficiency of gramineous plants | |
| CN115927363B (en) | Cymbidium CgARF8 gene and application thereof | |
| CN110423753B (en) | Root knot specific promoter T106-P induced by root knot nematode and application | |
| CN118638821A (en) | Rice CDPK20 gene and application thereof in improving plant abiotic stress resistance | |
| CN116083460A (en) | Rice ribonuclease gene OsRNS4 and encoding protein and application thereof | |
| CN118652875A (en) | Paddy PD1 gene and application thereof in improving plant abiotic stress resistance |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |