CN110423753B - Root knot specific promoter T106-P induced by root knot nematode and application - Google Patents

Abstract

The invention discloses a root knot specific promoter T106-P induced by root knot nematodes and application thereof. The root knot specific promoter T106-P induced by the root knot nematode is expressed by SEQ ID NO: 1. The primer pair comprises a first primer and a second primer, wherein the sequence of the first primer is shown in SEQ ID NO:2, and the sequence of the second primer is shown as SEQ ID NO:3, respectively. The invention takes the tomato underground part and the overground part inoculated with the enterolobium cyclocarpum meloidogyne for 21 days and the underground part not inoculated with the tomato for carrying out transcriptome sequencing analysis, screens out candidate genes which are specifically expressed at the root and have obvious expression quantity difference when infected by the enterolobium cyclocarpum meloidogyneT106. The invention successfully obtains a promoter T106-P specifically expressed in root knot during root knot nematode infectionProvides a proper promoter for the breeding of transgenic nematode resistance, and can be used for breeding safe and efficient root-knot nematode resistance transgenic plant varieties.

Description

Root knot specific promoter T106-P induced by root knot nematode and application

Technical Field

The invention belongs to the technical field of plant genetics, and particularly relates to a root knot specific promoter T106-P induced by root knot nematodes and application thereof.

Background

Root-knot nematode disease (C)Meloidogynespp.) is an obligate sessile endoparasitic nematode that damages the plant root system, develops severe attacks on lateral and fibrous roots, and induces root distortion in plants to form root knots. The root-knot nematode is called the most destructive pathogen in the world due to strong adaptability, various propagation ways, wide host range and great harmfulness. Meloidogyne incognita (C.) (M.incognita) Meloidogyne incognita (C)M.hapla) Root-knot nematode of Java: (A)M.Javanica) And root-knot nematode of peanut: (M.arenaria) Is a representative species of Meloidogyne, also a common species in China, in recent years, the Meloidogyne enterolobii (A. Johnson)M.enterolobii) Has been on the rise, has a wide host range, can overcome all resistance genes known at present, and has been taken as an important quarantine object internationally.

Root knot nematode disease mainly damages the roots of plants, usually shows no symptoms above the ground at the early stage of root knot nematode infection, and shows dwarfing, yellowing, wilting and weak growth when the root knot nematode is seriously damaged. The root-knot nematode population has strong reproductive capacity, is easy to spread, has multiple hosts, is stubborn and hidden, is difficult to control and poses serious threat to agricultural production. On one hand, the root-knot nematode damages crops by invading host plant tissues to absorb plant nutrients, secrete enzymes, toxins and other substances and induce the host plants to generate pathological changes; on the other hand, the nematode invades plant tissues to cause wounds, and causes pathogen compound infection such as fungi, bacteria, viruses and the like.

Root-knot nematodes can be parasitic on more than 3000 plants, with up to 100 commercial crops including herbaceous plants, woody plants, dicotyledonous plants and monocotyledonous plants, distributed throughout crops such as flowers, vegetables, economic plants, medicinal plants, fruit trees, food crops and the like, and cause economic losses of up to 1570 billion dollars in tropical, subtropical and temperate regions. In recent years, root-knot nematode diseases tend to rise, yield is reduced by 30-50% after the root-knot nematode diseases occur, and the yield reaches more than 70% in serious cases, so that crop failure is caused.

Because the parasitic characteristics of root-knot nematodes make the prevention and control of root-knot nematode diseases extremely difficult, the traditional prevention and control idea is to apply chemical, physical and biological factors which are unfavorable for the nematodes in soil, act on root-knot nematode eggs and second-instar larvae exposed in the soil, reduce the probability of successful invasion of the nematodes into hosts, and achieve the purpose of controlling diseases. The main control methods at present are chemical control, biological and agricultural control.

Chemical control has been the main subject of disease control because of its rapid onset of action, strong pertinence, and many chemical nematicides such as fenoxaprop, methyl bromide, etc. have been banned or limited in use gradually because of the presence of high toxicity, high residue, pathogen resistance, and other side effects.

Biological control mainly utilizes natural enemies and microbial resources of nematodes to control the nematodes, and is a relatively environment-friendly control method which is gradually developed in recent years, but many researches are only developed indoors, and practical application is lacked in production practice.

The agricultural prevention and control comprises planting disease-resistant varieties, reasonable rotation, planting predatory plants, grafting and the like. The crop rotation disease prevention is widely used, the limitation of the host of the root-knot nematode is utilized, but the rotation has certain limitation, and the crop rotation method is not suitable for the prevention and the treatment of the root-knot nematode with a wider host range.

Because of the obvious defects of chemical, biological and agricultural control, exploring an efficient and safe root-knot nematode control technology has become a common direction of effort for plant pathologists in various countries. With the development of recombinant DNA technology, the establishment of exogenous DNA introduction system, the improvement of plant tissue culture technology, and the continuous and deep research on nematode infection mode and plant self-disease-resistant defense system, the disease-resistant variety has become the first choice for research and development due to the advantages of economy, safety, high efficiency, environmental friendliness and the like. Genetic engineering breeding has become the most interesting breeding method in recent years due to its advantages of short cycle, high efficiency, durable resistance, easy planting and cultivation, broad-spectrum resistance, etc. In the genetic engineering breeding process, a promoter gene and a nematode-resistant major gene are two necessary elements, and a proper promoter gene and a proper nematode-resistant major gene are selected, so that the promoter drives the nematode-resistant gene to express in a plant body as required, and the key of the genetic engineering breeding is.

The constitutive promoter can drive the target gene to be efficiently expressed in all tissues of an organism, so that the expression quantity of the target gene is constant at a certain level and is not expressed in a plant under the condition of space-time limitation or induction of a certain substance. However, the constitutive promoter drives the non-specificity and continuous expression of the exogenous gene in the recipient plant, which increases the burden of the plant, and the expected effect cannot be achieved due to too low expression level at a specific tissue part or a specific time when the gene is required to be expressed in a large amount, which gradually exposes some defects in practical application.

Tissue-specific promoters, also known as organ-specific promoters, regulate the efficient expression of foreign genes in specific tissues and organs of plants, and usually exhibit developmental regulation characteristics, and such specificity is usually based on the existence of specific plant tissue cell structures and chemical-physical signals.

In the process of genetic engineering breeding, it is often desired that the inserted exogenous gene can be expressed in a specific tissue of a plant, so as to increase the regional expression level and avoid unnecessary waste of nutrients in the plant, thereby reducing the burden of the plant and alleviating the influence on agronomic traits of crops, so as to obtain useful traits, and thus the expression of a target gene needs to be regulated and controlled by an effective tissue-specific promoter. Therefore, the tissue specific promoter becomes the most promising promoter element of the exogenous gene in the transgenic research, and has become a hotspot and frontier field of plant molecular biology research in recent years.

In the aspect of transgenic breeding for disease resistance of root-knot nematodes, research on resistance mechanisms of plants to the root-knot nematodes has made great progress, for example, by utilizing structural resistance of plants to root-knot nematode diseases, disease resistance or defense related genes of plants, toxic protein genes with inhibiting effect on the root-knot nematodes, dsRNA or siRNA structures capable of generating RNA interference on pathogenic related genes of the nematodes, some transgenic plants capable of remarkably reducing root-knot nematode infection are obtained, but a disease-resistant variety for commercial production is still not formed so far, and one important reason is lack of a suitable gene promoter.

Disclosure of Invention

The first purpose of the invention is to provide a root knot specificity promoter T106-P induced by root knot nematode; the second purpose is to provide a group of primer pairs for amplifying the root knot specific promoter T106-P induced by the root knot nematode; the third aim is to provide a recombinant expression vector containing the root knot specific promoter T106-P induced by root knot nematodes; the fourth purpose is to provide an expression cassette; the fifth purpose is to provide the application of the root knot specific promoter T106-P induced by the root knot nematode.

The first object of the present invention is achieved by the fact that said root knot specific promoter T106-P induced by root knot nematode is encoded by the amino acid sequence of SEQ ID NO: 1.

The second purpose of the invention is realized by that the primer pair comprises a first primer and a second primer, and the sequence of the first primer is shown as SEQ ID NO:2, and the sequence of the second primer is shown as SEQ ID NO:3, respectively.

The third purpose of the invention is realized by that the recombinant expression vector is a recombinant plasmid T106-P-T to be constructedFor A useHindIII andNcoi double digestion, gel recovery of insert T106-P promoter and simultaneous useHindIII andNcocarrying out double enzyme digestion on a pCambia1304 vector, recovering a pCambia1304 vector fragment with the 35S promoter removed, connecting an insert fragment T106-P promoter and the pCambia1304 vector fragment with the 35S promoter removed to obtain a recombinant plasmid P1304-T106-P; in the recombinant expression vector, the root knot specific promoter T106-P induced by the root-knot nematode is connected to the upstream of a GUS gene.

The fourth object of the present invention is achieved in that said expression cassette comprises the root knot specific promoter T106-P induced by root knot nematode as defined in claim 1.

The fifth purpose of the invention is realized by the application of the root knot specific promoter T106-P induced by root knot nematode in obtaining safe and efficient root knot nematode-resistant transgenic plant varieties.

Constitutive expression promoters are used in the prior transgenic plants, are the earliest and most widely applied promoters in plant genetic engineering, and are characterized in that the expression is continuous and the expression quantity is basically constant, but the exogenous gene has low expression efficiency in a receptor plant body, the expression product is unstable, even phenomena such as gene inactivation or silence and the like occur, the normal growth and development of the plants are influenced, even the plants die, and the transgenic plants cannot be put into practical application. The selection of tissue-specific promoters to construct plant expression vectors for regulating the timing, positioning and quantitative expression of exogenous genes in plants is an important strategy for solving the problems.

In the interaction between the root-knot nematode and the plant, the root-knot nematode induces the plant to form giant cells and keeps the giant cells as the key of the parasitic damage of the root-knot nematode, finds out the plant major gene for controlling the formation and the maintenance of the giant cells, is favorable for deeply understanding the pathogenic mechanism of the root-knot nematode, clones the gene promoter specifically expressed at the root knot position induced by the root-knot nematode, and is favorable for obtaining the efficient root-knot nematode resistant transgenic material.

The invention takes the tomato underground part and the overground part inoculated with the enterolobium cyclocarpum meloidogyne for 21 days and the underground part not inoculated with the tomato for transcriptionGroup sequencing analysis, screening out candidate genes which are specifically expressed in roots and have obvious expression quantity difference when being infected by root-knot nematodesT106。

InterceptingT106Predicting the possible position of a transcription initiation site by using bioinformatics software for an upstream 1.5kb fragment, designing a specific primer, carrying out promoter target region amplification, and carrying out amplification to obtain the target geneT106The gene promoter fragment is 2506bp.

The 35S promoter of pCambia1304 is replaced by the amplified predicted gene promoter fragment, and a new plant expression vector P1304-106-P is constructed. Transforming tomato to obtain transgenic positive tomato seedling with normal development.

The successfully screened transgenic tomato seedlings are transplanted into soil, and the seedlings are respectively inoculated with the enterolobium cyclocarpum meloidogyne and the meloidogyne incognita for 21 daysGUSGene staining is carried out to verify the activity of the T106-P promoter, and the predicted promoter T106-P can be startedGUSThe gene is specifically expressed at the root node. Fluorescent quantitative PCR detection proves that the promoter can be started by 35S promoterGUSCompared with the stable expression of genes at various parts of plants, the T106-P promoter is positioned at the root nodeGUSThe relative expression quantity of the gene is obviously higher than that of root systems and overground parts without root knots.

Experimental results show that the promoter T106-P specifically expressed in root knot when the root knot nematode is infected is successfully obtained, a proper promoter is provided for transgenic nematode-resistant breeding, and the promoter can be used for breeding safe and efficient root knot nematode-resistant transgenic plant varieties.

The invention provides a root knot specificity promoter induced by root knot nematode, wherein the nucleotide sequence of the root knot specificity promoter is a T106-P promoter sequence shown in SEQ ID No. 1.

Gene amplification Using specific primersT106The primer sequence of the promoter fragment of (1) is shown as SEQ ID No.2/SEQ ID No.3, and the nucleotide sequence of the amplified T106-P promoter is shown as SEQ ID No. 1. And (3) carrying out gel recovery on the PCR product of the amplified T106-P promoter sequence for the next TA cloning.

The TA cloning vector selects pEASY-T1, the recombinant plasmid T106-P-TA is obtained after the T106-P promoter gene fragment is connected to the vector pEASY-T1,use ofHindIII andNcothe T106-P-TA double enzyme digestion is carried out, the accuracy of the connected promoter fragment is verified, and the method is used for the next step for constructing the plant expression vector.

The constructed recombinant plasmid T106-P-TA is usedHindIII andNcoi double digestion, gel recovery of insert T106-P promoter and simultaneous useHindIII andNcothe pCambia1304 carrier is subjected to double enzyme digestion, the pCambia1304 carrier fragment with the 35S promoter removed is recovered, the insert fragment T106-P promoter is connected with the pCambia1304 carrier fragment with the 35S promoter removed, and the recombinant plasmid P1304-T106-P is obtained.

PCR verification is carried out on the constructed plant expression vector P1304-T106-P to ensure that the T106-P promoter fragment is correctly connectedGUSPreceding the gene, using simultaneouslyHindIII andNcoand I, carrying out double enzyme digestion verification on the constructed plant expression vector P1304-T106-P.

The P1304-T106-P plant expression vector successfully constructed is transferred into the agrobacterium strain EHA105 by an electric shock method. The plates were plated and resistance selection was performed by YM medium plates (rifampicin 25 mg/L, kanamycin 50 mg/L).

The YM culture medium refers to that quantitative YM dry powder is weighed according to the specification of the YM culture medium, dissolved in 1L deionized water, and sterilized at the high temperature of 121 ℃ for 20 min. Taking out after sterilization, cooling, and adding 50 mg/L kanamycin and 50 mg/L rifampicin.

Selecting a single colony, and shaking the colony at 28 ℃ for 48 hours until the OD value of the bacterial liquid reaches 0.6-0.8.

Centrifuging and resuspending, taking out the culture bottle when OD value of Agrobacterium liquid reaches 0.6-0.8, pouring the liquid into a sterile 50 mL centrifuge tube in a super clean bench, centrifuging at 5000 r/min and 4 ℃ for 12 min. Taking out the centrifuge tube after centrifugation, pouring out the supernatant on an ultra-clean workbench, adding a heavy suspension liquid culture medium, suspending to OD value of 0.3, adding AS (acetosyringone) with the concentration of 100 mu mol/L, and mixing uniformly for later use.

The heavy suspension liquid culture medium is prepared by adding 20 g/L D-glucose and 10 g/L sucrose to MS basal culture medium, and sterilizing at 117 deg.C for 20 min.

And (3) carrying out PCR screening on the recombinant bacteria liquid by using a specific primer, wherein the sequence of the primer is shown as SEQ ID No.4/SEQ ID No.5, selecting 7 single colonies on a flat plate for transforming a P1304-T106-P vector, carrying out PCR verification to obtain 2 positive strains, sending the positive strains to a sequencing company for sequencing, and storing the recombinant bacteria liquid with correct sequencing at-80 ℃. And storing a part of streaked plates for further co-culture with tomato callus to obtain transgenic tomato seedlings so as to verify the activity of the T106-P promoter.

Tomato seeds were disinfected using the sodium hypochlorite method.

Inoculating the aseptic tomato seeds into a seedling culture medium for culturing.

The sprouting culture medium refers to 1/2MS +30 g/L sucrose +8 g/L agar, the pH of the culture medium is =5.8, and the high-temperature sterilization is carried out for 20 min at 121 ℃.

After the seeds grow in a sprouting culture medium for 10-15 days, tissue blocks with the size of about 2-5 mm multiplied by 2-5 mm are cut from young sterile tomato seedling leaves and placed on an induction culture medium with proper interval of about 5 mm.

The induction culture medium is MS +2 mg/L ZT +0.2 mg/L IAA +30 g/L sucrose +8 g/L agar, and is sterilized at the high temperature of 121 ℃ for 20 min.

And selecting the fresh yellow compact callus every 10 days for subculture, and obtaining the callus with good growth state and fresh yellow color after two subcultures, wherein the callus can be used as a receptor for infection transformation of agrobacterium tumefaciens.

The callus is taken and re-suspended and added with AS (acetosyringone) in Agrobacterium tumefaciens liquid, and soaked for 30 min at 100 rpm and 20 ℃. Placing the callus materials on a culture dish paved with sterile filter paper in a clean bench for air drying to finish the transfection of the recombinant agrobacterium.

Transferring the infected callus material into a co-culture medium, and performing dark culture at 18 ℃ for 2-3 d.

The co-culture medium is MS +20 g/L sucrose +10 g/L glucose +8 g/L agar +100 mu mol/L AS, and is sterilized at the high temperature of 118 ℃ for 20 min.

Transferring the callus to a screening culture medium, wherein the callus of the plant expression vector with the resistance gene successfully transformed can grow on the culture medium containing the screening resistance, and the callus without the resistance gene transferred slowly browns and dies.

The screening culture medium refers to MS +2 mg/L ZT +0.2 mg/L IAA +30 g/L sucrose +8 g/L agar +600 mg/L cef +20 mg/L Hyg. Wherein IAA, cef and Hyg are sterilized at 121 deg.C for 20 min.

And (4) differentiating and growing new buds on the screening culture medium, and transferring the buds to a rooting culture medium to induce rooting.

The rooting medium is 1/2MS +0.1 mg/L IBA +150 mg/L Cef, and is sterilized at the high temperature of 121 ℃ for 20 min.

And (3) carrying out PCR detection on the obtained transgenic plant by using a cross-sequence primer pair of the verification plant expression vector, wherein the primer sequence is shown as SEQ ID No.4/SEQ ID No.5, and the verification proves that the target gene T106-P promoter is successfully transferred into the tomato genome.

Transplanting the positive transgenic tomato plant growing well in the rooting culture medium into cultivation soil for strengthening the seedling.

The cultivation soil is prepared by mixing nutrient soil and sand according to a ratio of 1.

When the transgenic tomato plants grow well, 2000 young elephant-bean root-knot nematodes and two-instar southern root-knot nematodes are inoculated to each pot of transgenic tomato seedlings under the same condition. After 1 month of inoculation, the transgenic tomato grows root knot, and the process is carried outGUSAnd (3) carrying out tissue staining detection on gene activity.

GUSThe staining results show that the T106-P promoter is only blue-stained at the root knot of the enterolobium cyclocarpum and meloidogyne incognita after infection, and the tomato root system and the leaves on the overground part which are not infected by the meloidogyne incognita are not blue-stained. After the 35S promoter transgenic tomato seedlings are infected by root-knot nematodes, the root knots and the non-root knots, namely the whole root system, are stained blue.

Extracting RNA of transgenic tomato plant, reverse transcribing into cDNA, fluorescent quantitative PCR detectionGUSRelative expression level of gene.

The detection result shows that in the T106-P promoter transgenic tomato plant, the root node isGUSThe relative expression quantity of the gene is obviously higher than that of the root system and the overground part at the root-free node,GUSthe gene is located on the overground part of a T106-P transgenic tomato plant andno expression was detected in the root system without root nodes. In the transgenic tomato plant of 35S promoter, the root node, the root system without root node and the overground partGUSThe relative expression quantity of the genes has no obvious difference,GUSthe relative expression amount of the genes is basically consistent.

The result shows that the T106-P promoter and the 35S promoter provided by the invention have different expression conditions in each part of plant tissues, and compared with a 35S constitutive promoter, the root knot specific promoter T106-P induced by root knot nematode is specifically and stably expressed at a root knot position. The T106-P promoter provided by the invention can be used for breeding of meloidogyne enterolobii and can also be used for breeding of meloidogyne incognita in the current dominant population of meloidogyne incognita.

Drawings

FIG. 1 is an electrophoretogram of the T106-P promoter fragment;

FIG. 2 is a gel recovery electrophoresis diagram of a T106-P promoter fragment;

FIG. 3 is a T106-P-TA vector double-restriction enzyme electrophoresis diagram;

FIG. 4 shows the structure of the vector pCambia 1304;

FIG. 5 is a schematic diagram of construction of an expression vector P1304-T106-P;

FIG. 6 is the plant expression vector P1304-T106-P PCR identification electrophoresis picture;

FIG. 7 is a double-restriction enzyme identification electrophoresis diagram of plant expression vector P1304-T106-P and vector pCambia 1304;

FIG. 8 is a PCR identification electrophoresis diagram of the bacterial liquid after agrobacterium tumefaciens transformation of plant expression vector P1304-T106-P;

FIG. 9 is a transgenic tomato seedling;

FIG. 10 is a PCR detection electrophoretogram of transgenic tomato plants;

FIG. 11 shows the inoculation of strong seedlings of transgenic tomato seedlings and meloidogyne enterolobii;

FIG. 12 is a drawing showingGUSDyeing;

FIG. 13 shows fluorescent quantitative PCR assayGUSRelative expression level of gene.

Detailed Description

The present invention is further described with reference to the following examples and drawings, but the present invention is not limited thereto in any way, and any modifications or alterations based on the teaching of the present invention are within the scope of the present invention.

The root knot specific promoter T106-P induced by the root knot nematode is expressed by SEQ ID NO: 1.

The invention discloses a group of primer pairs for amplifying root knot specific promoter T106-P induced by root knot nematodes, wherein the primer pairs comprise a first primer and a second primer, and the sequence of the first primer is shown as SEQ ID NO:2, and the sequence of the second primer is shown as SEQ ID NO:3, respectively.

The recombinant expression vector containing the root knot specific promoter T106-P induced by root-knot nematodes is used for the constructed recombinant plasmid T106-P-TAHindIII andNcoi double enzyme digestion, gel recovery of the insert T106-P promoter, simultaneous useHindIII andNcocarrying out double enzyme digestion on a pCambia1304 vector, recovering a pCambia1304 vector fragment with the 35S promoter removed, connecting an insert fragment T106-P promoter and the pCambia1304 vector fragment with the 35S promoter removed to obtain a recombinant plasmid P1304-T106-P; in the recombinant expression vector, the root knot specific promoter T106-P induced by the root-knot nematode is connected to the upstream of a GUS gene.

The expression cassette of the invention comprises a root knot specific promoter T106-P induced by root knot nematodes.

The application of the root knot specific promoter T106-P induced by the root knot nematode is the application of the root knot specific promoter T106-P induced by the root knot nematode in obtaining a safe and efficient root knot nematode-resistant transgenic plant variety.

The invention is further illustrated by the following specific examples:

biological material

The enterolobium cyclocarpum meloidogyne and the meloidogyne incognita are stored in the laboratory.

The plant material tomato variety is Rutgers and is stored in the laboratory.

Main instrument and reagent

The instrument comprises the following steps: PCR instrument, centrifuge, electrophoresis apparatus, electric shock conversion apparatus, constant temperature incubator, water bath, tissue culture bottle, culture dish, alcohol lamp, forceps, scalpel, fluorescence quantitative PCR instrument (CFX 96, BIO-RAD)

Reagent: tris, concentrated HCl, EDTA-Na ₂ NaCl, CTAB, mercaptoethanol, LA-Taq DNA polymerase, agarose, TAE buffer solution, all-size gold gel recovery Kit, pEASY-T1 Simple Cloning Kit (all-size gold), DH5 alpha competence, LB medium (liquid/plate), omega plasmid extraction Kit, DNA A-labeling Kit (Takara), pCAMBIA1304, restriction enzymeEcoRⅠ、HindIII andNcoi, T4 ligase, agrobacterium EHA105, indoleacetic acid (IAA), 6-Benzylaminopurine (6-benzaminopurine, 6-BA), 2,4-Dichlorophenoxyacetic acid (2, 4-Dichlorophenoxyacetic acid,2, 4-D), zeatin (zeatin, ZT), acetosyringone (AS), rifampicin (Rifampin, rif), kanamycin sulfate (Kanamycin, KM), ampicillin (Amicilin), hygromycin (Hygromycin, hyg) 10% sodium hypochlorite solution, alcohol (reagent for domestic analysis), sucrose, glucose, MS medium, YM medium,GUSStaining kit (coolaber), reverse transcription kit were purchased from Dalibao bio, SYBR dye, TRIZOL extraction kit from Quanjin.

Example 1

Isolation of promoter sequences

1. Plant DNA extraction

Extracting by CTAB method. The specific operation process is as follows:

solution preparation: preparing CTAB extracting solution according to the following proportion: 100 mmol/L Tris-HCl (pH8.0), 20 mmol/L EDTA-Na2,1.4 mol/L NaCl, 2% CTAB, before use 0.1% (V/V) beta mercaptoethanol is added. Wherein Tris-HCl and EDTA-Na2 need to be prepared into 1M and 0.5M solution in advance respectively, the pH value is adjusted to the required value, and after sterilization, CTAB solution with corresponding concentration is prepared together with other components.

1) Taking out about 1.0 g of fresh tomato root tissue, placing in a clean mortar prepared in advance, quickly pouring liquid nitrogen, quickly grinding into powder, continuously adding liquid nitrogen in the middle, transferring into a centrifuge tube containing 1.2 mL of CTAB extract subjected to warm bath at 65 ℃, adding 30 mu L of beta-mercaptoethanol, fully mixing, and carrying out warm bath at 65 ℃ for 50 min.

2) Cooled to room temperature and centrifuged at 12000 rpm at 4 ℃ for 15 min.

3) Taking the supernatant into a new centrifuge tube, adding equal volume of chloroform: isoamyl alcohol (24.

4) Taking the supernatant, adding anhydrous ethanol with twice volume, slowly turning upside down to see milky flocculent precipitate, centrifuging, removing the supernatant, washing with 70% and 100% ethanol, and air drying.

5) The DNA crude precipitate was dissolved by adding 600. Mu.L of ddH2O, and 2. Mu.L of 10 mg/mL RNase was added and incubated at 37 ℃ for 1 hour.

6) 500 μ L of the supernatant was transferred to a new centrifuge tube, 350 μ L of isopropanol was added, the mixture was inverted several times, left at room temperature for 10 min, and centrifuged at 13000 rpm for 15 min at 4 ℃.

7) The supernatant was added with 1/3 volume of 3M NaAc (pH 5.2) and 2 volumes of absolute ethanol and left at-20 ℃ for 2 hours or overnight.

8) Centrifuging at 13000 rpm for 10 min at 4 deg.C, observing milky flocculent precipitate at the bottom of the tube, carefully pouring off ethanol, gently sucking off excess liquid with a pipette tip, and drying.

9) Adding 30-60 μ L sterile ddH2O to dissolve DNA precipitate, and storing at-20 deg.C.

2. Promoter sequence amplification and recovery

2.1 primer design and determination of restriction enzyme sites

The predicted promoter activity was verified by using the plant expression vector pCambia1304, and the 35S promoter of the vector pCambia1304 was replaced with the cloned promoter fragment. The promoter T106-P sites were chosen as Hind III and Nco I sites based on the plasmid vector pCambia1304 map (FIG. 1) in combination with the promoter target sequence. Primer design software Primer Premier and Oligo7 are used for designing primers, and a promoter sequence T106-P is amplified after a restriction enzyme site sequence and a protective base are added. The final designed amplification primers were as follows:

T106-P-F：5’-CCCAAGCTTGAGCATGGAGCATGACGTATAACG-3’（SEQ ID No.2）

T106-P-R：5’-CATGCCATGGAACTTTGGAATCCTATGCCTTTG-3’（SEQ ID No.3）

and (3) PCR reaction system:

PCR reaction procedure: 95 ℃ for 3 min;35 cycles of 94 deg.C, 1min, 60 deg.C, 1min, 72 deg.C, 3 min;72 deg.C, 10 min.

And detecting the PCR product obtained after amplification by using 1.2% agarose gel electrophoresis, wherein the length of the T106-P promoter sequence is 2506bp as a promoter target sequence of a downstream experiment as shown in an electrophoretogram of a T106-P promoter fragment shown in figure 1.

2.2 recovery of fragments of interest

The gel recovery kit is used for recovering the target fragment, and the specific operation process is as follows:

1) A0.8% agarose gel was prepared using 1XTAE as a buffer, and the PCR stock solution was subjected to agarose gel electrophoresis to isolate the objective gene product.

2) In an ultraviolet gel cutter, a gel block containing the band of the target fragment, about 0.1 g, is cut and placed into a clean sterile 1.5 mL centrifuge tube.

3) Adding 3 times of the GSB solution (300 mL) in volume, melting the gel in water bath at 55 ℃ for 5-10 min until the gel mass is completely melted, and adding isopropanol (100 mL) in one time in volume into the melted gel solution to increase the recovery amount of DNA.

4) When the melted gel solution is cooled to room temperature, the solution is added into a centrifugal column to be kept stand for 1min, and is centrifuged at 13000 rpm for 1min, and effluent is discarded.

5) 650. Mu.L of WB solution was added, and the mixture was centrifuged at 13000 rpm for 1min, and the effluent was discarded.

6) And (5) repeating the step 5), and centrifuging the hollow tube for 2 min to completely remove the residual WB.

7) Placing the column in a clean 1.5 mL centrifuge tube, opening the cover, standing for 3 min, air drying ethanol completely, adding 30 μ L preheated deionized water into the center of the column, and standing at room temperature for 3 min.

8) 13000 rpm for 2 min, eluting DNA, and storing at-20 ℃.

The recovery result of the T106-P promoter fragment gel is shown in the electrophoresis picture of the T106-P promoter fragment gel recovery shown in FIG. 2. The size of the target fragment recovered from the gel is 2506bp, and the target fragment is used as the next TA clone.

3. Cloning of promoter sequence TA

3.1 ligation of the fragment of interest to the vector

The specific operation process is as follows:

PCR recovery product 4.5. Mu.L

pEASY-T1 vector（10 ng/μL） 0.5 μL

Solution I 5.0 μL

Mixing gently, and connecting at 25 deg.C for 30 min.

3.2 transformation and screening of ligation products

The specific operation process is as follows:

1) The DH 5. Alpha. Competence was removed from the ultra-low temperature refrigerator and thawed on ice, 10. Mu.L of the ligation product was gently added to 100. Mu.L of E.coli DH 5. Alpha. Competence, gently mixed and then placed on ice for 30 min.

2) The mixture was heat-shocked at 42 ℃ for 90 s and immediately allowed to stand in an ice bath for 3 min.

3) Adding 500 μ L of preheated LB liquid medium, and shaking-culturing at 37 deg.C and 220 r/min for 1 h.

4) Centrifuging at 3000 rpm for 1min, sucking 200 μ L of supernatant, collecting 100 μ L of recovered bacterial liquid, spreading on LB medium plate containing Amp (100 μ g/mL), inverting the plate, and culturing in 37 deg.C incubator for 12-16h.

5) Picking single white bacterial plaque on a clean bench, putting the bacterial plaque into a liquid LB culture medium containing antibiotic Amp, and shaking the bacterial plaque at 37 ℃ and 190 rpm for 8-12 h.

3.3 plasmid extraction

The method comprises the following specific operation processes of extracting plasmids in escherichia coli liquid by using a full-type gold plasmid DNA small-quantity extraction kit:

1) Taking the overnight cultured bacterial liquid, centrifuging at 13000 rpm for 1min, taking out the supernatant, and centrifuging and collecting for multiple times.

2) Adding 250 mu L of colorless solution RB (containing RNase A), and shaking to suspend the bacterial pellet until all the bacterial pellet is suspended.

3) Adding 250 mu L of blue solution LB, mixing evenly for 4-6 times by warm and tumbling to ensure that the thalli are fully cracked, and indicating that the bacteria liquid is completely cracked when the color is changed from semi-transparent to transparent blue, wherein the time is generally not more than 5 min.

4) Adding 350 μ L yellow solution NB, mixing gently for 5-6 times until the color of blue turns yellow completely to form yellow aggregate, and standing at room temperature for 2 min.

5) Centrifuging at 13000 rpm for 10 min, carefully sucking the supernatant into a centrifugal column, centrifuging at 13000 rpm for 1min, and discarding the effluent.

6) 650. Mu.L of WB solution was added, centrifuged at 13000 rpm for 1min, and the effluent was discarded.

7) And (5) repeating the step 6, centrifuging for 2 min by using an empty centrifugal column at 13000 rpm, and removing residual WB.

8) Placing the centrifugal column in a clean centrifugal tube, drying in the air, adding 30 μ L sterile deionized water into the center of the column, standing for 3 min, centrifuging at 13000 rpm for 2 min, and eluting plasmid DNA.

3.4 double enzyme digestion assay

The extracted plasmid T106-P-TA is subjected to double enzyme digestion detection by using restriction enzymes Hind III and Nco I, and the specific operation process is as follows:

enzyme digestion system:

TA plasmid 4. Mu.L

10xK 2 μL

0.1% BSA 2 μL

HindⅢ/NcoⅠ 1 μL

The volume is fixed to 20 mu L

After gentle mixing, the mixture was incubated at 37 ℃ overnight and the double digested fragments were gel recovered in 0.8% agarose gel. The double-enzyme digestion result of the T106-P-TA vector is shown in a T106-P-TA vector double-enzyme digestion electrophoresis chart in figure 3, the accuracy of the connecting fragment is verified, and the connecting fragment is used for the construction of the plant expression vector in the next step.

Example 2

Plant expression vector construction

The construction of the plant expression vector takes a vector pCambia1304 as a framework, the structure of the vector pCambia1304 is shown in figure 4, the plant expression vector P1304-T106-P is constructed, and the construction schematic diagram of the plant expression vector P1304-T106-P is shown in figure 5.

1. Cleavage of pCambia1304 vector

The vector pCambia1304 was double-digested with the restriction enzymes Hind III and Nco I, yielding P1304H/N. The digestion was carried out according to the digestion system and reaction conditions described in 3.4 of example/1.

2. T4 enzyme ligation and transformation

2.1 connection

Connecting the target fragment and the double-digested linear vector by adopting T4 ligase, wherein a connecting system is as follows:

promoter fragment 16.5. Mu.L

P1304 H/N 4 μL

10×T4 ligase buffer 2.5 μL

T4 ligase 2. Mu.L

2.2 transformation

The total reaction system was 25. Mu.L, gently mixed and ligated overnight at 16 ℃. The constructed plasmid was introduced into E.coli DH 5. Alpha. Competence. The transformation was carried out as described in 3.2 of example one.

3. Identification of recombinant plasmids

3.1 PCR identification

Designing a primer to carry out PCR identification on the constructed plant expression vector P1304-106-P, and detecting whether the promoter sequence correctly replaces the 35S promoter in the vector pCambia1304 and is correctly inserted in front of a GUS region of a reporter gene. Therefore, the position of the designed pre-primer should be located in the target sequence of the promoter, and the position of the post-primer should be located in the GUS region of the pCambia1304 vector. Primers were designed using the software Primer Premier and Oligo7, and the final designed Primer sequences were as follows:

P1304-106-P-F：5’-TTTCTCAAGTAAAATCTACCCAA-3’（SEQ ID No.4）

P1304-106-P-R：5’-TTCTACAGGACGTAAACTAGCT-3’（SEQ ID No.5）

and (3) PCR reaction system:

PCR reaction procedure: 95 deg.C for 3 min;35 cycles of 94 deg.C, 1min, 54 deg.C, 1min, 72 deg.C, 1 min;72 deg.C, 10 min.

The PCR product obtained after amplification was detected by electrophoresis on 1.2% agarose gel. The plant expression vector P1304-T106-P PCR identification result is shown in a plant expression vector P1304-T106-P PCR identification electrophoretogram shown in figure 6, and the P1304-T106-P is verified to ensure that the promoter fragment is correctly connected to the upstream of the GUS gene.

3.2 double restriction enzyme assay

The constructed binary vector P1304-106-P is subjected to double enzyme digestion identification by using restriction enzymes Hind III and Nco I. The digestion was carried out according to the digestion system and reaction conditions described in example 3.4. The results of double-restriction enzyme identification of the plant expression vector P1304-T106-P and the vector pCambia1304 are shown in FIG. 7, which is a double-restriction enzyme identification electrophoretogram of the plant expression vector P1304-T106-P and the vector pCambia 1304.

Example 3

EHA105 agrobacterium transformed by recombinant plasmid

1. Preparation of electrotransformation EHA105 Agrobacterium

The specific operation process is as follows:

1) The strain EHA105 was removed from the freezer at-80 ℃ and the Agrobacterium EHA105 was streaked on YM plates (containing Rif 25 mg/L).

2) Single colonies were picked in 2 mL YM liquid medium (containing Rif 25 mg/L) and activated overnight at 28 ℃.

3) Inoculating 1 mL of activated bacterial solution into 50 mL of YM liquid culture medium, and culturing at 28 deg.C and 200 rpm until OD value is 0.4-0.5.

4) Transferring the bacterial liquid into a sterile 50 mL centrifuge tube, centrifuging at 5000 rpm and 4 ℃ for 10 min, discarding the liquid, and suspending agrobacterium cells in 20 mL sterilized and precooled 0.1M NaCl.

5) After being kept on ice for 30 min, the mixture is centrifuged for 10 min at 5000 rpm and 4 ℃, the solution is discarded, and thalli are collected.

6) Adding 2 mL of sterilized and precooled 10% glycerol, subpackaging into a clean sterile 1.5 mL centrifuge tube according to 100 μ L, quickly putting into liquid nitrogen for freezing, and storing at-80 ℃.

2. Transforming Agrobacterium EHA105

The correctly constructed recombinant plasmid is transformed into agrobacterium EHA105 by an electric shock method, and the specific operation process is as follows:

1) Soaking the electric shock cup in 70% 200 mL of alcohol, then rinsing with sterile water for 3-5 times, air drying, and placing on ice for later use.

2) An EP tube containing 100. Mu.L of competent Agrobacterium EHA105 cells was removed from the liquid nitrogen tank and thawed in an ice bath.

3) Add 2. Mu.L of recombinant plasmid, mix gently, ice-wash for 30 min.

4) Taking out the mixed liquid, transferring the mixed liquid into a pre-cooled electric shock cup, putting the electric shock cup into an electric shock groove, performing high-voltage electric shock at 2100V, pressing a shock button on the equipment with a hand, and completing the electric shock when a click is heard.

5) Taking out the electric shock cup, adding 700 mu L of precooled YM liquid culture medium, gently blowing and beating the mixture evenly, sucking out the bacterial liquid and transferring the bacterial liquid into a clean and sterile 1.5 mL centrifuge tube.

6) Recovering at 28 deg.C and 200 rpm for 2-4 hr.

7) Centrifuging at 10000 rpm for 1min, collecting thallus, sucking 500. Mu.L of supernatant, blowing and beating the resuspended thallus with a gun head, taking 100. Mu.L of bacterial liquid after blowing and beating uniformly, coating the bacterial liquid on YM plates containing Rif 25 mg/L and kana 50 mg/L, and carrying out inverted culture at 28 ℃.

3. PCR identification of plant expression vector introduced into agrobacterium

Colony PCR detects whether the recombinant plasmid is successfully transferred into agrobacterium to extract plasmid. Primer P1304-106-P-F (SEQ ID No. 4)/P1304-106-P-R (SEQ ID No. 5). PCR reaction PCR was carried out according to the PCR reaction system and reaction procedure described in example II 3.1. The PCR identification result of the bacteria liquid after the plant expression vector P1304-T106-P is transformed into the agrobacterium is shown in the PCR identification electrophoresis picture of the bacteria liquid after the plant expression vector P1304-T106-P is transformed into the agrobacterium in figure 8.

Example 4

Plant tissue culture

1. Seed disinfection

Firstly, taking a sterilized 50 mL centrifuge tube, taking tomato seeds into the centrifuge tube, adding 75% ethanol, slightly shaking for 30s, pouring off the ethanol, adding sterile water for rinsing for 1-2 times, pouring off the sterile water, then adding a proper amount of 5% sodium hypochlorite (NaClO) solution, and slightly shaking for 20 min. Then, rinse 5-6 times with sterile water until the smell of sodium hypochlorite is not smelled. And finally, placing the sterilized seeds on a culture dish paved with sterile filter paper, uncovering the culture dish, and drying the culture dish in an ultraclean workbench.

2. Tomato seedling

The medium for culturing the aseptic tomato seedlings is named as FM. The formula of the culture medium is as follows: 1/2MS +30 g/L sucrose +8 g/L agar, medium pH =5.8. Subpackaging into tissue culture bottles with 30 mL each, and sterilizing in a sterilizing pot at 121 deg.C for 20 min. After the culture medium is solidified, inoculating 20 sterile tomato seeds into each bottle, and culturing in an artificial climate box at 25 ℃ under illumination. The germination of tomato seeds is shown in FIG. 9A.

3. Culture of callus

After the seeds grow in a seedling culture medium for about 10 to 15 days, the leaves of the tomato seedlings are taken and cut. Pouring a small amount of sterile water into a glass culture dish paved with sterile filter paper, wetting the filter paper in the culture dish, taking out the tomato seedling leaves in the tissue culture bottle by using forceps, placing the tomato seedling leaves on the filter paper, cutting the tomato seedling leaves into tissue blocks with the size of 2-5 mm multiplied by 2-5 mm, and forming a knife edge on the 4 surfaces of the tomato leaves. The cut leaves were attached to an induction medium (YD) with tissue block spacing of about 5 mm. The formula of the culture medium for inducing callus is MS +2 mg/L ZT +0.2 mg/L IAA +30 g/L sucrose +8 g/L agar. After sealing the opening of the sealing film, marking the name of the variety, the name and the date of the culture medium, culturing in a tissue culture room, replacing the culture medium every 1 week, and culturing for 3-4 weeks to obtain the callus which can be used for subsequent genetic transformation operation. Induction of tomato calli as shown in fig. 9B.

Example 5

Transfection and co-culture of recombinant agrobacterium

1. Preparation of recombinant Agrobacterium

1.1 preparation of the culture Medium

Weighing a certain amount of YM dry powder according to the specification of the YM culture medium, dissolving in 1L deionized water, and pouring into a 1L bottle for high-temperature sterilization at 121 deg.C for 20 min. After sterilization, the mixture was taken out and cooled, and 50 mg/L kanamycin and 50 mg/L rifampicin were added. The resuspension is liquid culture medium, 20 g/L D-glucose and 10 g/L sucrose are added in MS basal medium, and high temperature sterilization is carried out for 20 min at 117 ℃.

1.2 shaking of the bacteria

When the callus is cultured, taking a sterile tissue culture bottle, adding about 50 mL of YM liquid culture medium, adding 500-1000 muL of agrobacterium tumefaciens mother solution into the liquid culture medium, sealing by a sealing film, and culturing at 200 r/min at 28 ℃ overnight.

1.3 centrifugal resuspension

When the OD value of the agrobacterium liquid reaches 0.6-0.8, taking out the culture bottle, pouring the liquid into a sterile 50 mL centrifuge tube in a super clean bench, centrifuging at 5000 r/min and 4 ℃ for 12 min. Centrifuging, taking out the centrifuge tube, pouring out the supernatant on a clean bench, adding the resuspension solution, resuspending to about OD value of 0.3, adding 100 mu mol/L AS (acetosyringone), and mixing uniformly for later use.

2. Transfection

Taking a sterile 100 mL wide-mouth triangular flask, putting the callus into the triangular flask in an ultra-clean workbench, pouring a proper amount of bacterium liquid which is re-suspended and added with AS, wherein the agrobacterium tumefaciens bacterium liquid is about 3 mm higher than the callus, sealing by a sealing film, and shaking at 100 rpm and 20 ℃ for 30 min. Tissue material was air dried in a clean bench in petri dishes with sterile filter paper.

3. Co-cultivation

The medium used for co-cultivation was designated GP. The formula of GP medium is MS +20 g/L sucrose +10 g/L glucose +8 g/L agar +100 mu mol/L AS. Sterilizing in autoclave at 118 deg.C for 20 min, wherein AS is added after sterilization. Before screening, a piece of sterile filter paper is laid on each co-culture medium, infected materials are connected to the culture medium, and dark culture is carried out for 2-3 days at 18 ℃.

4. Regeneration and rooting

4.1 screening

The selection medium was named SX. The formulation of the screening culture medium is MS +2 mg/L ZT +0.2 mg/L IAA +30 g/L sucrose +8 g/L agar +600 mg/L cef +20 mg/L Hyg. Among them, IAA, cef and Hyg were added after the medium had been sterilized. Inoculating the callus after co-culture into a screening culture medium, culturing in an illumination incubator, and changing the screening culture medium once for about 15 days for 2 times. Resistance selection as shown in FIG. 9C.

4.2 differentiation

The differentiation medium SR1 is: MS +2 mg/L ZT +0.2 mg/L IAA +30 g/L sucrose +8 g/L agar +400 mg/L cef. Subculture every 10 days until new buds grow.

4.3 rooting

When the bud grows to 3-5 cm, the bud is transferred into a rooting medium (ST). The rooting medium comprises the following components: 1/2MS +0.1 mg/L IBA +150 mg/L Cef. After sterilization, IBA and cef are added, the mixture is subpackaged in tissue culture bottles, the culture is carried out for 16h every day under illumination at 26 ℃, and rooting is induced. Rooting was induced as shown in fig. 9D.

5. Molecular detection of transformed tomato

5.1 extraction of DNA from transformed tomato

And (3) extracting the DNA of the leaf blade of the transgenic tomato by adopting a CTAB method. The specific procedure was as described in example 1 for DNA extraction.

5.2 PCR verification of transgenic tomato seedlings

The primers P1304-106-P-F (SEQ ID No. 4)/P1304-106-P-R (SEQ ID No. 5) were used to verify transgenic tomato seedlings. PCR reaction the PCR reaction system and the reaction procedure described in example two 3.1 were followed for PCR. The PCR detection result of the transgenic tomato plant is shown in a PCR detection electrophoresis picture of the transgenic tomato plant shown in figure 10, which indicates that the target gene of the promoter T1061-P has been successfully transferred into a tomato genome to obtain 18 transgenic tomato seedlings P1304-106-P, wherein 12 positive seedlings are obtained, and the positive rate is 66.7%; the transgenic seedlings obtained from P1304-35S-P are 30 in total, the positive seedlings are 22 in total, and the positive rate is 73.3%. The positive rate of the transgenic tomato plants obtained by the T106-P plant binary expression vector and the 35S control group is over 60 percent.

6. Transplanting of transgenic tomato seedlings

And (4) transferring the positive tomato seedlings which develop well in the rooting culture medium and are successfully transformed into soil for cultivation. And (3) washing the culture medium adhered to the roots with clear water, preparing cultivation soil mixed by nutrient soil and sand 1, and transplanting the transgenic tomato seedling plants into the cultivation soil. Strong seedlings of transgenic tomato seedlings as shown in fig. 11A.

7. Transgenic tomato seedling inoculation root-knot nematode

When the transgenic tomato plant transplanted into the cultivation soil grows well, 2000 juveniles of the enterolobium cyclocarpum root-knot nematode and southern root-knot nematode are inoculated respectively under the same condition. As shown in FIG. 11B, the transgenic tomato seedlings were inoculated with root-knot nematodes 1 month later.

Experimental example 6

Tissue staining detection of GUS Activity

1. Tissue staining

And (3) inoculating the transgenic tomato seedlings to the enterolobium meloidogyne for 1 month, and carrying out tissue staining detection on GUS activity after the tomato root systems grow root knots. T106-P promoter with root knot, 35S promoter transgenic tomato root tissue and overground part tissue are taken and placed into a 1.5 mL centrifuge tube, and are stained by GUS staining solution and kept overnight at 37 ℃.

GUS staining results showed that the T106-P promoter was blue-stained at the root knot after the root knot nematode infestation of the Ivorax lenok, as shown in FIG. 12A, while neither the tomato root system nor the aerial leaves, which were not infected with the root knot nematode of the Ivorax lenok, were blue-stained as shown in FIG. 12A B. The root knot after infection by Meloidogyne incognita is blue stained as shown in FIG. 12C, while neither the root system nor the aerial leaves of Lycopersicon esculentum that are not infected by Meloidogyne incognita are blue stained as shown in FIG. 12C D. After the 35S promoter transgenic tomato seedlings are infected by the enterolobium meloidogyne, the roots of the seedlings are stained blue at root nodes and non-root nodes, namely the whole roots, as shown in FIG. 12C.

2. Fluorescent quantitative PCR detection of GUS gene

2.1 extraction of transgenic plant RNA

The RNA of the plant tissue is extracted by adopting a full-scale gold (Beijing) TransZol Up Plus RNA Kit. The specific operation process is as follows:

1) After weighing the ultra-low temperature frozen plant material, quickly transferring the plant material into a mortar precooled by liquid nitrogen, fully grinding the plant material into powder by a pestle, and continuously supplementing the liquid nitrogen in the middle.

2) The ground powder was transferred to a centrifuge tube, and 1 mL of Transzol Up was added to each 100 mg of sample and mixed well.

3) Standing at room temperature for 5 min.

4) 0.2 mL of chloroform was added to each tube, shaken vigorously for 30s, and incubated at room temperature for 3 min.

5) Centrifuge at 12000 r at 4 ℃ for 15 min and collect the supernatant colorless supernatant (ca. 500. Mu.L) into a new 1.5 mL centrifuge tube.

6) Adding absolute ethyl alcohol with the same volume, and slightly reversing and mixing.

7) Adding the mixed liquid into a centrifugal column, centrifuging at 14000 r room temperature for 30s, and discarding the effluent (dividing into 2-3 times).

8) Adding 500 μ L CB9, centrifuging at room temperature of 14000 r for 30s, and discarding the effluent.

9) And repeating the step 8.

10 Add 500. Mu.L of WB9, centrifuge at 14000 r for 30s at room temperature, and discard the effluent.

11 ) repeat step 10.

12 At room temperature 14000 r for 2 min, and standing at room temperature for 10 min.

13 Taking out the column, placing in RNase-free Tube, adding 30 μ L RNase-free Water in the center of the column, standing at room temperature for 1min, and centrifuging at room temperature 14000 r for 1 min.

14 Quality was measured on BioMateTM3S spectrophotometers (Thermo Fisher Scientific, USA), agilent 2100 (Agilent, USA) and Qubit2.0 (Thermo Fisher Scientific, USA) to ensure RNA quality and integrity, OD standard reached 1.8. Ltoreq. OD 260/280. Ltoreq.2.2.

15 The RNA solution was stored at-80 ℃ until use.

The part forming root knots after the transgenic positive plants of the promoter T106-P are inoculated is a sample No.1, the root without the root knots is a sample No.2, and the overground part is a sample No. 3. In the 35S transgenic positive plant, the root system with root knot formation is No.4 sample, the root system without root knot formation is No.5 sample, and the aerial part is No. 6 sample.

2.2 cDNA Synthesis

A reverse transcription reaction was performed using a PrimeScript RT reagent Kit with gDNA Eraser (Perfect Real Time) Kit from Bao Bio (Dalian) engineering Ltd. To synthesize cDNA used for detection, and the amount of the reversed total RNA was 1. Mu.g. The specific operation process is as follows:

1) The following reaction system was prepared:

2) 42 ℃ for 2 min (or 5 min at room temperature)

3) Storing at 4 deg.C

4) The following reaction system was prepared:

uniformly mixing the reagents, and placing the reagents in a PCR instrument for reaction under the reaction condition of 37 ℃ for 15 min; 5s at 85 ℃;4 ℃ for 1 min. After the reaction is finished, the reverse transcription cDNA is stored at-20 ℃ for later use.

2.3 fluorescent quantitative PCR detection

Fluorescent quantitative PCR detectionGUSThe primer sequences of the genes are as follows:

GUS-F：ACACCGACATGTGGAGTGAA（SEQ ID No.6）

GUS-R：TCATTGTTTGCCTCCCTGCT（SEQ ID No.7）

Actin-F：TGTCCCTATTTACGAGGGTTATGC（SEQ ID No.8）

Actin-R：AGTTAAATCACGACCAGCAAGAT（SEQ ID No.9）

fluorescent quantitative PCR reaction system

Setting of reaction parameters for fluorescent quantitative PCR

Amplification cycle parameters: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 20 s; annealing and extending for 20 s at 59 ℃; collecting fluorescence signals at 65 ℃; the number of cycles was 44.

Dissolution curve parameters: the temperature is raised from 59 ℃, fluorescence signals are collected in one cycle when the temperature is raised by 0.5 ℃, and fluorescence signals of 80 cycles are collected. The Ct values were recorded and the relative expression levels were calculated for 3 replicates per sample.

Fluorescent quantitative PCR data processing with 2 ^—△Ct Method for makingGUSThe expression level of the gene was calculated.GUSRelative expression amount of Gene =GUSGene CT value-Actin CT value.

The results of fluorescent quantitative PCR are shown in FIG. 13GUSRelative expression level of gene.

Sample No.1 of the root node position after inoculating enterolobium cyclocarpum root knot nematode with T106-P promoter transgenic positive tomato plantGUSRelative gene expression level of 0.0057, root system of non-root node, sample No.2GUSThe relative expression quantity of the gene is 0.0015, and the overground part of the T106-P transgenic positive tomato plant after the enterolobium cyclocarpum meloidogyne is inoculated, namely a No.3 sampleGUSThe relative expression quantity of the gene is 0.0007;

35S promoter transgenic positive tomato plant inoculated with enterolobium cyclocarpum meloidogyne posterior root knot part, namely No.4 sampleGUSThe relative expression quantity of the gene is 0.0052, and the root system of the non-root knot part is No.5 sampleGUSThe relative expression quantity of the gene is 0.0048, and the relative expression quantity of the overground part of the 35S promoter transgenic positive tomato plant after inoculation of the enterolobium cyclocarpum meloidogyne, namely the No. 6 sample is 0.0051.

Quantitative PCR detection from fluorescenceGUSThe result of the relative expression quantity of the gene can be seen, and the gene is positioned at the root node in the T106-P promoter transgenic tomato plantGUSThe relative expression quantity of the gene is obviously higher than that of root systems and overground parts without root knots,GUStransgenic tomato plant with gene T106-PThe aerial parts and the root system at the rootless nodes of (A) were not substantially detected. In the transgenic tomato plant of 35S promoter, the root node, the root system without root node and the overground partGUSThe relative expression quantity of the genes has no obvious difference,GUSthe relative expression amount of the genes is basically consistent.

The results show that the expression conditions of the T106-P promoter and the 35S promoter in each part of the plant tissue are different, and compared with the 35S constitutive promoter, the root knot specific promoter T106-P induced by root-knot nematode is specifically and stably expressed at the root knot.

Although the present invention has been described in detail with reference to the preferred embodiments, it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the spirit and scope of the present invention.

SEQUENCE LISTING

<110> Yunnan university of agriculture

<120> root knot specific promoter T106-P induced by root-knot nematode and application

<130> 2019

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 2626

<212> DNA

<213> T106-P promoter sequence

<400> 1

tgttcttttt catcatatat ttgttcgtat tatatggtgt ttttctattt ttataattag 60

ttaaaaataa tttttttaaa tcaagaatta tggtcctagt tttagtattt tattttatat 120

aaattttttt ttatatctag gcatgtacac atgtgatctt ttatattttt cccaagatgc 180

aacccatctt tagttttaag tatgcattta taaatttaat ttttgtttca aattttattt 240

gacttttggg tagattttac ttgagaaaaa aatgaaaacc aaaaaagtag tcgctttaat 300

atcaaagtag tagttttatt gttgtttttc ttttttctaa aaggaaccaa atttttttta 360

aaatcatacc cgataacatg tttttttttc tttttcgata acatgttttt aggtgattgt 420

agacattgaa aataactcat atttgattaa tgagatatct ttctttccta ttacttatat 480

aattctatta aatatataaa atttcactca tacgtttatg ttattcatat aaaattaaaa 540

agaaaaaaat tatcattttg aatttatttc ttttaaaaga cttatgctga ggatgaacaa 600

attatatatt tgaaacatgt gaaaagataa tattagcaac ttgttattgt tgttgactaa 660

caaatcttta taatattcgg ttaaaatctt ataatcacaa atattcattt ataaaagaaa 720

tataaaatta tgtgattcat aaatatgaca ttttaaacta tttttatgtc ttgtttatga 780

actataattg attatttagt agtattatat aaattttacc agttattaca atttatggag 840

ttttttttta taaaaaaata tacaacttta aattttaaat tacttaaata aaatttcaac 900

tttatattat aatttaattt aacatcataa tttcatactg tctgtccaat gacatatcgt 960

gtttgacttg gttggggaca ttttgttgtt catcttgtat ttcaaacata cttagaacaa 1020

aactttgaac atctttgtaa gaaaacaaag tttaagaaca ttttcacaac tagaaaatta 1080

aaactagtag cgaaactaga atcagaaaca gatttaaaaa aaatatacga aatatttttc 1140

ttaaagaaga attgttatta atatgtgtct aaagaatctt actgattcca acaaactttg 1200

cagaaacacg aagttaccaa gtttaatgaa ccagtgaaga acaaaagaat agaagaactg 1260

aaattaattc acaaatctaa agtttgtaaa acacgtacca gaatttggaa aattttaaaa 1320

ggaaaaggat caagtccact gaattcacag tgtcccctta aggaaattat tcccctctag 1380

tatccgaggt ttgatttgga atatgacctc ccagggtaaa atgatctcaa tcaccagagt 1440

atagatacca aaaactccgg tgtcagcgag ccactcaacg gcaataaagt acacttagca 1500

tactagattt agtagttgaa taagaaatcc atgaattcta tttaaaatga gaggaaatcc 1560

ctcaatttat agaaaacaaa gaaaagtgcg aaaaggttct tattgtgcct taccggaaag 1620

gtcacaaacc tttggaaaag tcacaatgtt tcagaaaggt cgtcaccttt cataaaagtc 1680

acaacttacc ataaaagtca caacttttca taaaagtcac aacatttcat aaaagtcacg 1740

actcttcata aaagtcacaa catttcataa aagtcacaac tcttcataaa agtcttcata 1800

aaagtcgcaa ctatttattt tccattcaca cctttttaaa atccaacaat cccttgcatg 1860

aatgtggaat gactcgaaga caaagaaacg gacaagtatg tgtactttac aagcaagaac 1920

taattgcatc tggataagta ggtttctcct tggactttcc gtagtgaaca tatgttggat 1980

atactcgaaa aatcggtaga tgcgatattt ttgaaccgtc gaactttggt gtatacctag 2040

acaaccatat gtcacacaat taactcttta ccatttgtgg ttcttacggt tgtgttcgtt 2100

ttatcaatga acacctcctg gtttcatgag tgtatagaga gatggacttt tgacaatcat 2160

cttctttgaa gcggcttaca cttcacactc acataggtga tttctaaccg tgttatcgcg 2220

tagatatact atttggtcaa ctttgccaaa cttagcaaat cattaaaacc attaatcttt 2280

attaactcat taacaaacct taatgttgta tccttgtccc tgagcattgt cttcatcatg 2340

agaatggatt gagtttattg acaatgctga accgtcattc acaactttat ttttctcctt 2400

gaatctagct cttgggatct ccagtctgct agatagagtt atcgccatga tgacttgtcc 2460

taagccgtaa attcattctc ttggatgatc ttttaacttt ctctctagtt aggtcttttt 2520

gtaagtggat ccgacacatt atcctttaac tttacatagt caattctgat aattccacta 2580

gagagtagtt ttctaacagt atcatgtcta tgtcgtatat gacgag 2626

<210> 2

<211> 33

<212> DNA

<213> primer T106-P-F

<400> 2

cccaagcttg agcatggagc atgacgtata acg 33

<210> 3

<211> 33

<212> DNA

<213> primer T106-P-R

<400> 3

catgccatgg aactttggaa tcctatgcct ttg 33

<210> 4

<211> 23

<212> DNA

<213> primer P1304-106-P-F

<400> 4

tttctcaagt aaaatctacc caa 23

<210> 5

<211> 22

<212> DNA

<213> primer P1304-106-P-R

<400> 5

ttctacagga cgtaaactag ct 22

<210> 6

<211> 20

<212> DNA

<213> GUS-F

<400> 6

acaccgacat gtggagtgaa 20

<210> 7

<211> 20

<212> DNA

<213> GUS-R

<400> 7

tcattgtttg cctccctgct 20

<210> 8

<211> 24

<212> DNA

<213> Actin-F

<400> 8

tgtccctatt tacgagggtt atgc 24

<210> 9

<211> 23

<212> DNA

<213> Actin-R

<400> 9

agttaaatca cgaccagcaa gat 23

Claims (1)

1. A group of primer pairs for amplifying root knot specific promoter T106-P induced by root knot nematodes is characterized in that the primer pairs comprise a first primer and a second primer, the sequence of the first primer is shown as SEQ ID NO.2, and the sequence of the second primer is shown as SEQ ID NO. 3.

Images