CN118127153A

CN118127153A - Reagent for detecting head and neck squamous cell carcinoma and application thereof

Info

Publication number: CN118127153A
Application number: CN202310386992.5A
Authority: CN
Inventors: 周谛晗; 董兰兰; 张良禄; 刘成杰; 洪瑶; 刘严; 李肖燕
Original assignee: Wuhan Aimisen Life Technology Co ltd
Current assignee: Wuhan Aimisen Life Technology Co ltd
Priority date: 2022-12-02
Filing date: 2023-04-12
Publication date: 2024-06-04

Abstract

The invention relates to a reagent for detecting head and neck squamous cell carcinoma and application thereof. The target region is Ch6: 137493196-137494301 or a partial region thereof with GRCh38.p14 as a reference. By detecting the change of the methylation level of the DNA of the OLIG3 gene CpG island and the adjacent region thereof, namely, detecting the methylation level by taking the Chr6:137493196-137494301 as a target region, the head and neck squamous cell carcinoma patients and healthy people can be effectively distinguished, the sensitivity is high, the specificity is strong, and a new thought is provided for diagnosing the head and neck squamous cell carcinoma.

Description

Reagent for detecting head and neck squamous cell carcinoma and application thereof

The present application claims priority from chinese patent application No. 202211535786.8, entitled "use of reagent for detecting methylation level of target region" filed by chinese patent office on month 2022, 12 and 02 in the preparation of diagnostic product for squamous cell carcinoma of head and neck, the entire contents of which are incorporated herein by reference.

Technical Field

The invention relates to the technical field of biomedicine, in particular to a reagent for detecting head and neck squamous cell carcinoma and application thereof.

Background

Head and neck cancer refers to a group of malignant tumors originating in the upper respiratory tract and part of the upper digestive tract organs, and the occurrence sites of the malignant tumors include oral cavity, oropharynx, hypopharynx, larynx and the like. It was counted that 705781 new cases of head and neck cancer occurred worldwide in 2018, and 358144 patients died of head and neck cancer. Of the head and neck tumors, more than 90% of cancers belong to head and neck squamous cell carcinoma (HEAD AND NECK squamous cell carcinoma, HNSCC). The squamous cell carcinoma of neck occurs in mucosa of oral cavity, throat, the affected part is hidden, the early symptoms are atypical in clinic, and the biomarker which can find the lesion in early stage is lacking, so it is not easy to find in early stage, more than half of patients are diagnosed in middle and late stage of the lesion, and at this time, most of patients have lymph nodes and/or distant metastasis, which brings great difficulty to clinical treatment of the disease. At present, although diagnosis and treatment technology of head and neck squamous cell carcinoma has been remarkably improved, prognosis of the disease is still poor, and survival rate of 5 years is lower than 50%.

Survival and quality of life of head and neck squamous cell carcinoma patients are directly related to tumor size at the primary site at diagnosis, and once the patient's oropharynx presents with symptoms associated with cancer such as non-healing bumps or pain, dysphagia, dyspnea, etc., the likelihood of successful treatment is greatly reduced. Therefore, early screening and diagnosis is necessary in high risk populations that are still asymptomatic.

In recent years, body fluid biopsy technology has become the most promising tool for detecting and monitoring the development status of various stages of disease, providing powerful support for accurate medical treatment. Circulating markers in body fluids such as circulating tumor cells, circulating tumor DNA, exosomes, etc. can reflect information about the primary site of the tumor. Therefore, the screening of the high-sensitivity and high-specificity molecular marker has positive significance for early diagnosis or auxiliary diagnosis of head and neck squamous cell carcinoma patients by adopting a body fluid biopsy mode.

In view of this, the present application has been made.

Disclosure of Invention

One of the purposes of the embodiment of the application comprises that a reagent for detecting the methylation level of the Chr6:137493196-137494301 or a partial region thereof is used for preparing a head and neck squamous cell carcinoma diagnosis product, and the diagnosis product is used for diagnosing the head and neck squamous cell carcinoma, so that the sensitivity is high and the specificity is strong.

In a first aspect of the application there is provided the use of an agent for detecting the methylation level of a target region in the manufacture of a diagnostic product for squamous cell carcinoma of the head and neck;

The target region is Ch6: 137493196-137494301 or a partial region thereof with GRCh38.p14 as a reference.

In some embodiments of the application, the partial region comprises one or more of regions 1 to 11 defined as follows:

region 1 is Chr6:137493196-137493305, plus strand;

Region 2 is Chr6:137493358-137493519, plus strand;

region 3 is Chr6:137493512-137493649, plus strand;

region 4 is Chr6:137493664-137493803, plus strand;

region 5 is Chr6:137493804-137493898, plus strand;

region 6 is Chr6:137493921-137494067, plus strand;

region 7 is Chr6:137494135-137494301, plus strand;

Region 8 is the Chr6:137493920-137494054, negative strand;

Region 9 is the Chr6:137493817-137493919, negative strand;

region 10 is the Chr6:137493573-137493687 negative strand; and

Region 11 is the Chr6:137493200-137493308 negative strand.

In some embodiments of the application, the reagent enables detection of the methylation level of the target region by one or more of the following methods: methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole genome bisulfite sequencing, pyrosequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution dissolution profile, methylation-sensitive restriction endonuclease, and methylation-specific fluorescent quantitative PCR.

In some embodiments of the application, the reagent comprises a detection primer pair and a detection probe that detect the methylation level of the target region.

In some embodiments of the application, the agent has one or more of the following technical features:

(1) The detection primer pair for detecting the region 1 is shown as SEQ ID No.7 and SEQ ID No.8, and the detection probe is shown as SEQ ID No. 9;

(2) The detection primer pair for detecting the region 2 is shown as SEQ ID No.10 and SEQ ID No.11, and the detection probe is shown as SEQ ID No. 12;

(3) The detection primer pair for detecting the region 3 is shown as SEQ ID No.13 and SEQ ID No.14, and the detection probe is shown as SEQ ID No. 15;

(4) The detection primer pair for detecting the region 4 is shown as SEQ ID No.16 and SEQ ID No.17, and the detection probe is shown as SEQ ID No. 18;

(5) The detection primer pair for detecting the region 5 is shown as SEQ ID No.19 and SEQ ID No.20, and the detection probe is shown as SEQ ID No. 21; and, a step of, in the first embodiment,

(6) The detection primer pair for detecting the region 6 is shown as SEQ ID No.22 and SEQ ID No.23, and the detection probe is shown as SEQ ID No. 24;

(7) The detection primer pair for detecting the region 7 is shown as SEQ ID No.25 and SEQ ID No.26, and the detection probe is shown as SEQ ID No. 27;

(8) The detection primer pair for detecting the region 8 is shown as SEQ ID No.28 and SEQ ID No.29, and the detection probe is shown as SEQ ID No. 30;

(9) The detection primer pair for detecting the region 9 is shown as SEQ ID No.31 and SEQ ID No.32, and the detection probe is shown as SEQ ID No. 33;

(10) The detection primer pair for detecting the region 10 is shown as SEQ ID No.34 and SEQ ID No.35, and the detection probe is shown as SEQ ID No. 36; and, a step of, in the first embodiment,

(11) The detection primer pair for detecting the region 10 is shown as SEQ ID No.37 and SEQ ID No.38, and the detection probe is shown as SEQ ID No. 39.

In some embodiments of the application, the reagent further comprises a detection primer pair for detecting a reference gene and a detection probe corresponding to the detection primer pair; the reference gene comprises an ACTB gene.

In some embodiments of the application, the pair of detection primers for detecting the ACTB gene is shown as SEQ ID No.62 and SEQ ID No.63, and the detection probe is shown as SEQ ID No. 64.

In some embodiments of the application, the sample type detected comprises a plasma sample, a cell sample, or a tissue sample.

In a second aspect of the application there is provided a kit for diagnosis of squamous cell carcinoma of the head and neck comprising the reagent as defined in the first aspect.

In some embodiments of the application, the diagnostic kit further comprises one or more of sequencing reagents, amplification reagents, reagents for converting unmethylated cytosine bases to uracil, DNA extraction reagent purification reagents.

In some embodiments of the application, the amplification reagents include one or more of amplification buffers, dNTPs, DNA polymerase, and Mg ²⁺.

The beneficial effects of the application include:

The application discovers that by detecting the change of the methylation level of the DNA of the OLIG3 gene CpG island and the adjacent region thereof, namely, detecting the methylation level by taking the Chr6:137493196-137494301 as a target region, the application can effectively distinguish head and neck squamous cell carcinoma patients from healthy people, has high sensitivity and strong specificity, and provides a new thought for diagnosing head and neck squamous cell carcinoma.

Detailed Description

The present application will be described in further detail with reference to embodiments and examples. It should be understood that these embodiments and examples are provided solely for the purpose of illustrating the application and are not intended to limit the scope of the application in order that the present disclosure may be more thorough and complete. It will also be appreciated that the present application may be embodied in many different forms and is not limited to the embodiments and examples described herein, but may be modified or altered by persons skilled in the art without departing from the spirit of the application, and equivalents thereof are also intended to fall within the scope of the application. Furthermore, in the following description, numerous specific details are set forth in order to provide a more thorough understanding of the application, it being understood that the application may be practiced without one or more of these details.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used herein in the description of the invention is for the purpose of describing the embodiments and examples only and is not intended to be limiting of the invention.

Unless otherwise indicated or contradicted, terms or phrases used herein have the following meanings:

The term "and/or", "or" as used herein includes a selection of any one of two or more of the listed items and also includes any and all combinations of the listed items, including any two or more of the listed items, or all combinations of the listed items. It should be noted that, when at least three items are connected by at least two conjunctions selected from the group consisting of "and/or", "or" and ", it is to be understood that, in the present application, the technical solutions include those that are all connected by" logical and ", and those that are all connected by" logical or ". For example, "a and/or B" includes three parallel schemes A, B and a+b. For another example, the technical schemes of "a, B, C, and/or D" include any one of A, B, C, D (i.e., the technical schemes all connected by "logical or"), also include any and all combinations of A, B, C, D, i.e., the combinations of any two or three of A, B, C, D, and also include four combinations of A, B, C, D (i.e., the technical schemes all connected by "logical and").

The terms "plurality", "plural", "multiple", and the like in the present application refer to, unless otherwise specified, an index of 2 or more in number. For example, "one or more" means one kind or two or more kinds. "above" includes the present number, for example "two or more" includes two, three or more.

In the present application, "at least one" and "at least one" mean any one of the listed items, or a combination of any two or more thereof.

As used in this disclosure, "a combination thereof," "any combination thereof," and the like include all suitable combinations of any two or more of the listed items.

In the present application, "suitable" in "suitable combination manner", "suitable manner", "any suitable manner", etc., are used to implement the technical scheme of the present application, solve the technical problem of the present application, and achieve the technical effects expected by the present application.

In the present application, "preferred", "better", "preferred" are merely embodiments or examples which are better described, and it should be understood that they do not limit the scope of the present application.

In the present application, the terms "first", "second", "third", "fourth", etc. are used for descriptive purposes only and are not to be construed as indicating or implying a relative importance or quantity, nor as implying an importance or quantity of a technical feature being indicated. Moreover, the terms "first," "second," "third," "fourth," and the like are used for non-exhaustive list description purposes only, and are not to be construed as limiting the number of closed forms.

In the application, the technical characteristics described in an open mode comprise a closed technical scheme composed of the listed characteristics and also comprise an open technical scheme comprising the listed characteristics.

In the present application, the term "diagnosis" includes auxiliary diagnosis, recurrence risk assessment, assessment of risk of canceration and degree of canceration, prognosis judgment, and the like.

In the present application, "head and neck squamous cell carcinoma" has the same meaning as "head and neck cancer" and refers to cancers or tumors occurring in the neck and head, but does not include lesions other than the brain and eyes. Typically including oral, nasal and nasal cancers, lip, throat, larynx, head tumors, ear, nasopharynx, oropharynx or hypopharynx, or salivary gland cancers. Head and neck cancer may begin with squamous cells that line moist mucosal surfaces within the head and neck (e.g., inside the mouth, nose, and throat). These squamous cell carcinomas may be referred to as Head and Neck Squamous Cell Carcinomas (HNSCC).

The term "oligonucleotide" or "polynucleotide" or "nucleotide" or "nucleic acid" refers to a molecule having two or more deoxyribonucleotides or ribonucleotides, preferably more than three, and typically more than ten. The exact size will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide. The oligonucleotides may be produced in any manner, including chemical synthesis, DNA replication, reverse transcription, or a combination thereof. Typical deoxyribonucleotides of DNA are thymine, adenine, cytosine and guanine. Typical ribonucleotides of RNA are uracil, adenine, cytosine and guanine.

The term "methylation" is a form of chemical modification of DNA that can alter genetic manifestations without altering the DNA sequence. DNA methylation refers to covalent binding of a methyl group at the 5 th carbon position of cytosine of a genomic CpG dinucleotide under the action of a DNA methyltransferase. DNA methylation can cause alterations in chromatin structure, DNA conformation, DNA stability, and the manner in which DNA interacts with proteins, thereby controlling gene expression.

The term "methylation level" refers to whether or not cytosine in one or more CpG dinucleotides in a DNA sequence is methylated, or the frequency/proportion/percentage of methylation, representing both qualitative and quantitative concepts. In practical application, different detection indexes can be adopted to compare the DNA methylation level according to practical conditions. As in some cases, the comparison may be made based on Ct values detected by the sample; in some cases, the ratio of gene methylation in the sample, i.e., number of methylated molecules/(number of methylated molecules+number of unmethylated molecules). Times.100, can be calculated and then compared; in some cases, statistical analysis and integration of each index is also required to obtain a final decision index. It is understood that the target region of the gene to be detected herein is a DNA sequence comprising at least one CpG dinucleotide (CG).

The term "primer" refers to an oligonucleotide that can be used in an amplification method (e.g., polymerase chain reaction, PCR) to amplify a sequence of interest based on a polynucleotide sequence corresponding to a gene of interest or a portion thereof. Typically, at least one of the PCR primers used to amplify a polynucleotide sequence is sequence specific for that polynucleotide sequence. The exact length of the primer will depend on many factors, including temperature, source of primer, and method used. For example, for diagnostic and prognostic applications, the oligonucleotide primers will typically contain at least 10, 15, 20, 25 or more nucleotides, but may also contain fewer nucleotides, depending on the complexity of the target sequence. In the present disclosure, the term "primer" refers to a pair of primers that hybridize to the double strand of a target DNA molecule or to regions of the target DNA molecule that flank the nucleotide sequence to be amplified.

The term "TaqMan probe" refers to a stretch of oligonucleotide sequences comprising a 5 'fluorescent group and a 3' quenching group. When the probe binds to the corresponding site on the DNA, the probe does not fluoresce because of the presence of a quenching group near the fluorescent group. During amplification, if the probe binds to the amplified strand, the 5'-3' exonuclease activity of the DNA polymerase (e.g., taq enzyme) digests the probe and the fluorescent group is far from the quenching group, its energy is not absorbed, i.e., a fluorescent signal is generated. The fluorescence signal is also identical to the target fragment with a synchronous exponential increase per PCR cycle.

DNA methylation is the transfer of a methyl group to the 5-carbon atom of a cytosine base by the action of a DNA methyltransferase. Methylation of the DNA of the promoter region of tumor suppressor genes is an important event in the cancerous process, and abnormal DNA methylation usually occurs early in cancer and is stably present. Abnormal methylation of DNA generally results in the inactivation of cancer suppressor genes and activation of oncogenes. In view of this, the methylation-altered gene can be used as a molecular marker for diagnosing cancerous or precancerous lesions, and has a certain diagnostic value. In the process of judging the negative and positive of cancer, it is very critical to screen out the proper molecular marker and detect the methylation of the molecular marker.

First aspect of the application

The application provides an application of a reagent for detecting methylation level of a target region in preparing a head and neck squamous cell carcinoma diagnosis product;

Optionally, the partial region includes one or more of regions 1 to 11 defined as follows:

region 1 is Chr6:137493196-137493305, plus strand;

Region 2 is Chr6:137493358-137493519, plus strand;

region 3 is Chr6:137493512-137493649, plus strand;

region 4 is Chr6:137493664-137493803, plus strand;

region 5 is Chr6:137493804-137493898, plus strand;

region 6 is Chr6:137493921-137494067, plus strand;

region 7 is Chr6:137494135-137494301, plus strand;

Region 8 is the Chr6:137493920-137494054, negative strand;

Region 9 is the Chr6:137493817-137493919, negative strand;

region 10 is the Chr6:137493573-137493687 negative strand; and

Region 11 is the Chr6:137493200-137493308 negative strand.

Optionally, the target region is selected from one or more of regions 1 to 11.

Optionally, the target region is selected from one or more of region 1, region 3, region 5, region 7, region 9 and region 10. Optionally, the target region is selected from one or more of region 1, region 3, region 6, region 7, region 8 and region 10. Further, the target region is selected from one or more of region 1, region 3, region 7, and region 10.

Optionally, the target region is selected from one or more of region 1, region 3, region 5, region 7, region 9, region 10 and region 11. Optionally, the target region is selected from one or more of region 1, region 2, region 3, region 5, region 6, region 7, region 9, region 10 and region 11. Further, the target region is selected from one or more of region 1, region 3, region 5, region 7, region 9, region 10, and region 11.

Optionally, the target area is area 3.

Optionally, the reagent enables detection of the methylation level of the target region by one or more of the following methods: methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole genome bisulfite sequencing, pyrosequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution dissolution profile, methylation-sensitive restriction endonuclease, and methylation-specific fluorescent quantitative PCR. In an exemplary embodiment of the application, methylation level is detected using methylation-specific PCR.

Optionally, the reagent comprises a detection primer pair and a detection probe for detecting the methylation level of the target region.

Optionally, the reagent has one or more of the following technical features:

Optionally, the reagent further comprises a detection primer pair for detecting the reference gene and a detection probe corresponding to the detection primer pair; the reference gene comprises an ACTB gene.

Optionally, the pair of detection primers for detecting the ACTB gene is shown as SEQ ID No.62 and SEQ ID No.63, and the detection probe is shown as SEQ ID No. 64.

It will be appreciated that the detection probes of the present application contain a fluorescent group.

Optionally, the detection probe of the present application is a TaqMan probe, the 5 'end of which is a fluorescent group, such as FAM, ROX, VIC, CY, and the 3' end of which is a fluorescence quenching group, such as BHQ, BHQ1, MGB, and the like.

Optionally, the sample tested comprises a plasma sample, a cell sample or a tissue sample. The sample is an ex vivo biological sample derived from a subject. In the present application, "subject" or "patient" or "subject" includes human patients and other mammals, as well as any individual suffering from or suffering from esophageal cancer, or who is desired to be analyzed or treated using the methods of the application. Suitable mammals that fall within the scope of the application include, but are not limited to: primates, domestic animals (e.g., sheep, cattle, horses, monkeys, pigs), laboratory test animals (e.g., rabbits, mice, rats, guinea pigs, hamsters), pets (e.g., cats, dogs), and wild animals (e.g., foxes, deer, wild dogs) in containment. Preferably, the patient is a human patient.

Second aspect of the application

The present application provides a kit for diagnosis of squamous cell carcinoma of head and neck comprising the reagents defined in the first aspect.

Optionally, the diagnostic kit further comprises one or more of sequencing reagents, amplification reagents, reagents for converting unmethylated cytosine bases to uracil, DNA extraction reagents, and purification reagents.

Optionally, the amplification reagents include one or more of amplification buffers, dNTPs, DNA polymerase, and Mg ²⁺.

DETAILED DESCRIPTION OF EMBODIMENT (S) OF INVENTION

Embodiments of the present invention will be described in detail below with reference to examples. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples, in which specific conditions are not noted, are preferably referred to the guidelines given in the present invention, and may be according to the experimental manual or conventional conditions in the art, the conditions suggested by the manufacturer, or the experimental methods known in the art.

In the specific examples described below, the measurement parameters relating to the raw material components, unless otherwise specified, may have fine deviations within the accuracy of weighing. Temperature and time parameters are involved, allowing acceptable deviations from instrument testing accuracy or operational accuracy.

DNA methylation is the transfer of a methyl group to the 5-carbon atom of a cytosine base by the action of a DNA methyltransferase. Methylation of the DNA of the promoter region of tumor suppressor genes is an important event in the cancerous process, and abnormal DNA methylation usually occurs early in cancer and is stably present. Abnormal methylation of DNA generally results in the inactivation of cancer suppressor genes and activation of oncogenes. The OLIG3 (Oligodendrocyte transcription factor) Gene is located on the negative strand of chromosome 6 of the human genome, whose Gene ID is 167826. The protein coded by the gene has double-chain DNA binding activity and can be used as a transcription factor to participate in the transcription and transcription regulation process of the gene. The CpG island position of the gene is as follows: 137493219-137494065, the application discovers that the methylation level change of the OLIG3 gene CpG island and the DNA in the adjacent area thereof in a blood sample can be detected by a fluorescence quantitative PCR method, so that a head and neck squamous cell carcinoma patient and a healthy person can be effectively distinguished. The application provides a reagent and a kit for detecting the DNA methylation level of a target region (Chr 6: 137493196-137494301), and provides an application method of the reagent and the kit in diagnosing head and neck squamous cell carcinoma, provides a new thought for diagnosing and assisting in diagnosing the head and neck squamous cell carcinoma, and brings good news for patients with the cancer.

Example 1 design of detection primer pair and detection Probe

The nucleic acid fragment of the OLIG3 gene Chr6:137493196-137494301 is used as a target region, the DNA sequence converted by the target region is used as a template, and a plurality of pairs of methylation detection primer pairs are designed and artificially synthesized for methylation specific fluorescent quantitative PCR reaction. Then, fragments (SEQ ID NO.2 and SEQ ID NO. 5) of the OLIG3 gene, which are obtained by converting the positive strand DNA and the negative strand DNA of which the regions are completely methylated in the Chr6:137493196-137494301 region, and fragments (SEQ ID NO.3 and SEQ ID NO. 6) of the positive strand DNA and the negative strand DNA, which are obtained by converting the regions which are completely unmethylated, are respectively synthesized artificially, and are respectively ligated to pUC 18 vectors, so that artificial plasmids containing the target regions are constructed. And then, taking the plasmid containing the target region as a template, and analyzing the performance of each pair of methylation detection primer pairs by using a SYBR fluorescent quantitative PCR system, wherein an amplification curve is required to have obvious exponential growth phase, the amplification efficiency is in the range of 95% -105%, and no nonspecific amplification exists. In order to meet the amplification efficiency and facilitate the detection of plasma samples, the length of the amplicon is less than 170bp, so that the target region is divided into a plurality of continuous sub-target regions for amplification. Non-specific amplification refers to the requirement that the methylation detection primer pair amplify only methylated plasmids, but not non-methylated plasmids, and not other non-specific amplifications, in one PCR amplification system with simultaneous addition of methylated and non-methylated plasmid templates.

After the methylation detection primer pairs aiming at all the sub-target areas are obtained, corresponding detection probes are designed for each pair of detection primer pairs, wherein the detection probes are TaqMan probes, fluorescent groups are arranged at the 5 'ends of the probes, fluorescent quenching groups are arranged at the 3' ends of the probes, and no non-specific binding exists between the detection primer pairs and the detection probes and between the detection probes and the target areas. And finally verifying the combination effect of the methylation detection primer pair and the detection probe in a fluorescent quantitative PCR system, and reserving the detection primer pair and the detection probe with exponential amplification period as final detection products. Through the method, the methylation detection primer pair and the detection probe 7 pair of the positive strand of the detectable target region are finally obtained through screening, and the methylation detection primer pair and the detection probe 4 pair of the negative strand of the detectable target region are obtained. The sequences of the methylation detection primer pairs and detection probes for the target region are shown in Table 1, the methylation cytosine sites recognizable by each methylation detection primer pair and detection probe are shown in Table 2, and the sequences of the amplicon fragments of each methylation detection primer pair and their corresponding untransformed fragments (i.e., the sub-target regions) are shown in Table 3.

Sequence of Positive strand DNA of region Chr6:137493196-137494301 of OLIG3 Gene (SEQ ID NO.1)：GGAGTCTGAGATCTCTCAGACAGCGTGGGAGGCTGCGGGCCCCGGAGCCTGCCCTCCCGTGGGCCGAGCGTGCAGCCTCCCTCTTCCCTCCCGGCCCGGCACCGCGGCCCCTCCCGCCGCTCTCCCTCCTCCTTGGCAGCCGGGCCCGCCCGCTGCTCACTTGAGCAAGTCCTTGGACTCGGCCGACAGCCGGGCCATGTTGGCTGTGGAGAGAGCGGACAGGTGCGGCGGCGGCGGCATCTGGCAGATGGTGCAGGGGCAGGGCAGACCAGCCCAGTGCTGGAAGCCGCTGCCCAGCTGCAGCGCGGGCGGCGTGGAGGGCGCCTTGAGTAGCGAGTGGGGAGGCCGGATGGTGCCGATGGCGGGAAGTGAGGCGGCGGACAGCGGTGACGAGGCGTTGCCAGATGAGAGCGCGCCGCCCAAGATGGGGTGCACCGGGTGCACGGAGTTGGCCGCGTGCGCGGGGTGGCCGGCCGAGTGGCCCACGGTCCCGCAGTGAAAGGCCGAGTGGTGGCCCCCATAGATCTCGCCAACCAGCCTCTTCATCTCCTCCAGGGAGCTGGTGAGCATGAGGATGTAGTTTCTGGCGAGCAGGAGTGTGGCGATCTTGGAGAGCTTGCGCACCGACGGCCCATGCGCGTAGGGCATGACTTCGCGCAGCCCGTCCATGGCTAGGTTCAGGTCGTGCATCCGCTTGCGTTCGCGTCCGTTGATCTTCAGCCTCAACTGCTGTAGGTCCTGCTCCGACAGCTGCTTCTTGATTTTGTACTTGCTGCTCTCTCCCGCGGCCTTGGCGCCAGCCCGCGAGAGGCTTTCCCCGGGCATCTTCTGCATCATATCGCCCTGCGTGGACGAGACCGAGTTGAGACGGCTCTCCTGGTGGTGGTGGTGGCGGTGGTGGTGGTCCCTCAGGTACATCTCATCCATGTCCGGAGATGAAGCTCTGCTGGAGACAGAGCTCGAATCAGAATTCATTTTATTACAGGGGATGCGGCCCTACCGTGGGGAGGCTTTAGGCGGGAAATTAAAGAAAATCTTGAATTAAAAAAAAAAAATCTGCACTGCCCAGGAACCCACTTCTCCGCGGCAAGACGTGAGAAGAAAAG

Sequence of fully methylated positive strand DNA of OLIG3 gene chr6:137493196-137494301 region after transformation (SEQ ID NO.2)：GGAGTTTGAGATTTTTTAGATAGCGTGGGAGGTTGCGGGTTTCGGAGTTTGTTTTTTCGTGGGTCGAGCGTGTAGTTTTTTTTTTTTTTTTCGGTTCGGTATCGCGGTTTTTTTCGTCGTTTTTTTTTTTTTTTGGTAGTCGGGTTCGTTCGTTGTTTATTTGAGTAAGTTTTTGGATTCGGTCGATAGTCGGGTTATGTTGGTTGTGGAGAGAGCGGATAGGTGCGGCGGCGGCGGTATTTGGTAGATGGTGTAGGGGTAGGGTAGATTAGTTTAGTGTTGGAAGTCGTTGTTTAGTTGTAGCGCGGGCGGCGTGGAGGGCGTTTTGAGTAGCGAGTGGGGAGGTCGGATGGTGTCGATGGCGGGAAGTGAGGCGGCGGATAGCGGTGACGAGGCGTTGTTAGATGAGAGCGCGTCGTTTAAGATGGGGTGTATCGGGTGTACGGAGTTGGTCGCGTGCGCGGGGTGGTCGGTCGAGTGGTTTACGGTTTCGTAGTGAAAGGTCGAGTGGTGGTTTTTATAGATTTCGTTAATTAGTTTTTTTATTTTTTTTAGGGAGTTGGTGAGTATGAGGATGTAGTTTTTGGCGAGTAGGAGTGTGGCGATTTTGGAGA GTTTGCGTATCGACGGTTTATGCGCGTAGGGTATGATTTCGCGTAGTTCGTTTATGGTTAGGTTTAGGTCGTGTATTCGTTTGCGTTCGCGTTCGTTGATTTTTAGTTTTAATTGTTGTAGGTTTTGTTTCGATAGTTGTTTTTTGATTTTGTATTTGTTGTTTTTTTTCGCGGTTTTGGCGTTAGTTCGCGAGAGGTTTTTTTCGGGTATTTTTTGTATTATATCGTTTTGCGTGGACGAGATCGAGTTGAGACGGTTTTTTTGGTGGTGGTGGTGGCGGTGGTGGTGGTTTTTTAGGTATATTTTATTTATGTTCGGAGATGAAGTTTTGTTGGAGATAGAGTTCGAATTAGAATTTATTTTATTATAGGGGATGCGGTTTTATCGTGGGGAGGTTTTAGGCGGGAAATTAAAGAAAATTTTGAATTAAAAAAAAAAAATTTGTATTGTTTAGGAATTTATTTTTTCGCGGTAAGACGTGAGAAGAAAAG

The sequence of the positive strand DNA of the OLIG3 gene Chr6:137493196-137494301 region which is completely unmethylated after transformation (SEQ ID NO. 3):

GGAGTTTGAGATTTTTTAGATAGTGTGGGAGGTTGTGGGTTTTGGAGTTTGTTTTTTTGTGGGTTGAGT

GTGTAGTTTTTTTTTTTTTTTTTGGTTTGGTATTGTGGTTTTTTTTGTTGTTTTTTTTTTTTTTTGGTAGTT

GGGTTTGTTTGTTGTTTATTTGAGTAAGTTTTTGGATTTGGTTGATAGTTGGGTTATGTTGGTTGTGGAG

AGAGTGGATAGGTGTGGTGGTGGTGGTATTTGGTAGATGGTGTAGGGGTAGGGTAGATTAGTTTAGTG

TTGGAAGTTGTTGTTTAGTTGTAGTGTGGGTGGTGTGGAGGGTGTTTTGAGTAGTGAGTGGGGAGGTT

GGATGGTGTTGATGGTGGGAAGTGAGGTGGTGGATAGTGGTGATGAGGTGTTGTTAGATGAGAGTGT

GTTGTTTAAGATGGGGTGTATTGGGTGTATGGAGTTGGTTGTGTGTGTGGGGTGGTTGGTTGAGTGGT

TTATGGTTTTGTAGTGAAAGGTTGAGTGGTGGTTTTTATAGATTTTGTTAATTAGTTTTTTTATTTTTTTT

AGGGAGTTGGTGAGTATGAGGATGTAGTTTTTGGTGAGTAGGAGTGTGGTGATTTTGGAGAGTTTGTG

TATTGATGGTTTATGTGTGTAGGGTATGATTTTGTGTAGTTTGTTTATGGTTAGGTTTAGGTTGTGTATTT

GTTTGTGTTTGTGTTTGTTGATTTTTAGTTTTAATTGTTGTAGGTTTTGTTTTGATAGTTGTTTTTTGATT

TTGTATTTGTTGTTTTTTTTTGTGGTTTTGGTGTTAGTTTGTGAGAGGTTTTTTTTGGGTATTTTTTGTAT

TATATTGTTTTGTGTGGATGAGATTGAGTTGAGATGGTTTTTTTGGTGGTGGTGGTGGTGGTGGTGGTG

GTTTTTTAGGTATATTTTATTTATGTTTGGAGATGAAGTTTTGTTGGAGATAGAGTTTGAATTAGAATTTA

TTTTATTATAGGGGATGTGGTTTTATTGTGGGGAGGTTTTAGGTGGGAAATTAAAGAAAATTTTGAATT

AAAAAAAAAAAATTTGTATTGTTTAGGAATTTATTTTTTTGTGGTAAGATGTGAGAAGAAAAG

Negative strand DNA sequence of region chr6:137493196-137494301 of OLIG3 gene (SEQ ID NO.4)：CTTTTCTTCTCACGTCTTGCCGCGGAGAAGTGGGTTCCTGGGCAGTGCAGATTTTTTTTTTTTAATTCAAGATTTTCTTTAATTTCCCGCCTAAAGCCTCCCCACGGTAGGGCCGCATCCCCTGTAATAAAATGAATTCTGATTCGAGCTCTGTCTCCAGCAGAGCTTCATCTCCGGACATGGATGAGATGTACCTGAGGGACCACCACCACCGCCACCACCACCACCAGGAGAGCCGTCTCAACTCGGTCTCGTCCACGCAGGGCGATATGATGCAGAAGATGCCCGGGGAAAGCCTCTCGCGGGCTGGCGCCAAGGCCGCGGGAGAGAGCAGCAAGTACAAAATCAAGAAGCAGCTGTCGGAGCAGGACCTACAGCAGTTGAGGCTGAAGATCAACGGACGCGAACGCAAGCGGATGCACGACCTGAACCTAGCCATGGACGGGCTGCGCGAAGTCATGCCCTACGCGCATGGGCCGTCGGTGCGCAAGCTCTCCAAGATCGCCACACTCCTGCTCGCCAGAAACTACATCCTCATGCTCACCAGCTCCCTGGAGGAGATGAAGAGGCTGGTTGGCGAGATCTATGGGGGCCACCACTCGGCCTTTCACTGCGGGACCGTGGGCCACTCGGCCGGCCACCCCGCGCACGCGGCCAACTCCGTGCACCCGGTGCACCCCATCTTGGGCGGCGCGCTCTCATCTGGCAACGCCTCGTCACCGCTGTCCGCCGCCTCACTTCCCGCCATCGGCACCATCCGGCCTCCCCACTCGCTACTCAAGGCGCCCTCCACGCCGCCCGCGCTGCAGCTGGGCAGCGGCTTCCAGCACTGGGCTGGTCTGCCCTGCCCCTGCACCATCTGCCAGATGCCGCCGCCGCCGCACCTGTCCGCTCTCTCCACAGCCAACATGGCCCGGCTGTCGGCCGAGTCCAAGGACTTGCTCAAGTGAGCAGCGGGCGGGCCCGGCTGCCAAGGAGGAGGGAGAGCGGCGGGAGGGGCCGCGGTGCCGGGCCGGGAGGGAAGAGGGAGGCTGCACGCTCGGCCCACGGGAGGGCAGGCTCCGGGGCCCGCAGCCTCCCACGCTGTCTGAGAGATCTCAGACTCC

Sequence of fully methylated negative strand DNA of OLIG3 gene chr6:137493196-137494301 region after transformation (SEQ ID NO.5)：TTTTTTTTTTTACGTTTTGTCGCGGAGAAGTGGGTTTTTGGGTAGTGTAGATTTTTTTTTTTTAATTTAA GATTTTTTTTAATTTTTCGTTTAAAGTTTTTTTACGGTAGGGTCGTATTTTTTGTAATAAAATGAATTTTGATTCGAGTTTTGTTTTTAGTAGAGTTTTATTTTCGGATATGGATGAGATGTATTTGAGGGATTATTATTATCGTTATTATTATTATTAGGAGAGTCGTTTTAATTCGGTTTCGTTTACGTAGGGCGATATGATGTAGAAGATGTTCGGGGAAAGTTTTTCGCGGGTTGGCGTTAAGGTCGCGGGAGAGAGTAGTAAGTATAAAATTAAGAAGTAGTTGTCGGAGTAGGATTTATAGTAGTTGAGGTTGAAGATTAACGGACGCGAACGTAAGCGGATGTACGATTTGAATTTAGTTATGGACGGGTTGCGCGAAGTTATGTTTTACGCGTATGGGTCGTCGGTGCGTAAGTTTTTTAAGATCGTTATATTTTTGTTCGTTAGAAATTATATTTTTATGTTTATTAGTTTTTTGGAGGAGATGAAGAGGTTGGTTGGCGAGATTTATGGGGGTTATTATTCGGTTTTTTATTGCGGGATCGTGGGTTATTCGGTCGGTTATTTCGCGTACGCGGTTAATTTCGTGTATTCGGTGTATTTTATTTTGGGCGGCGCGTTTTTATTTGGTAACGTTTCGTTATCGTTGTTCGTCGTTTTATTTTTCGTTATCGGTATTATTCGGTTTTTTTATTCGTTATTTAAGGCGTTTTTTACGTCGTTCGCGTTGTAGTTGGGTAGCGGTTTTTAGTATTGGGTTGGTTTGTTTTGTTTTTGTATTATTTGTTAGATGTCGTCGTCGTCGTATTTGTTCGTTTTTTTTATAGTTAATATGGTTCGGTTGTCGGTCGAGTTTAAGGATTTGTTTAAGTGAGTAGCGGGCGGGTTCGGTTGTTAAGGAGGAGGGAGAGCGGCGGGAGGGGTCGCGGTGTCGGGTCGGGAGGGAAGAGGGAGGTTGTACGTTCGGTTTACGGGAGGGTAGGTTTCGGGGTTCGTAGTTTTTTACGTTGTTTGAGAGATTTTAGATTTT

The sequence of the fully unmethylated negative strand DNA of the region 137493196-137494301 of the OLIG3 gene Chr6 (SEQ ID NO. 6):

TTTTTTTTTTTATGTTTTGTTGTGGAGAAGTGGGTTTTTGGGTAGTGTAGATTTTTTTTTTTTAATTTAAG

ATTTTTTTTAATTTTTTGTTTAAAGTTTTTTTATGGTAGGGTTGTATTTTTTGTAATAAAATGAATTTTGAT

TTGAGTTTTGTTTTTAGTAGAGTTTTATTTTTGGATATGGATGAGATGTATTTGAGGGATTATTATTATTG

TTATTATTATTATTAGGAGAGTTGTTTTAATTTGGTTTTGTTTATGTAGGGTGATATGATGTAGAAGATGT

TTGGGGAAAGTTTTTTGTGGGTTGGTGTTAAGGTTGTGGGAGAGAGTAGTAAGTATAAAATTAAGAAG

TAGTTGTTGGAGTAGGATTTATAGTAGTTGAGGTTGAAGATTAATGGATGTGAATGTAAGTGGATGTAT

GATTTGAATTTAGTTATGGATGGGTTGTGTGAAGTTATGTTTTATGTGTATGGGTTGTTGGTGTGTAAGT

TTTTTAAGATTGTTATATTTTTGTTTGTTAGAAATTATATTTTTATGTTTATTAGTTTTTTGGAGGAGATGA

AGAGGTTGGTTGGTGAGATTTATGGGGGTTATTATTTGGTTTTTTATTGTGGGATTGTGGGTTATTTGGT

TGGTTATTTTGTGTATGTGGTTAATTTTGTGTATTTGGTGTATTTTATTTTGGGTGGTGTGTTTTTATTTGG

TAATGTTTTGTTATTGTTGTTTGTTGTTTTATTTTTTGTTATTGGTATTATTTGGTTTTTTTATTTGTTATTT

AAGGTGTTTTTTATGTTGTTTGTGTTGTAGTTGGGTAGTGGTTTTTAGTATTGGGTTGGTTTGTTTTGTT

TTTGTATTATTTGTTAGATGTTGTTGTTGTTGTATTTGTTTGTTTTTTTTATAGTTAATATGGTTTGGTTGT

TGGTTGAGTTTAAGGATTTGTTTAAGTGAGTAGTGGGTGGGTTTGGTTGTTAAGGAGGAGGGAGAGT

GGTGGGAGGGGTTGTGGTGTTGGGTTGGGAGGGAAGAGGGAGGTTGTATGTTTGGTTTATGGGAGGG

TAGGTTTTGGGGTTTGTAGTTTTTTATGTTGTTTGAGAGATTTTAGATTTT

TABLE 1 methylation detection primer pairs and detection probes

/>

TABLE 2 methylation detection primer pairs and methylated cytosine sites recognizable by detection probes

/>

TABLE 3 nucleotide sequences of sub-target regions

/>

Example 2 detection of tissue sample Performance Using methylation level of target region

1. Tissue sample collection

This example collected 96 samples of cancer tissue from patients diagnosed with squamous cell carcinoma of the head and neck (i.e., patients with cancerous mouth, throat, or throat) and corresponding paracancerous normal tissue samples, respectively, by pathology biopsy. All tissue samples were formalin-immersed, paraffin-embedded tissue samples. All tissue samples were approved by the ethics committee, all volunteers signed informed consent, and all tissue samples were anonymized.

2. Tissue sample DNA extraction

For Tissue samples, the QIAAMP DNA FFPE Tissue Kit (56404) was used to extract DNA, and the specific procedure was followed according to the Kit instructions.

3. Tissue sample DNA transformation and purification

The extracted sample genome DNA is subjected to bisulphite conversion and purification after conversion, and the used nucleic acid conversion kit is a nucleic acid conversion reagent (Ehan mechanical preparation 20200843) of Wuhan Ai Misen life technology Co., ltd, and specific experimental operation is shown in the instruction book of the kit.

4. Methylation-specific fluorescent quantitative PCR reactions

The methylation fluorescent quantitative PCR reaction was performed using the converted sample DNA as a template, and using the detection primer pair and the detection probe provided in Table 1, respectively, to amplify each sub-target region. Specifically, a PCR amplification system was prepared according to the formulation provided in Table 4, and the components such as DNA polymerase and buffer used in the formulation were purchased from Invitrogen (Cat: 14966005). It should be noted that, in performing each PCR reaction, the amount of the reference gene ACTB needs to be detected simultaneously for monitoring the sample quality and interpretation of the results. The upstream primer sequences of the amplified ACTB gene fragment used in the invention are as follows: 5'-AAGGTGGTTGGGTGGTTGTTTTG-3' (SEQ ID NO. 62), the sequence of the downstream primer for amplifying the ACTB gene fragment is: 5'-AATAACACCCCCACCCTGC-3' (SEQ ID NO. 63), the corresponding detection probe sequences are: 5'-VIC-GGAGTGGTTTTTGGGTTTG-BHQ1-3' (SEQ ID NO. 64), wherein the fluorescent group at the 5 'end of the detection probe is VIC, and the fluorescent quenching group at the 3' end is BHQ1. In each PCR reaction system, the 5 '-end fluorescent group of the sub-target area detection probe is FAM, and the 3' -end fluorescent quenching group is MGB. In addition, in detecting each sub-target region in a biological sample, a quality control experiment needs to be set simultaneously, that is, a positive control PCR tube and a negative control PCR tube need to be set. For a certain sub-target region, the configuration system of the positive control PCR tube and the negative control PCR tube is the same as that of an experimental test PCR tube, but the template of the positive control PCR tube is formed by mixing 10 ³ copies/microliter of plasmid containing the sub-target region after transformation and 10 ³ copies/microliter of plasmid containing the ACTB gene fragment after transformation in equal volume, and the template of the negative control PCR tube is TE buffer solution. After the system configuration of the positive control PCR tube, the experimental test PCR tube and the negative control PCR tube was completed, the reaction was performed on a fluorescent quantitative PCR instrument according to the procedure provided in table 5.

TABLE 4 PCR reaction System

TABLE 5 PCR reaction procedure

After qPCR reaction is finished, a baseline is adjusted, a threshold value is set, the threshold value is required to be located in an exponential amplification period, a straight line crossing the threshold value and parallel to the X axis is called a threshold line, and the cycle number corresponding to the intersection point of the threshold line and the amplification curve is called a Ct value. Analysis of the results of qPCR reactions required: ① The negative control PCR tube was not amplified (i.e., not streaked); ② The positive control PCR tube has obvious index increasing period, and the Ct value of the target gene of the positive control PCR tube is between 26 and 30; ③ The Ct value of the reference gene of the sample to be detected is less than or equal to 33. If the positive control, the negative control and the reference gene all meet the requirements, the detection result of the sample to be detected can be analyzed and the result can be interpreted, otherwise, the detection must be carried out again when the experiment is invalid.

5. Result determination

Regarding a tissue sample, under the condition that the Ct value of a certain sub-target area is less than or equal to 37, considering the tissue sample as methylation positive in the area, and judging the tissue sample as a head and neck squamous cell carcinoma positive sample; and under the condition that the Ct value of a certain target area is amplified to be more than 37, the tissue sample is considered to be methylation negative in the area, and the tissue sample is judged to be a head and neck squamous cell carcinoma negative sample.

The methylation level of each subregion of the Chr6:137493196-137494301 region of the OLIG3 gene is detected by a methylation fluorescent quantitative PCR method, and further whether the tissue sample is a positive sample of head and neck squamous cell carcinoma is judged as shown in a table 6, the sensitivity in the table is the methylation positive proportion in the sample with positive pathological results, and the specificity is the methylation negative proportion in the sample with negative pathological results.

TABLE 6 Performance of detection of head and neck cancer tissue samples Using respective sub-target regions

Sub-target area	Methylation positive (example)	Sensitivity (%)	Methylation negative (example)	Specificity (%)
					Zone 1	87	90.63	90	93.75
Zone 2	78	81.25	85	88.54
					Zone 3	92	95.83	89	92.71
Zone 4	84	87.50	81	84.38
					Zone 5	91	94.79	85	88.54
Zone 6	81	84.38	87	90.63
					Zone 7	87	90.63	91	94.79
Zone 8	80	83.33	88	91.67
					Region 9	90	93.75	85	88.54
Region 10	89	92.71	89	92.71
					Region 11	82	85.42	86	89.58

As can be seen from Table 6, the methylation level of each sub-region in the target region was detected by the methylation fluorescent quantitative PCR method, and the diagnosis of the head and neck squamous cell carcinoma tissue sample was excellent. Specifically, the sensitivity of the head and neck squamous cell carcinoma tissue samples diagnosed in the areas 1 to 11 is higher than 81%; the specificity of the detection of the paracancerous normal tissue samples is higher than 84%. The sensitivity of detecting cancer tissue samples in the area 1, the area 3, the area 5, the area 7, the area 9 and the area 10 is higher than 90%; the specificity of detection of the paracancestral normal tissue samples in region 1, region 3, region 6, region 7, region 8 and region 10 is higher than 90%. In summary, region 1, region 3, region 7 and region 10 are the most effective for diagnosing head and neck squamous cell carcinoma tissue samples.

Example 3 Performance of testing plasma samples Using methylation levels of target regions

1. Sample collection

A total of 169 volunteers were enrolled, of which 78 were patients diagnosed with oral squamous cell carcinoma by pathological tissue biopsy, and the remaining 91 volunteers were healthy, with each volunteer drawing greater than 8mL venous blood. All plasma sample collection procedures were approved by the ethics committee and all volunteers signed informed consent.

2. Sample DNA extraction

After centrifugation of the fresh anticoagulated blood sample, the upper plasma layer is aspirated for extraction of plasma free DNA. Plasma cfDNA extraction was performed using the magnetic bead serum/plasma free DNA (cfDNA) extraction kit (DP 709) from the company of the biochemical technology of the root of the chinese day (beijing), the specific procedure being according to the kit instructions.

3. Transformation and purification of sample DNA

After cfDNA was obtained, it was transformed with the wuhan Ai Misen life technologies nucleic acid transformation reagent (jaw chinese instruments No. 20200843), followed by purification of the transformed DNA for subsequent experiments, see kit instructions for specific procedures.

4. Methylation-specific fluorescent quantitative PCR reactions

The procedure of example 2, the configuration of positive control tube and negative control tube of PCR reaction, and the reading and quality control of Ct value were the same as in example 2, except that the methylation fluorescent quantitative PCR reaction was performed using the detection primer pair and the detection probe provided in Table 1 as a template, respectively, to amplify each sub-target region.

5. Result determination

Regarding a plasma sample, under the condition that the Ct value of a certain sub-target area is less than or equal to 48, the plasma sample is considered to be methylation positive in the area, and the plasma sample is an oral squamous cell carcinoma positive sample; under the condition that a Ct value of a certain target area is amplified to be more than 48, the plasma sample is considered to be methylation negative in the area, and then the plasma sample is an oral squamous cell carcinoma negative sample.

The methylation level of each subregion of the Chr6:137493196-137494301 region of the OLIG3 gene is detected by a methylation fluorescent quantitative PCR method, and further whether the plasma sample is a positive sample of oral squamous cell carcinoma is judged according to the performance shown in a table 7, wherein the sensitivity in the table is the proportion of positive methylation in samples with positive pathological results, and the specificity is the proportion of negative methylation in samples with negative pathological results.

TABLE 7 Performance of detection of oral squamous cell carcinoma plasma samples Using respective sub-target areas

Sub-target area	Methylation positive (example)	Sensitivity (%)	Methylation negative (example)	Specificity (%)
					Zone 1	62	79.49	88	96.70
Zone 2	55	70.51	84	92.31
					Zone 3	67	85.90	87	95.60
Zone 4	57	73.08	80	87.91
					Zone 5	64	82.05	86	94.51
Zone 6	56	71.79	90	98.90
					Zone 7	61	78.21	85	93.41
Zone 8	58	74.36	81	89.01
					Region 9	63	80.77	82	90.11
Region 10	62	79.49	87	95.60
					Region 11	59	75.64	89	97.80

As can be seen from Table 7, the methylation level of each sub-region in the target region was detected by the methylation fluorescent quantitative PCR method, and the oral squamous cell carcinoma plasma sample was excellent in performance. The sensitivity of the oral squamous cell carcinoma blood plasma samples diagnosed in the areas 1 to 11 is higher than 70%, and the detection sensitivity in the area 3 is highest and can reach 85.90%; the specificity of the diagnostic healthy human plasma samples in the area 1 to the area 11 is higher than 87%, and the detection specificity of the area 6 is highest and can reach 98.90%. The sensitivity of detecting oral squamous cell carcinoma plasma samples in the areas 1,3,5, 7, 9, 10 and 11 is higher than 75%; the specificity of detection of healthy human plasma samples in region 1, region 2, region 3, region 5, region 6, region 7, region 9, region 10 and region 11 is higher than 90%. In summary, region 1, region 3, region 5, region 7, region 9, region 10 and region 11 are better for diagnosing oral squamous cell carcinoma plasma samples, wherein region 3 is most effective for diagnosis.

The technical features of the above-described embodiments and examples may be combined in any suitable manner, and for brevity of description, all of the possible combinations of the technical features of the above-described embodiments and examples are not described, however, as long as there is no contradiction between the combinations of the technical features, they should be considered to be within the scope described in the present specification.

Claims

1. Use of an agent that detects the methylation level of a target region in the manufacture of a diagnostic product for head and neck squamous cell carcinoma;

2. The use according to claim 1, wherein the partial region comprises one or more of regions 1 to 11 defined as follows:

region 1 is Chr6:137493196-137493305, plus strand;

Region 2 is Chr6:137493358-137493519, plus strand;

region 3 is Chr6:137493512-137493649, plus strand;

region 4 is Chr6:137493664-137493803, plus strand;

region 5 is Chr6:137493804-137493898, plus strand;

region 6 is Chr6:137493921-137494067, plus strand;

region 7 is Chr6:137494135-137494301, plus strand;

Region 8 is the Chr6:137493920-137494054, negative strand;

Region 9 is the Chr6:137493817-137493919, negative strand;

region 10 is the Chr6:137493573-137493687 negative strand; and

Region 11 is the Chr6:137493200-137493308 negative strand.

3. The use according to claim 1 or 2, wherein the reagent enables detection of the methylation level of the target region by one or more of the following methods: methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole genome bisulfite sequencing, pyrosequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution dissolution profile, methylation-sensitive restriction endonuclease, and methylation-specific fluorescent quantitative PCR.

4. The use according to claim 3, wherein the reagent comprises a detection primer pair for detecting the methylation level of the target region and a detection probe.

5. The use according to claim 4, wherein the detection primer pair and the detection probe are selected from one or more of the following groups:

6. The use according to claim 5, wherein the reagent further comprises a pair of detection primers for detecting a reference gene and a detection probe corresponding to the pair of detection primers; the reference gene comprises an ACTB gene;

7. The use according to any one of claims 1,2, 4 to 6, wherein the sample type detected comprises a plasma sample, a cell sample or a tissue sample.

8. A kit for diagnosing squamous cell carcinoma of head and neck, comprising a reagent as defined in any one of claims 1 to 7.

9. The head and neck squamous cell carcinoma diagnostic kit of claim 8, further comprising one or more of sequencing reagents, amplification reagents, reagents that convert unmethylated cytosine bases to uracil, DNA extraction reagents, and purification reagents.

10. The head and neck squamous cell carcinoma diagnostic kit of claim 9, wherein the amplification reagents include one or more of amplification buffers, dNTPs, DNA polymerase, and Mg ²⁺.