CN117925642A - Barley HvWRKY gene and application thereof in wheat leaf rust resistance - Google Patents

Abstract

The invention discloses a barley HvWRKY gene and application thereof in wheat leaf rust resistance, belonging to the technical field of genetic engineering. The nucleotide sequence of the barley HvWRKY gene is shown as SEQ ID NO.1, and the invention uses the leaf cDNA of barley material Golden Promise as a template, and the barley HvWRKY gene can be obtained by PCR cloning. The wheat material over-expressing HvWRKY gene has obviously raised resistance level to wheat leaf rust.

Description

Barley HvWRKY gene and application thereof in wheat leaf rust resistance

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a barley HvWRKY gene and application thereof in leaf rust resistance of wheat.

Background

Wheat is used as main grain crop and has important significance to the agricultural development of China. Wheat leaf rust caused by wheat leaf rust bacteria (Puccinia triticina, pt) is an important fungal disease which seriously affects wheat production in China. In recent years, wheat leaf rust has become serious due to the increase in planting density and the change in agricultural cultivation system. The wheat leaf rust pathogenic bacteria have the characteristic of high mutation frequency, and physiological seeds can be mutated for a plurality of times in a short time, so that the single-resistant wheat variety is easy to lose resistance in a short time. Therefore, it is especially necessary to discover new disease-resistant and drought-resistant germplasm resources.

Transcription factors refer to a class of binding proteins that are capable of specifically interacting with cis-acting elements in the promoter region of a gene. Transcription factors activate or inhibit the expression of certain downstream genes, also known as trans-acting factors, through interactions between them and other related proteins. Since this century, researchers have separated a series of plant transcription factors successively, and proved by researches that the transcription factors not only regulate and control the expression of related genes in the growth and development and physiological processes of plants, but also play a very important role in the aspects of the invasion of plants to external environments including pathogens, low temperature, high salt, drought, hormone and other stress reactions.

WRKY transcription factors are considered to be a family of transcription factors that are found only in plants, with highly conserved WRKY domain zinc finger proteins. The conserved domain consists of about 60 amino acid residues, and 7 conserved amino acid residues WRKYGQK near the N-terminal are regarded as a core sequence of the WRKY domain and can be specifically combined with a W-box of a gene promoter region to participate in expression regulation. Research shows that WRKY transcription factors play a very important role in regulating and controlling plant disease-resistant defense reaction. Wheat transgenic material over-expressing the arabidopsis AtWRKY29 gene shows an increased level of resistance to scab by enhancing PTI immune response. Barley HvWRKY is homologous to AtWRKY30/41/53 and is involved in abiotic stress tolerance or cross-signaling regulation between SA and JA. The wheat TaWRKY70 gene participates in the disease resistance reaction of wheat to Wen Kangxiao wheat stripe rust in the seedling stage. NAC transcription factor TaSNAC-6A enhances drought resistance by inducing auxin and drought response pathways, stimulates lateral root development, and further improves water utilization efficiency.

Disclosure of Invention

One of the purposes of the present invention is to provide a barley HvWRKY gene, the nucleotide sequence of the barley HvWRKY gene is shown as SEQ ID NO. 1.

Another object of the present invention is to provide a method for cloning the gene of barley HvWRKY, wherein the gene of barley HvWRKY is obtained by PCR cloning using leaf cDNA of barley material "Golden Promise" as a template.

Preferably, the primer sequences used in the PCR are shown as SEQ ID NO.2 and SEQ ID NO. 3.

The third object of the present invention is to provide an expression vector comprising the above-mentioned barley HvWRKY gene.

Preferably, the expression vector is a eukaryotic expression vector.

More preferably, the eukaryotic expression vector is pLGY-02.

The fifth object of the present invention is to provide a host comprising the above expression vector.

Preferably, the host is E.coli or Agrobacterium.

The sixth object of the present invention is to provide the use of the above nucleotide sequence for improving leaf rust resistance of wheat.

Preferably, the application is to transform a vector containing the sequence shown in SEQ ID NO.1 into wheat young embryo to obtain a wheat plant over-expressing HvWRKY gene.

Compared with the prior art, the invention has the following beneficial effects:

The invention provides HvWRKY gene sequences and a preparation process of a wheat transgenic material of over-expression HvWRKY22, and experiments prove that the wheat transgenic material has obviously improved wheat leaf rust disease resistance.

Drawings

FIG. 1 shows the results of leaf rust resistance identification of wheat transgenic materials in example 4, wherein WT represents a control and #4- #7 represent different transgenic families, respectively.

Detailed Description

The experimental methods used in the following examples are conventional methods unless otherwise specified.

Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

Plant material: barley variety "Golden Promise", common wheat spring wheat variety "JW1".

Strains and vectors: coli DH5a competent cells (CB 104) were purchased from Tiangen Biochemical technology (Beijing) Co. The T cloning vector pGEM-Teasy was purchased from Beijing full gold biotechnology Co. Agrobacterium GV3101 and wheat transgene vector pLGY-02 were maintained by the present laboratory. The wheat leaf rust toxic physiological race THTT is preserved by the university of agriculture in river north.

The main reagent comprises: agarose was purchased from SIGMA company; 2 XPOmix Taq enzyme was purchased from Beijing kang as century biotechnology Co., ltd, restriction enzyme KpnI, speI (TaKaRa engineering Co., ltd.); the reagents such as sucrose, glucose, tryptone, agar powder, tween-20, isopropanol, glycerol, beta-mercaptoethanol, sodium chloride, sodium hydroxide, absolute ethyl alcohol, boric acid, tris-HCl and the like are purchased from Wankui chemical reagent commercial departments of self-holding city. AL2000 DNAMARKER, plasmid small extraction kit, gel recovery and purification kit are purchased from biological engineering Co., ltd, QIAGEN plant total RNA extraction kit is purchased from Tiangen Biochemical technology Co., ltd, SYBR Premix DIMER ERASER fluorescence quantification kit and reverse transcription kit are purchased from Beijing full gold biotechnology Co.

The main instrument is as follows: applied Biosystems VERITI THERMAL CYCLER PCR amplification apparatus (Thermo Fisher), WH-861 vortex mixer (Taiku Kogyo Instrument Co., ltd.), high-speed refrigerated Centrifuge Centrifuge 5810R (Eppendorf Co., ltd.), small-sized high-speed desktop Centrifuge Centrifuge 5415D (Eppendorf Co., ltd.), ultra clean bench (AIR TECH Co.), constant temperature shaking incubator (Shanghai Su Kun Co., ltd.), SX-500 sterilization pot (TOMY Co., ltd.), ice maker (SCOTSMAN Co.), molar element type ultra-pure water machine (Shanghai Mole scientific instruments Co., ltd.), microwave oven (Galanz Co.), water bath pot (Beijing long wind instrument Co., ltd.), micropipette (Eppendorf Co., ltd.), SONY Carl Zeiss Vario Sonnar camera (SONY), lightCycler96 real-time fluorescent quantitative PCR apparatus (Roche Co., ltd.), sample grinder, etc.

EXAMPLE 1HvWRKY cloning of the Gene

Extraction of barley leaf RNA: RNA extraction was performed using RNAExtraction Kit kit (QIAGEN, hilden, germany). The second leaf blade sample of barley material "Golden Promise" at seedling stage was rapidly ground to powder with liquid nitrogen in a sterilized mortar for use. Preparing Buffer RLT mixed solution, adding 10 mu L of beta-mercaptoethanol into each milliliter of Buffer RLT, mixing the mixed solution for use, and placing the mixed solution on ice. Taking out the ground RNA sample from the liquid nitrogen, rapidly adding 500 mu L Buffer RLT mixed solution, sufficiently shaking, and centrifuging for 2min at 10000 g. The supernatant was aspirated with a pipette and transferred to a purple spin column and centrifuged at 10000g for 1min. Transferring the collected liquid into a pink centrifugal column, adding absolute ethyl alcohol (the addition amount is 1/2 of that of the collected liquid) pre-cooled in advance, reversing and mixing uniformly, and standing to precipitate nucleic acid. The solution was removed for 30 seconds and the collection solution was discarded. mu.L RW1 (protein washed) was added, the solution was transiently separated for 30s, and the collected solution was discarded. Add 500. Mu.L Buffer RPE (44 mL absolute ethanol before use), snap-off 30s, and pour off the collection. The above steps were repeated once and centrifuged at 10000g for 2min. The column was replaced with a new 2mL collection tube and left free for 1min. After centrifugation, the pink column was placed in a 1.5mL centrifuge tube with the kit itself, 30. Mu.L RNase-FREE WATER was added to the center of the adsorption membrane with a pipette, and the mixture was centrifuged for 1min. The collected RNA samples were stored and the RNA concentration was measured by a Nanodrop ultra-micro spectrophotometer.

Barley cDNA reverse transcription: for RNA samples obtained by extractionThe First-STRAND CDNA SYNTHESIS SuperMix reverse transcription kit (full gold) was inverted to generate cDNA. All RNA samples were homogenized to 1000ng, made up to 8. Mu.L with RNASE FREE DDH ₂ O, then 1. Mu.L Oligo (dT) 12-18Primer (50. Mu.M) was added, and the mixture was mixed by pipetting and placed in a PCR apparatus at 65℃for 5min and 4℃for 2min. Then 10. Mu.L of 2 XES Reaction Mix, 1. Mu.L was addedMixing, placing into PCR instrument at 42 deg.C/15 min, and heating at 85deg.C for 5sThe RT/RI was deactivated and stored at 4 ℃. The resulting cDNA template was prepared with sterile water at 1:5, diluting the mixture in proportion, and preserving the mixture at the temperature of minus 20 ℃ for later use.

And (3) PCR amplification: PCR amplification was performed using the barley cDNA as a template and HvWRKY gene amplification primers (SEQ ID NO.2: GGTACCATGGAGAGCGTGGATGAAAATGG, SEQ ID NO.3: ACTAGTTCATGCAAAGAAGC CAGAAACGT). PCR amplification system: cDNA: mu.L of each F/R primer was 0.5. Mu.L, 12.5. Mu.L of 2 XPromix Taq, and 25. Mu.L of ddH ₂ O was added. The PCR reaction conditions were: pre-denaturation at 95℃for 5min, denaturation at 95℃for 30s, annealing: 60 ℃/30s, extension: 72 ℃/1min,35 cycles, and finally extension at 72 ℃ for 10min.

And (3) electrophoresis of PCR products and recovery and purification of target fragments: a1% agarose gel, 0.5 XTBE, was prepared and the electrophoresis conditions were set as follows: u=110V, I =100 mA, p=90W, time =30 min. The target fragment was cut under a gel cutting instrument and recovered using a gel recovery kit (Protect Co.).

Cloning vector construction: the recovered product was ligated to pGEM-Teasy vector, the reaction system was: 5.0. Mu.L of 2 XBuffer Buffer, 3.0. Mu.LPCR gel recovery product, 1.0. Mu.LT 4 DNA ligase, 1.0. Mu. LpGEM T-easy carrier, and centrifugation was performed to mix the reagents thoroughly, and ligation was performed at 22℃for at least 1h or overnight at 4 ℃.

Transformation of recombinant plasmid: melting DH5 alpha competent cells on ice for 5min; adding all the connecting liquid, mixing, and ice-bathing for 20min; heat shock of the metal bath for 60s; after ice bath for 5min, 150 mu L of LB liquid medium is added; shaking at 37℃and 200rpm for 50min; and (3) coating a plate (Amp-resistant solid culture medium) on an ultra-clean workbench, sealing by using a sealing film after airing, and culturing overnight in a 37 ℃ incubator.

Screening of recombinant plasmids: 8 spots (half of each spot) were picked, positive and negative controls were made, and PCR identification was performed using the universal primer T7-F/SP6-R or the crossover primer; positive colonies were picked and shaken, inoculated into 6mLAmp resistant liquid LB medium in a 10mL sterilized centrifuge tube, and cultured overnight with shaking at 200rpm in a shaker at 37 ℃.

Extraction of plasmids: usingThe plasmid was extracted using the DNA plasmid miniprep kit from Sangon Biotech. The cultured bacterial liquid is sucked out of a centrifuge tube with 500 mu L to 2mL, and then 500 mu L of 50% glycerol is added, and the glycerol bacteria are preserved at-20 ℃. The remaining bacterial liquid was centrifuged at 8000g for 2min to collect bacterial cells, and the supernatant was discarded. mu.L Buffer P1 (RNaseA was added before use and stored at 4 ℃) was added, and the cells were thoroughly suspended by shaking. 250 mu LBuffer P of 2 (adding the color-developing agent before use, preserving at 28 ℃) is added, the mixture is inverted and mixed evenly, and the mixture is left stand for 2min. Then 350. Mu.L Buffer P3 was added with a pipette and turned upside down to completely disappear blue until white flocs appeared. 12000g is centrifuged for 8min, impurities are sunk into the bottom of the tube, the supernatant is transferred into an adsorption column, the supernatant is instantaneously separated, and the waste liquid is discarded. Then 500 mu LWash solution is added into the adsorption column, the instant separation is carried out, and the waste liquid is discarded. The Wash solution step was repeated once. The empty adsorption column was centrifuged for 1min. The column was transferred to a sterilized 1.5mL centrifuge tube, 40. Mu.L of an absorption buffer preheated at 60℃in advance was added, and the mixture was allowed to stand at room temperature for 1min and centrifuged for 1min. The collected DNA solution was stored. The extracted plasmid was extracted to 5. Mu.L and sent to Beijing large gene Limited for sequencing, and the successfully sequenced plasmid was stored at-20 ℃. Sequencing results show that the T vector obtained by connection contains 999bp DNA insert, and contains an ORF segment of HvWRKY genes, as shown in SEQ ID NO.1.

SEQ ID NO.1：

ATGGAGAGCGTGGATGAAAATGGAGGAAGCCGCCTTGTGGTGACCGAGCTGGGCCACATCAAGGAG

CTGGTGAGGCAGCTCGGCGTCAACCTGGGAGGCTGTCCCGAGCACTGCAAGCGTCTGGCCGCCCAG

ATCTTCGATGTAACCGAGAGGTCCATCGGCATGATCATGTCCGGGCACTTCGACTGCCCGAAGCGCTC

CGCCGCCGGCCTCGACTCGCCGCCCTTCTCCGCGACTCCCAGCCCCCTGAGCGACGTTTCGGGGATG

CCTTTCCATACCAACAACAAGAAGAGGAAGATAATGGAGAAACGGAAGCATCAGGTTAGGGTGAGCT

CGGAGGTAGGAGGAGCAGAGACCCCAGTCGATGACGGCCACAGCTGGAGGAAGTACGGCCAGAAG

GACATTCTTGGAGCCAAGCACCCAAGGGGGTACTACCGTTGCACGCACCGCAAATCCCAGGGATGCG

CGGCGACGAAGCAGGTGCAGCGCGCCGACGAGGACCCGACTCTCTTCGACGTGATCTACCACGGCG

AGCACACGTGCATTCATAAGACGGTGGCGGCGTTAGCGGCGGGACACGCGGAGGAGAACCCGGGCG

CGAGTAGGCTCCTGCAGAACCTGAGCACGAGCCTGACGGTGAACACCGAGGGGCTTACGGCGACGG

CGGGTCACCAGGGCTGCAGCACCACCACGTCCTTCTGCTTCTCCTCGCAGGCGGCGCGCGTGCTGGC

GCCGCAAGAGCACTACCCGTTCTCCATGCCGTCAACGCCGGAGAACTGCTTTGGGCAAGGCGCGTCG

CTGTCAACGTCCCTCGAACCCTCGCCGGTGACCTCGGACTCGAACCGCTTCTCCATGACCCCGTTCCA

GGCGGAGTGGAGGGCGCGGTCTGAGTTGGACGAGGTGGTGTCCGCGCTCGTGGCCGCGGGGGCGCCCGCCATGGAGGAGACCCCCTTCTCGCTGGACGGGTTTGAGTTTGACGTTTCTGGCTTCTTTGCATGA.

Example 2HvWRKY construction of Gene wheat transgene vector pLGY-02

Construction of wheat transgenic vector pLGY-02: the plasmid of the HvWRKY-T recombinant plasmid and pLGY-02 vector, which were sequenced correctly, were extracted and double digested with restriction enzymes KpnI+SpeI. The specific enzyme digestion system is as follows: 1.0. Mu.g of plasmid, kpnI (15U/. Mu.L) 1.0. Mu.L, speI (10U/. Mu.L) 1.0. Mu.L, 10 XBuffer 2.0. Mu.L, ddH ₂ O to 20. Mu.L. The enzyme cutting mixed solution is subjected to enzyme cutting in a metal bath at 37 ℃ for 3-5 hours. After the electrophoresis detection of the enzyme digestion products, the target gene fragment and pLGY-02 vector fragment are recovered by glue and are connected. The connection system is as follows: the fragment of interest was 12. Mu.L, pLGY-02 vector fragment 5. Mu.L, T4 DNA ligase 1.0. Mu.L, T4 DNA LIGASE buffer 2.0. Mu.L, and ddH ₂ O was added to 20. Mu.L. The reagents were thoroughly mixed by centrifugation, and were either attached at 22℃for at least 1h or attached overnight at 4℃in a refrigerator. The connection product is transformed into escherichia coli, PCR detection is carried out, positive bacterial colony shaking is selected, plasmid is extracted for double enzyme digestion detection, positive plasmid is sent to company for sequencing, and HvWRKY-pLYG-02 recombinant vector is obtained through screening.

Example 3HvWRKY preparation of transgenic wheat plants overexpressing

The preparation of the agrobacterium-mediated wheat transgenic material is completed by Shandong Jinan Pond biological Limited company, the transformation background material is common wheat spring wheat material JW1, and an agrobacterium-mediated wheat young embryo transformation method is adopted.

Extracting genome DNA by SDS method: sampling and marking; adding 1 polishing bead into each tube, pre-cooling with liquid nitrogen, balancing, placing into a proofing machine, polishing for 1min at 1100g, taking out, placing into 600 mu L Extractionbuffer (100 mL of 0.1M Tris-HCl pH=7.5, 100mL 0.5M EDTApH =8.0, 125mL of 10% SDS), shaking, and placing into a 65 ℃ water bath kettle for water bath for 30min; taking out, cooling to room temperature for 15min, adding 300 μl of 6MAmmoniumAcetate (ammonium acetate), mixing, placing in a refrigerator at 4deg.C for 15min, and centrifuging 12000g for 15min; 600. Mu.L of the supernatant was placed in a 1.5mL centrifuge tube containing 360. Mu.L of isopropanol, and the mixture was homogenized and placed in a refrigerator at 4℃for precipitation for 15min. Taking out 12000g, centrifuging for 15min, and pouring out supernatant; 400 μl of 75% ethanol was added, and 12000g was centrifuged for 15min, and the supernatant was poured off; repeating the steps for one time; putting the tube containing DNA on an ultra-clean workbench, opening a cover, and drying; the DNA was reconstituted with 100. Mu.L of sterile water and allowed to stand at ambient temperature for about half a day. And carrying out PCR detection on the genomic DNA of the transgenic material by using a transgenic vector detection primer to determine a transgenic positive plant.

Example 4 identification of leaf rust resistance of wheat transgenic Material HvWRKY22

Purification and propagation of rust wheat leaf: the summer spores of the wheat leaf rust toxic physiological micro-strain THTT stored at low temperature are activated for 30min in warm water at 42 ℃ before inoculation, then hydrated, 0.1% Tween-20 is added, the activated strain is evenly inoculated on leaves of the wheat leaf rust sensing material JW1 with one heart and one leaf by a smearing method, and water spray mist is sprayed after inoculation, the water spray mist is placed in a dark condition at 15+/-5 ℃ for preserving moisture for 12-18h and then transferred into a greenhouse for cultivation. Covering a glass cover and covering gauze, collecting summer spores of Rumex patiens 12d after inoculation, scanning fresh Rumex patiens spores and inoculating to wheat materials with one heart and one leaf, and collecting Rumex patiens spores for later use under drying conditions, wherein the rust may be stored in a silica gel box at 4deg.C for later use, and vacuum-pumping at-20deg.C for long-term storage.

Identification of leaf rust resistance of wheat transgenic material: one-leaf one-heart-period seedlings are obtained after wheat transgenic materials and wild wheat transgenic materials are planted for one week. When the first leaf is fully unfolded, the purified wheat rust THTT is inoculated by a shake-grafting method. The wheat seedlings after inoculation are placed in a culture room with proper temperature until the disease occurs. Taking a first leaf of a wheat transgenic material for transgenic identification; taking the second leaves of the wheat transgenes and the wild wheat for photographing, and analyzing the data of the spore-forming area percentage by using plant disease phenotype statistics ASSESS software. The results indicate that over-expression of the barley transcription factor HvWRKY gene in wheat can significantly increase the level of resistance of plants to wheat leaf rust (figure 1).

The above embodiments are only illustrative of the preferred embodiments of the present invention and are not intended to limit the scope of the present invention, and various modifications and improvements made by those skilled in the art to the technical solutions of the present invention should fall within the protection scope defined by the claims of the present invention without departing from the design spirit of the present invention.

Claims (10)

1. The barley HvWRKY gene is characterized in that the nucleotide sequence of the barley HvWRKY gene is shown as SEQ ID NO. 1.

2. The method for cloning the gene HvWRKY of barley according to claim 1, wherein the gene HvWRKY of barley is obtained by PCR cloning using leaf cDNA of barley material "Golden Promise" as a template.

3. The cloning method according to claim 2, wherein the primer sequences used in the PCR are shown in SEQ ID NO.2 and SEQ ID NO. 3.

4. An expression vector comprising the barley HvWRKY gene of claim 1.

5. The expression vector of claim 4, wherein the expression vector is a eukaryotic expression vector.

6. The expression vector of claim 5, wherein the eukaryotic expression vector is pLGY-02.

7. A host comprising the expression vector of any one of claims 4-6.

8. The host of claim 7, wherein the host is escherichia coli or agrobacterium.

9. Use of the nucleotide sequence of claim 1 for increasing leaf rust resistance of wheat.

10. The use according to claim 9, characterized in that it is a wheat plant obtained by transforming a young wheat embryo with a vector comprising the sequence shown in SEQ ID No.1, over-expressing the HvWRKY gene.