CN111621503A - Barley transcription factor HvWRKY70 gene and application thereof in stripe rust and powdery mildew resistance of wheat - Google Patents

Abstract

The invention provides a barley transcription factor HvWRKY70 gene and application thereof in stripe rust and powdery mildew resistance of wheat. The invention relates to a gene sequence, and particularly discloses a barley transcription factor HvWRKY70, a nucleotide sequence of which is shown in SEQ ID No.1, and a preparation process of a wheat transgenic material for over-expressing HvWRKY 70. Experiments prove that the HvWRKY70 gene can obviously improve the resistance level of wheat to wheat stripe rust and wheat powdery mildew.

Description

Barley transcription factor HvWRKY70 gene and application thereof in stripe rust and powdery mildew resistance of wheat

Technical Field

The invention belongs to the technical field of biological gene engineering, and relates to a barley transcription factor HvWRKY70 gene and application thereof in wheat stripe rust and powdery mildew resistance.

Background

Wheat is used as a main grain crop, the quality and the yield of the wheat seriously influence the grain safety and the social stability of China, and the high yield and the stable yield of the wheat have important significance for the agricultural development of China. Wheat stripe rust and wheat powdery mildew which are respectively caused by Puccinia striiformis wheat transformation type (Puccinia striiformis f.sp.tritici) and Blumeia graminis wheat specialized type (Blumeia graminis f.sp.tritici) are important fungal diseases which seriously affect wheat production in China. In recent years, due to the increase of planting density and the change of agricultural cultivation system, the occurrence of wheat stripe rust and powdery mildew is increasingly serious, and the quality and safety of food in China are seriously influenced. The pathogenic bacteria of wheat stripe rust and powdery mildew have the characteristic of high mutation frequency, and physiological races can complete multiple mutations in a short time, so that a wheat variety with single resistance easily loses resistance in a short time. Therefore, the development of new disease-resistant germplasm resources is necessary.

Transcription factors refer to a class of binding proteins that are capable of specific interaction with cis-acting elements in the promoter region of a gene. Transcription factors activate or inhibit the expression of certain downstream genes, also known as trans-acting factors, through interactions between them and with other related proteins. Since this century, researchers have isolated a series of plant transcription factors in succession, and have proved through research that the transcription factors not only regulate the expression of related genes in the growth and physiological processes of plants, but also play a very important role in the stress response of plants to the external environment including invasion of pathogens, low temperature, high salinity, drought, hormones, etc.

The WRKY transcription factor is considered to be a transcription factor family only existing in plants, and has a high conserved WRKY domain zinc finger protein. The conserved domain consists of about 60 amino acid residues, and 7 conserved amino acid residues WRKYGQK close to the N-terminal are regarded as a core sequence of a WRKY structure domain and can be specifically combined with a W-box of a gene promoter region to participate in expression regulation. Research shows that the WRKY transcription factor plays an important role in regulation and control in the process of plant disease-resistant defense reaction. Under the induction of some pathogenic bacteria, the plant can effectively enhance the expression and DNA binding activity of certain WRKY family members. The wheat transgenic material over-expressing the Arabidopsis AtWRKY29 gene shows that the resistance level to gibberellic disease is improved by enhancing PTI immune response. The wheat TaWRKY70 gene participates in the disease-resistant reaction of wheat to scab and high-temperature wheat stripe rust resistance in seedling stage. The rice OsWRKY45 gene participates in the regulation process of rice blast resistance.

Disclosure of Invention

The invention aims to provide a barley transcription factor HvWRKY70 gene and application thereof in wheat stripe rust and powdery mildew resistance.

The invention provides a barley transcription factor HvWRKY70 gene, the nucleotide sequence of which is shown in SEQ ID No.1, or the nucleotide sequence which is formed by substituting, deleting and/or adding one or more nucleotides and is derived from SEQ ID No.1 and codes amino acid sequences with the same functions.

The invention provides a cloning method of the gene sequence, which comprises the following steps: cloning by using a Polymerase Chain Reaction (PCR) method by using a primer and using barley cDNA as a template to obtain the gene sequence; the nucleotide sequence of the primer is shown as SEQ ID No. 2-3.

The invention provides an expression vector containing the gene sequence. Preferably, the expression vector is a eukaryotic expression vector, and more preferably is a pLGY-02(Ubi:: Gene, T-DNA) vector. For example, the eukaryotic expression vector may be obtained by cloning the aforementioned gene sequence into a pLGY-02 vector.

The present invention provides a host containing the aforementioned expression vector. Alternatively, the host may be escherichia coli, agrobacterium, wheat, or the like. For example, the wheat may be common wheat spring wheat variety JW 1.

The invention provides application of the gene sequence in regulating and controlling disease resistance of plants to wheat stripe rust and wheat powdery mildew. Preferably, the plant is wheat. More preferably, the common wheat is common wheat spring wheat variety JW 1.

The invention has the beneficial effects that: the invention provides a barley HvWRKY70 gene sequence and a preparation process of a wheat transgenic material for over-expressing HvWRKY 70. Experiments prove that the disease resistance of the wheat transgenic material to wheat stripe rust and wheat powdery mildew is remarkably improved.

Drawings

FIG. 1 shows that the disease resistance level of wheat stripe rust CYR32 inoculated with the wheat transgenic material over-expressing HvWRKY70 gene is obviously improved.

FIG. 2 shows that the disease resistance level of wheat powdery mildew E20 inoculated with the wheat transgenic material overexpressing HvWRKY70 gene is remarkably improved.

Detailed Description

Preferred embodiments of the present invention will be described in detail with reference to the following examples. It is to be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the present invention. Various modifications and alterations of this invention will become apparent to those skilled in the art without departing from the spirit and scope of this invention.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Plant material: the barley variety "Golden Promise", the spring wheat variety "JW 1" of common wheat.

Strain and carrier: coli TOP10 competent cells (CB104) were purchased from Tiangen Biochemical technology, Inc. (Beijing). The T cloning vector pGEM-Teasy was purchased from Beijing Quanyujin Biotechnology, Inc. Agrobacterium GV3101 and wheat transgenic vector pLGY-02 were maintained by the present laboratory. The puccinia striiformis toxicity physiological race CYR32 and the wheat powdery mildew toxicity physiological race E20 are stored by North river agriculture university.

The main reagents are as follows: agarose was purchased from SIGMA; 2 XPremix Taq enzyme was purchased from Shijieki Biotechnology Co., Ltd, restriction enzymes Kpn I, Spe I (TaKaRa engineering Co., Ltd., Boehringer Mannheim); sucrose, glucose, tryptone, agar powder, Tween-20, isopropanol, glycerol, beta-mercaptoethanol, sodium chloride, sodium hydroxide, absolute ethanol, boric acid, Tris-HCl and other reagents are purchased from Ministry of Wanke chemical reagents. The AL2000 DNA Marker, the plasmid small-scale extraction kit, the gel recovery and purification kit are purchased from Biotechnology, Inc., the QIAGEN plant total RNA extraction kit is purchased from Tiangen Biotechnology, Inc., and the SYBR Premix Dimer Eraser fluorescence quantitative kit and the reverse transcription kit are purchased from Beijing all-purpose gold biotechnology, Inc.

The main apparatus is as follows: applied Biosystems Veriti Thermal Cycler PCR amplification instrument (ThermoFisher), WH-861 vortex mixer (science and education instruments, taicang), high speed refrigerated Centrifuge 5810R (Eppendorf corporation), small high speed desktop Centrifuge 5415D (Eppendorf corporation), ultra clean bench (AIR TECH corporation), constant temperature shaking incubator (shanghai su kushui ltd.), SX-500 sterilization pot (TOMY corporation), ice maker (SCOTSMAN corporation), molar element type ultrapure water machine (shanghai morganic instruments ltd.), microwave oven (Galanz corporation), water bath pot (beijing maxuanchi instruments ltd.), trace amount (Eppendorf corporation), soncanary Zeiss vanno Sonnar camera (SONY), LightCycler96 real time fluorescence quantitative PCR instrument (Roche corporation), sample grinder, and the like.

Example 1 cloning of the barley HvWRKY70 Gene

And (3) extracting barley leaf RNA: RNA Extraction was performed using the RNA Extraction Kit (QIAGEN, Hilden, Germany). The second leaf sample of the seedling stage of barley material "Golden Promise" was rapidly ground into powder in a sterilized mortar with liquid nitrogen for use. Preparing Buffer RLT mixed liquor, adding 10 mu L of beta-mercaptoethanol into each ml of Buffer RLT, mixing the mixture for use at present, and placing the mixture on ice after mixing. The ground RNA sample was taken out of the liquid nitrogen, and 500. mu.L of buffer RLT mixture was quickly added thereto, followed by shaking sufficiently and centrifugation at 10000g for 2 min. The supernatant was pipetted with a pipette and transferred to a purple spin column and centrifuged at 10000g for 1 min. Transferring the collected liquid into a pink centrifugal column, adding pre-cooled absolute ethyl alcohol (the addition amount is 1/2 of the collected liquid), reversing, uniformly mixing, and standing to separate out nucleic acid. The mixture was instantaneously separated for 30 seconds, and the collected liquid was decanted. Add 700. mu.L of RW1 (protein washed off), flash-cut for 30s, and discard the pool. 500 μ L of Buffer RPE (44 mL absolute ethanol was added before use) was added and the mixture was centrifuged off instantaneously for 30s and the collected solution was decanted off. Repeating the above steps once, centrifuging at 10000g for 2 min. The column was replaced with a new 2mL collection tube and left to empty for 1 min. After the centrifugation is finished, the pink centrifugal column is put into a 1.5mL centrifuge tube carried by the kit, 30 mu L of RNase-free water is added to the center of the adsorption membrane by a pipette, and the centrifugation is carried out for 1 min. The collected RNA samples were stored and the RNA concentration was measured by Nanodrop ultramicro spectrophotometry.

Reverse transcription of barley cDNA: for extracting the obtained RNA sample

The First-Strand cDNASynthesis SuperMix reverse transcription kit (all formula gold) was inverted to generate cDNA. All RNA samples were normalized to 1000ng using RNase free ddH₂Complementing O to 8 μ L, adding 1 μ L Oligo (dT)12-18Primer (50 μ M), blowing, sucking, mixing, putting into a PCR instrument at 65 ℃/5min and 4 ℃/2min, then adding 10 μ L2 × ES Reaction Mix, 1 μ L

Mixing the RT/RI Enzyme Mix, putting the mixture into a PCR instrument again at 42 ℃/15min, and heating the mixture for 5s at 85 ℃ to ensure that

RT/RI lost activity and was stored at 4 ℃. The resulting cDNA template was purified with sterile water at a rate of 1: 5, and storing at-20 ℃ for later use.

PCR amplification with barley cDNA as template and HvWRKY70 gene amplification primer with the primer information as SEQ ID No.2-3 PCR amplification system including cDNA 1. mu.L, F/R primers 0.5. mu.L, 2 × Premix Taq 12.5. mu.L, ddH₂And O is supplemented to 25 mu L. The PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 5min,denaturation at 94 ℃ for 30s, annealing: 60 ℃/30s, extension: 72 deg.C/1 min, 35 cycles, and finally an extension of 7min at 72 deg.C.

Electrophoresis of PCR products and recovery and purification of target fragments: preparing 1% agarose gel and 0.5 × TBE electrophoresis solution, wherein the electrophoresis conditions are as follows: U110V, I100 mA, P90W, Time 30 min. The target fragment was cut into gel under a gel cutter and recovered with a gel recovery kit (Bio-chemical Co.).

Construction of cloning vector: connecting the recovered product to a pGEM-Teasy vector, wherein the reaction system is as follows: mu.L of 2 XBuffer Buffer, 3.0. mu.L of PCR gel recovery product, 1.0. mu. L T4DNA ligase, and 1.0. mu.L of pGEM T-easy vector, and centrifuging to mix the reagents well, and ligating at 22 ℃ for at least 1h or 4 ℃ overnight.

Transformation of recombinant plasmid: thawing DH5 alpha competent cells on ice for 5 min; adding all the connecting liquid, mixing, and ice-cooling for 20 min; performing heat shock on the metal bath for 60 s; adding 150 mu L of LB liquid culture medium after ice bath for 5 min; shaking at 37 deg.C and 200rpm for 50 min; and (3) coating a plate (Amp resistant solid culture medium) on an ultra-clean workbench, airing, sealing by using a sealing film, and culturing in an incubator at 37 ℃ overnight.

Screening of recombinant plasmids: 8 spots (half of each spot is reserved) are picked, positive and negative controls are made, and a universal primer T7-F/SP6-R or a cross primer is used for PCR identification; the positive colonies were picked and shaken, inoculated in 6mL of LB medium in sterile centrifuge tubes, and shaken overnight at 200rpm in a shaker at 37 ℃.

And (3) plasmid extraction: use of

The DNA plasmid miniprep kit from Sangon Biotech company extracts plasmids. The cultured cell suspension was aspirated into a 2mL centrifuge tube (500. mu.L), and then 500. mu.L of 50% glycerol was added thereto, followed by storing the glycerol cells at-20 ℃. The remaining bacteria solution was centrifuged at 8000g for 2min to collect the cells, and the supernatant was decanted. 250. mu.L of Buffer P1 (RNase A was added before use, stored at 4 ℃) was added thereto, and the cells were suspended thoroughly by shaking. Add 250. mu.L Buffer P2 (color developing reagent added before use, stored at 28 ℃), mix by inversion, and let stand for 2 min. Then 350. mu.L of Buffer P3 was added with a pipette and turned upside down to let blueThe color disappeared completely until white floe appeared. Centrifuging at 12000g for 8min, precipitating impurities into the bottom of the tube, transferring the supernatant into an adsorption column, instantly separating, and discarding the waste liquid. Then 500. mu.L of Wash solution was added to the adsorption column, flash separated, and the waste solution was discarded. The Wash solution step is repeated once. The column was centrifuged for 1 min. The column was transferred to a sterile 1.5mL centrifuge tube, 40. mu.L of an Elution buffer preheated at 60 ℃ in advance was added, allowed to stand at room temperature for 1min, and centrifuged for 1 min. The collected DNA solution was stored. And (3) sucking 5 mu L of the extracted plasmid, sending the extracted plasmid to Beijing Huada Gene Limited for sequencing, and storing the successfully sequenced plasmid at-20 ℃. Sequencing results show that the T vector obtained by connection contains a 927bp DNA insert comprising an ORF segment of HvWRKY70 gene, such as SEQ ID No. 1.

Example 2 construction of wheat transgenic vector pLGY-02 for HvWRKY70 gene.

Construction of wheat transgenic vector pLGY-02, extracting HvWRKY70-T recombinant plasmid and pLGY-02 vector plasmid with correct sequencing, and performing double enzyme digestion by using restriction enzymes KpnI + SpeI, wherein the enzyme digestion system comprises 1.0 μ g of plasmid, 1.0 μ L of KpnI (15U/μ L), 1.0 μ L of SpeI (10U/μ L), 2.0 μ L of 10 × Buffer, and ddH₂And O is supplemented to 20 mu L. The enzyme digestion mixture is cut in a metal bath at 37 ℃ for 3-5 h. And (3) after enzyme digestion product electrophoresis detection, recovering a target gene fragment and a pLGY-02 vector fragment by glue, and connecting. A connection system: 12. mu.L of the target fragment, 5. mu.L of the pLGY-02 vector fragment, 1.0. mu.L of T4DNA Ligase, 2.0. mu.L of T4DNA Ligase buffer, ddH₂And O is supplemented to 20 mu L. The reagents were mixed well by centrifugation and were either connected at 22 ℃ for at least 1h or in a refrigerator at 4 ℃ overnight. And (3) transforming the ligation product into escherichia coli, carrying out PCR detection, selecting positive bacterial colony shake bacteria, extracting plasmids for double enzyme digestion detection, sending the positive plasmids to a company for sequencing, and screening to obtain the HvWRKY70-pLYG-02 recombinant vector.

Example 3 preparation of HvWRKY70 overexpression wheat transgenic plant

The preparation of the agrobacterium-mediated wheat transgenic material is finished by Shandong Jinnan nation biology limited company, the transformation background material is common wheat spring material JW1, and an agrobacterium-mediated wheat immature embryo transformation method is adopted.

Extracting genome DNA by the SDS method: sampling and marking; adding 1 grinding bead into each tube, precooling with liquid nitrogen, balancing, putting into a sample making machine, grinding for 1min at 1100g, taking out, putting into 600 mu L Extraction buffer (100mL of 0.1M Tris-HClpH 7.5, 100mL of 0.5M EDTA pH 8.0, 125mL of 10% SDS), shaking, and putting into a 65 ℃ water bath kettle for 30 min; taking out, cooling on ice for 15min to room temperature, adding 300 μ L of 6M Ammonium Acetate, mixing, placing in 4 deg.C refrigerator for 15min, and centrifuging at 12000g for 15 min; and putting 600 mu L of the supernatant into a 1.5mL centrifuge tube which is already filled with 360 mu L of isopropanol, uniformly mixing, and putting the mixture in a refrigerator at 4 ℃ for precipitation for 15 min. Taking out, centrifuging at 12000g for 15min, and pouring out the supernatant; adding 400 μ L of 75% ethanol, centrifuging at 12000g for 15min, and removing supernatant; repeating the steps once; placing the tube containing the DNA on a superclean bench, opening a cover, and drying by blowing; DNA was redissolved in 100. mu.L of sterile water and allowed to stand at room temperature for about half a day. And carrying out PCR detection on the transgenic material genome DNA by using the transgenic vector detection primer to determine a transgenic positive plant.

Example 4 identification of stripe rust and powdery mildew resistance of wheat transgenic Material HvWRKY70-OE

Purification and propagation of wheat stripe rust: before inoculation, summer spores of a low-temperature stored toxic physiological race CYR32 of wheat stripe rust are activated in warm water at 42 ℃ for 30min, then hydrated, 0.1% Tween-20 is added, activated strains are evenly inoculated on leaves of a wheat stripe rust material JW1 of one heart and one leaf by a smearing method, and after inoculation, water mist is sprayed, the leaves are kept moist for 12-18h under the dark condition of 15 +/-5 ℃, and then the leaves are transferred to a greenhouse for culture. Covering a glass cover and covering gauze, generating a large amount of spore piles on the surfaces of left and right leaves after 12 days of inoculation, collecting summer spores of the rust, scanning and inoculating fresh rust spores to a wheat material with one heart and one leaf to expand and propagate a large amount of rust for a test, collecting the rust spores under the dry condition for later use, storing the rust spores in a silica gel box at 4 ℃ for short term use, and vacuumizing and storing at-20 ℃ for long term storage.

Purifying and propagating wheat powdery mildew: inoculating diseased leaves of conidia of fresh erysiphe graminis to a test-tube plantlet of a sterile susceptible wheat variety JW1 by a shaking inoculation method, culturing in an 18 ℃ incubator for 4-5d until pathogenic bacteria infection points can be observed by naked eyes, shearing wheat leaf sections with single sporophyte in a super clean workbench, placing on a water agar culture medium containing 1% benzimidazole, culturing in the 18 ℃ incubator for about one week, then transferring to a sterile susceptible wheat seedling, completing the first purification of the erysiphe graminis, performing the second separation and purification by the same method, and inoculating the erysiphe graminis subjected to the two-time separation and purification to the sterile susceptible wheat seedling for propagation.

And (3) identifying the stripe rust and powdery mildew resistance of the wheat transgenic material: after the wheat transgenic material and the wild type thereof are planted for one week, one-leaf one-heart-stage seedlings are obtained. When the first leaf blade is completely unfolded, purified wheat stripe rust CYR32 and wheat powdery mildew E20 are inoculated by a shaking inoculation method. And (4) placing the inoculated wheat seedlings in a culture room at a proper temperature until the diseases occur. Taking a first leaf of the wheat transgenic material for transgenic identification; and (3) taking a second leaf of the wheat transgene and wild wheat for photographing, and analyzing data of sporulation area percentage by using plant disease phenotype statistics ASSESS software. The result shows that the overexpression of the barley transcription factor HvWRKY70 gene in wheat can obviously improve the resistance level of plants to wheat stripe rust (figure 1) and wheat powdery mildew (figure 2).

Sequence listing

<110> university of agriculture in Hebei

<120> barley transcription factor HvWRKY70 gene and application thereof in stripe rust and powdery mildew resistance of wheat

<130>MLOC_66134

<160>3

<170>SIPOSequenceListing 1.0

<210>1

<211>927

<212>DNA

<213> HvWRKY70 Gene sequence ()

<400>1

atggagaccc cgttcgcgca ggtgacggat gatctgatca aggggcggga gttggcaacg 60

cagctgcagg gcctcctccg ggactccccc aagtccggcc tcataatgga ccggatcctc 120

cacgccttct cccgttccat ccatgccgcc aaggccgcgg tcgccaccag cgagagggcg 180

tcgtccgacg tgcagagcga ggtcatcgac ggcgtgagcg gcggcgggaa gaggaagccc 240

gcctccgccg ccgctggagg aaaccgcagg gcctgccgga gaagcaggac ccagcaatcg 300

tccgtcgtct tcacgaaaag catcaagagc ttggacgacg ggcatgcatg gcgcaagtac 360

gggcagaagg agatacacaa ctccaagcac tcgagggcct acttccggtg cacgcacaag 420

tacgaccagc tgtgcgcggc gcagcggcag gtccagcgct gcgacgacga cgagggcatg 480

ttcagggtca cctacatcgg cgtgcacccc tgccgggacc ctgccgccgc cgtggcgccg 540

cacgtcctcc acctgaccgg caccgccgaa ggcatgcacg ccggctgccg cctcatcagc 600

ttcgcgcctg gcggcgccgc cgccactacc catgatgcca ccgccagcac gaccacgaac 660

gccaacttgg tcgacaagga cgccgcgacg gggtccggcc ggcagggcat gaagcctgag 720

agcggcgacc aggaggaggt gctgagcagc cgcacaccgg gtaactctgc cccgcgcagc 780

accgccccgg cggcgacggc gcctgcttgg cccgaccagg gagacgtgac gtccacacgg 840

caatacggtg gtgccgttag ctttggagag taccttgatg attatacgtc ccttggggac 900

ctagcgtcgt acgtactcga tcattga 927

<210>2

<211>24

<212>DNA

<213> Artificial sequence-Forward primer ()

<400>2

ggtaccatgg agaccccgtt cgcg 24

<210>3

<211>30

<212>DNA

<213> Artificial sequence-reverse primer ()

<400>3

actagttcaa tgatcgagta cgtacgacgc 30

Claims (9)

1. The barley transcription factor HvWRKY70 gene is characterized in that the nucleotide sequence is shown in SEQ ID No. 1.

2. The method for cloning a gene sequence according to claim 1, wherein the gene sequence is cloned by PCR using a primer using a cDNA of barley "Golden Promise" material as a template.

3. The nucleotide sequence of the primer is as follows:

HvWRKY70-ORF-F：GGTACCATGGAGACCCCGTTCGCG

HvWRKY70-ORF-R：ACTAGTTCAATGATCGAGTACGTACGACGC。

4. an expression vector comprising the gene sequence of claim 1.

5. The expression vector of claim 4, wherein the expression vector is a eukaryotic expression vector.

6. The expression vector of claim 5, wherein the expression vector is the wheat transgene vector pLGY-02.

7. A host comprising the expression vector of any one of claims 4 to 6.

8. Use of the gene sequence of claim 1 for modulating disease resistance of plants to wheat stripe rust and wheat powdery mildew.

9. Use according to claim 8, wherein the plant is Triticum aestivum.

Images