CN108715853A - NtHAK11 genes and application thereof - Google Patents
NtHAK11 genes and application thereof Download PDFInfo
- Publication number
- CN108715853A CN108715853A CN201810508861.9A CN201810508861A CN108715853A CN 108715853 A CN108715853 A CN 108715853A CN 201810508861 A CN201810508861 A CN 201810508861A CN 108715853 A CN108715853 A CN 108715853A
- Authority
- CN
- China
- Prior art keywords
- nthak11
- plant
- nucleotide sequence
- tobacco
- carrier
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H4/00—Plant reproduction by tissue culture techniques ; Tissue culture techniques therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Developmental Biology & Embryology (AREA)
- Biochemistry (AREA)
- Zoology (AREA)
- Botany (AREA)
- Wood Science & Technology (AREA)
- Cell Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Nutrition Science (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Environmental Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses NtHAK11 genes and application thereof.The NtHAK11 genes of the present invention have SEQ ID NO：Nucleotide sequence shown in 1 or its variant with promotion potassium of plants absorption function.The invention further relates to the target sequence nthak11 of energy specific recognition NtHAK11 genes, such as SEQ ID NO：2.The invention further relates to convert the genetically modified plants for having NtHAK11 genes or its variant and the gene editing plant using nthak11 as target sequence.The purposes for the invention further relates to the NtHAK11 genes or its variant being used to that potassium of plants to be promoted to absorb and the method for promoting potassium of plants to absorb, and reduce the purposes and its method that potassium of plants absorbs using editor's NtHAK11 genes.
Description
Technical field
The present invention relates to a kind of genes, more particularly to NtHAK11 genes, and its promote the purposes of potassium of plants absorption.
Background technology
Tobacco belongs to Solanaceae (Solanaceae) cigarette category (Nicotiana), is the fifth-largest family of plant of Solanaceae, and about more than 60
Kind, can cigarette and pipe tobacco processed, the detritus of stem and leaf can be insecticide.Having for China's introducing cultivation is several, wherein with Nicotiana tabacum
(Nicotiana tobacum L.) cultivation is most wide.Tobacco is annual or perennial industrial crops, and cigarette platymiscium body cell is total
There are a kind of ten chromosomes of number, respectively 2,n=9 II, 10 II, 12 II, 16 II, 18 II, 19 II, 20 II, 21 II, 22 II, 23
Ⅱ,24Ⅱ(Goodspeed T H et al.,1944).Nicotiana tabacum (Nicotiana tobacum；2n=24 II=
It is 48TTSS) by villiform tobacco (Nicotiana tomentosiformis；II=24TT of 2n=12) and woods tobacco
(Nicotiana sylvestris；II=24SS of 2n=12) the two ancestors kind is natural by a series of hybridization, chromosome
Double the allotetraploid to be formed (Goodspeed T H, 1944；Gerstel D U,1960；GerstelD U,1963).Cigarette
For grass during allopolyploidzation, genomic source is 47% in the general ratio of villiform tobacco (T genomes), is derived from
The general ratio of woods tobacco (S genomes) be 53% (Sierro etal., 2014), wherein villiform tobacco and woods tobacco gene
Group repetition DNA fragment loss 3.7%-8% (Leitch et al., 2008；Sierro et al., 2014), T genomes
Loss ratio is more than S genomes, has certain tendentiousness (Renny-Byfield et al., 2011).
Tobacco is important one of the industrial crops in China, and during its growth and development, potassium is that tobacco uptake is most
Mineral element.Potassium plays the part of critically important role in the physiology course of cigarette strain, it significantly affect cigarette strain metabolism and
Energetic supersession can almost participate in all physiological metabolism processes of cigarette strain, include the activation of enzyme, film transhipment, anion neutralize with
And osmotic adjustment etc. (Clarkson D T etal., 1980).Potassium element can enhance the photosynthesis of plant, promote plant
The formation of interior sugar and starch；The activity that breaks down proteins enzyme can be improved, to influence the metabolic process of nitrogen；Cell can be improved
Osmotic pressure, increase the drought resistance and cold resistance of plant；Also it can promote the formation of mechanical tissue and improve the premunition (land of plant
Jing Ling, 2003).
Potassium content in tobacco leaf is closely related with quality of tobacco, is one of the important indicator for weighing quality of tobacco.Tobacco leaf contains potassium
Amount directly affects the jealous of tobacco leaf, oil, perfume quantity, aroma quality and glows and hold the index of quality such as firepower, and with tobacco product
Safety breath breath is related, to be considered as the important indicator (stone towering like a mountain peak etc., 1997) of cigarette quality.Sims etc. (1981) studies table
Bright, the height of potassium content in tobacco leaf determines that the content of harmful chemical component in generated gas in tobacco leaf combustion process, tobacco leaf contain
Potassium amount is more, and the type and quantity of thermal decomposition product can also be substantially change therewith, and the harmful substance contents such as tar can be
It reduces.Yan little Long etc. (1997) is also indicated that, with the increase of potassium content in tobacco leaf, the nicotine of cigarette, total alkaloid, suction time
Number, static combustion, particle matter equal size reduce.But compared with international sound tobacco, China's potassium content of tobacco leaf is relatively
Low, gap is apparent.
By increasing K Amounts, improving fertilizing method, can play a role to improving potassium content in tobacco leaf, still
Tobacco is absorbed and utilized it limited, and one side potassium content of tobacco leaf is not significantly increased, on the other hand increases Potassic fertilizer resources
Consumption, while being largely lost for potash fertilizer also damages ecological environment.Tobacco is improved to potassium element by improvement of genes
Absorption and use efficiency, can fundamentally solve efficiently, reasonably utilize potassium element, improve tobacco leaf in potassium content.
KUP/HAK/KT families are that the potassium that living nature is found earliest, family gene number is most, function is most rich and varied turns
There are certain distribution in Yun Ti families in multiple species.The expression of the family gene is by the regulating and controlling effect of many factors, master
If being regulated and controled by factors such as plant own growth and development regulatory factor and environment, KUP/HAK/KT potassium transporter can both be situated between
Plant is led under low potassium concn to the absorption of K+, moreover it is possible to the increase for promoting plant cell, in the transportational process of root growth element
Also play an important role, at the same also assist in plant growth and development and stress response mechanism (Gierth M et al.,
2007)。
It is found according to correlative study, there are certain differences on expression pattern by KUP/HAK/KT potassium transporter family member
It is different, respectively there is corresponding functional characteristic.Rubio F (2000) andM A etc. (2002) pass through Molecular Phylogeny
Learn sorting technique to the KUP/HAK/KT potassium transporter families of barley, arabidopsis and tobacco (Gupta M et al., 2008) at
Member's classification analysis, builds phylogenetic tree, KUP/HAK/KT family genes can be divided into 4 gene evolution clusters：ClusterⅠ,
Cluster II, Cluster III and Cluster IV.Wherein, I members of Cluster are typical High affinity K+ transporter；
II members of Cluster are mainly low compatibility potassium transporter；Cluster III and IV members of Cluster are mainly while having Na+
The High affinity K+ transporter (Grabov A et al., 2007) of transport function.Wherein HAK11 is allusion quotation in III members of Cluster
One of double compatibility potassium transporters of type.
Currently, clone obtains the K+ absorption and transport body genes of three KUP/HAK/KT families in tobacco, it is chrysanthemum respectively
The NrHAK1 (Guo Z et al., 2008) of tobacco, the NtHAK1 (Shandong dawn etc., 2011) of Nicotiana tabacum, woods tobacco
NsHAK11 (Song Yufeng etc., 2014).
Invention content
The purpose of the present invention is to provide a kind of nucleotide sequence (NtHAK11 gene sequences for having and promoting potassium absorption function
Row).
Tobacco NtHAK11 gene orders of the present invention, and NtHAK11 is confirmed by overexpression and gene editing technology
Gene has the function of that tobacco potassium is promoted to absorb.
Inventor has cloned NtHAK11 genes, and by turning base on the basis of completed tobacco genome sequencing
Cause and gene editing technical identification its function, by the transfer-gen plant for, finding to have converted compared with the control group NtHAK11 genes
Under potassium content is significantly improved than control group, and the plant potassium content obtained into edlin to NtHAK11 genes is more notable than control group
Drop.Thus it is to absorb relevant functional gene with potassium to demonstrate NtHAK11 genes, completes the present invention.
Specifically, the present invention includes following several respects：
One aspect of the present invention is related to a kind of nucleotide sequence for having and promoting potassium of plants absorption function, the nucleotide
Sequence contains SEQ ID NO：Nucleotide sequence shown in 1, i.e. NtHAK11 genes, the sequence of the gene are as follows：
TCCCTGCATATTCTCCTAAGAAACGCATATATATAGTCAATAGCAATTTTCTTATAGAACCTAGAGTCTCTCCTTGC
TCTAACTACAGTGTTTCCAAGAATGTGTACAACCCCAGCATCTCGACAACGATTTAAGAATTCCATTTCGTCCACTT
CTGCCTGGCTGCTCTCACGGCCCAACGATGATGTGACTGTATTGCTTCCTTGAGTGGGAGATTTCACAGGTACTATT
GATTCCACCGTCGAACATGTAAAGTCATTATTTCCTGTAGTTGCCAATTTGACTTTGATTTCTGAATCCAGCAGTGA
CACCGATGCAAAGAATCATAAGTATCCAATTTATATCAGGAATATAAATCTGCCCAAGGAACTTCTTTGACGTATGT
ACAACCTTAACTCTTGGAAAACAGCCTAGTGCCAGAGCTTGCTTGATTATTGAAAATGTAGCAGAAATGGTTGCTTG
ACTTGCAACGATAGCAGCTAAAGTTGCAATGACAAAAACTGGCCAGTATATGCTTTCTGGAATAGAACGGTAGAATG
CATCGACAACATGTTCCTTATTTTGCATGAGGTATGCTGCTTGCCCCGTATAGGTTAAAAGAGGGCATGGGAAAACA
ATGACTGTGAAAGCAAGCTGTATTGCTGACACTGGAAAATGAGCAAGATCAGCAAAAAGTGCCTCTGTCCCTGTAAT
GCTGAGCATTATTCCTCCCAGAGATGTCCAACCCTCTTTCTTTCTCCTCCTAAAATACCTATATATGTACACAGGAG
AAAAAGCCCTCAAAACAGAGCTATCGTACTTCCAGATGTTGAAGATGCCGATACCTCCTACTAATAGAAACCAAAGC
AGCACAATGGGAGCAAACAGCCAACCAACCCTGTCTGTGCCATAGTGTTGTAAGCTAAACAGACCAACCAATATAAT
GACTGCAACAACCACCACTACGTCATTACTCATCTTTGGATGATCCACCTTGATCCCGCCAGTAGCTGAAAGAGCTG
ATATAGCCGGAGTGAGAATTCCATCACCTATTACCGTGCAAGTGCCAACAATTACAATAATAAGAAGTGCATTCTTC
CTGAATGAATATGCCTCCAACCATCGTTTTGTTTTTGCAGCAAATGAATGCTCATGGAATGTGCTACGGCTATAAGT
TGTCAGCTCCTCATCTGTCCGATGTTGGTTGGGAATTGTCTTTATCTTAGCATGGCGACATAGTAAAGAATAAAGAG
CAAAAGTCCCGCCTTGGCCATTGTCATTCGCTCTACAAACAATAAAAACATACTTGAGGAGAGGGATAAGTGTGAGG
GAATATATAATTAATGAAAGGGCGCCAATGACATCCTCTGTATCATCAATTCCATGGGGAAATGTATTGTAGAACAC
ATACAAAGGAGAAGTTCCCAAGTCTCCATAAACCACACCTAGACTCTGAAAAGCAAGCCGCAGAAGCAACAATGCCG
AGAATTTCTTTTCTCTATACATATTTTTGAGTCTACCAGCCTCCTCACCCATAGGCTGATCAATCTTTTGGTCTAAT
TCCCACATCCCTCCTTTAGTT SEQ ID NO：1.
The invention further relates to SEQ ID NO：The nucleotide sequence of the complementation of sequence shown in 1 or its have promote potassium of plants
The variant chosen from the followings of absorption function：
1) under the conditions of high stringency with SEQ ID NO：The nucleotide sequence of nucleotide sequence hybridization shown in 1.
2) to SEQ ID NO：Nucleotide sequence shown in 1 carries out substitution, missing, the addition modification of one or more bases
Nucleotide sequence, and,
3) with SEQ ID NO：Nucleotide sequence of the nucleotide sequence shown in 1 at least 90% sequence identity.
Typically, " hybridization conditions " classify according to " stringency " degree of condition used when measuring hybridization.Stringency journey
Degree can be with the melting temperature (Tm) of such as nucleic acid binding complex or probe for foundation.For example, " maximum stringency " is typically
It is happened at about Tm-5 DEG C (being less than 5 DEG C of probe Tm)；" high stringency " is happened at about 5-10 DEG C of Tm or less；" moderate stringency "
It is happened at about 10-20 DEG C of probe Tm or less；" low stringency " is happened at about 20-25 DEG C of Tm or less.Alternatively, further
Ground, the stringency washes that hybridization conditions can using the salt of hybridization or ionic strength conditions and/or one or more times is foundations.For example, 6
The extremely low stringencies of × SSC=；3 × SSC=is down to moderate stringency；1 × SSC=moderate stringencies；0.5 × SSC=high etc. is tight
Sigma compactness.Functionally, maximum stringent conditions may be used to determine and hybridization probe is tight same or nearly tight same core
Acid sequence；And high stringency condition is used to determine the nucleic acid sequence for having about 80% or more sequence identity with the probe.
For requiring highly selective application, typically expectation to form hybrid using relatively restricted condition, for example,
Selection relatively low salt and/or high-temperature condition.(Sambrook, J. etc. (1989) molecular cloning, the laboratory hand such as Sambrook
Volume, Cold Spring HarborPress, Plainview, N.Y.) it provides and exists including moderate stringency and high stringency
Interior hybridization conditions.
For purposes of illustration only, the suitable Moderate hybridized with other polynucleotides for detecting the polynucleotides of the present invention
Condition includes：With 5 × SSC, 0.5%SDS, 1.0mM EDTA (pH8.0) solution prewashing；It is miscellaneous in 5 × SSC at 50-65 DEG C
It hands over overnight；Then with 2 containing 0.1%SDS ×, 0.5 × and 0.2 × SSC respectively washed twice at 65 DEG C 20 minutes.This field skill
Art personnel, which should be appreciated that, can easily operate hybridization stringency, such as change the salt content and/or hybridization temperature of hybridization solution.
In the present invention, it is described under the conditions of high stringency with SEQ ID NO：The core of nucleotide sequence hybridization shown in 1
Nucleotide sequence has and SEQ ID NO：The same or analogous activity for promoting potassium of plants and absorbing of nucleotide sequence shown in 1.
In the present invention, described to SEQ ID NO：The substitution of the one or more bases of nucleotide sequence progress shown in 1,
It lacks, addition modified nucleotide sequence, refers to the 5 ' ends and/or 3 ' ends separately or concurrently in the nucleotide sequence, and/or
Interior sequences carry out for example no more than 2-45, are either no more than 2-30 and are either no more than 3-20 or are no more than 4-15
It is a, be either no more than the substitution of 5-10 or the base indicated respectively with continuous integral number one by one no more than 6-8, missing,
Addition modification.
In the present invention, described to SEQ ID NO：Nucleotide sequence shown in 1 is carried out such as above-mentioned one or more bases
Substitution, missing, addition modified nucleotide sequence have and SEQ IDNO：Nucleotide sequence shown in 1 is same or analogous
Function.
Illustrated by a kind of polynucleotides, its nucleotide sequence for example with SEQID NO：1 reference core
" homogeneity " that nucleotide sequence at least has 95% refers to：In SEQ IDNO：Every 100 nucleotide of 1 reference nucleotide sequence
In, the nucleotide sequence of the polynucleotides is other than the difference containing up to 5 nucleotide, the nucleotide sequence of the polynucleotides
It is identical as reference sequences.In other words, in order to obtain nucleotide sequence multinuclear identical with reference nucleotide sequence at least 95%
Thuja acid, up to 5% nucleotide can be deleted or by another nucleotide substitution in reference sequences；Or it can be by some nucleotides inserteds
In reference sequences, wherein the nucleotide being inserted into can up to the total nucleotide of reference sequences 5%；Or it in some nucleotide, deposits
In the combination of deletion, insertion and replacement, wherein the 5% of the total nucleotide of the nucleotide up to reference sequences.Reference sequences
These mutation can be happened at 5 ' or 3 ' terminal positions of reference nucleotide sequence, or between these terminal positions arbitrarily
Side, they or be individually dispersed in the nucleotide of reference sequences, or be present in reference sequences with the neighbouring groups of one or more.
In the present invention, for determine the algorithm of sequence identity and sequence similarity percentage be such as BLAST and
BLAST2.0 algorithms, they are described respectively in Altschul etc. (1977) Nucl.Acid.Res.25：3389-3402 and
Altschul etc. (1990) J.Mol.Biol.215：403-410.Using for example described in document or default parameters, BLAST and
BLAST2.0 is determined for the nucleotide sequence homology percentage of the present invention.Executing the software of BLAST analyses can lead to
It is for the public to obtain to cross National Biotechnology information centre.
In the present invention, described and SEQ ID NO：Nucleotide sequence shown in 1 has at least 90% sequence identity
Nucleotide sequence include and SEQ ID NO：The substantially same polynucleotide sequence of sequence disclosed in 1, such as when using herein
When the method (being analyzed for example, by using the BLAST of standard parameter), at least 90% is contained compared with polynucleotide sequence of the present invention
The sequence of sequence identity, preferably at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or higher
Those of homogeneity sequence.
In the present invention, described and SEQ ID NO：Nucleotide sequence shown in 1 has at least 90% sequence identity
Nucleotide sequence have and SEQ ID NO：The same or analogous function of promoting potassium to absorb of nucleotide sequence shown in 1.
In the present invention, the NtHAK11 gene sources are in Nicotiana tabacum NC89.
Another aspect of the present invention is related to having specific recognition and the target sequence of editor to above-mentioned NtHAK11 gene orders
Row such as contain SEQ ID NO：Target sequence shown in 2, the target sequence are as follows：
ATTAGGCAAAGTACTAACACGGG SEQ ID NO：2.
Another aspect of the present invention relates to a kind of carriers, which is characterized in that the carrier contains of the present invention
NtHAK11 nucleotide sequences, the carrier can be for example, by being inserted into cloning vector or expression vector by above-mentioned nucleotide sequence
And obtain, or can be obtained by artificial synthesized.
Another aspect of the present invention relates to a kind of recombinant vectors, it is characterised in that the recombinant vector contains of the present invention
NtHAK11 nucleotide sequences, the recombinant vector can by by above-mentioned nucleotide sequence be inserted into cloning vector or expression carry
Body and obtain.
Cloning vector suitable for building recombinant vector of the present invention includes but not limited to, such as：pUC18,pUC19,
pUC118、pUC119、pMD19-T、pMD20-T、pMD18-T Simple Vecter、pMD19-T Simple Vecte、
PEASY-T1 etc..
Include but not limited to suitable for building expression vector of the present invention, such as：pC2301M1DPB,pBI121,
P13W4, pGEM etc..
In one embodiment of the invention, the recombinant vector is pC2301M1DPB+NtHAK11 recombinant vectors.
Another aspect of the present invention relates to a kind of carriers, which is characterized in that the carrier contains of the present invention
Nthak11 target sequences, the carrier can be for example, by by above-mentioned target sequence inserting edition carriers or can be by manually closing
At obtaining.
Another aspect of the present invention relates to a kind of recombinant vectors, it is characterised in that the recombinant vector contains of the present invention
Nthak11 target sequences, the recombinant vector can obtain by by above-mentioned target sequence inserting edition carrier.
In another embodiment of the present invention, editor's carrier is sgRNA-Cas9+nthak11 recombinant vectors.
Another aspect of the present invention relates to a kind of recombinant cell containing carrier of the present invention, the recombinant cell can be with
It is obtained by will be converted to host cell containing carrier of the present invention.
Host cell suitable for building recombinant cell of the present invention includes but not limited to, such as：Agrobacterium tumefaciens cell
LBA4404, EHA105, GV3101 etc..
In one embodiment of the invention, the recombinant cell is recombinational agrobacterium (Agrobacterium
tumefaciens)EHA105-pC2301M1DPB+NtHAK11。
In one embodiment of the invention, the recombinant cell is recombinational agrobacterium (Agrobacterium
tumefaciens)EHA105-sgRNA-Cas9+nthak11。
The further aspect of the present invention is related to a kind of dicotyledon callus, which is characterized in that the callus turns
Change the nucleotide sequence for having the present invention and/or carrier and/or the recombinant cell infected with the present invention.
The further aspect of the present invention is related to a kind of genetically modified plants, which is characterized in that the genetically modified plants conversion has this
The nucleotide sequence and/or carrier of invention and/or the recombinant cell of the infection present invention.
The further aspect of the present invention is related to the nucleotide sequence of the present invention and/or pC2301M1DPB+NtHAK11 recombinations carry
The purposes that body and/or EHA105-pC2301M1DPB+NtHAK11 recombinant cells are used to that potassium of plants to be promoted to absorb, and for making
Standby genetically modified plants or the purposes for plant breeding.
The sgRNA-Cas9+nthak11 that the further aspect of the present invention is related to the present invention edits carrier and/or EHA105-
The purposes that sgRNA-Cas9+nthak11 recombinant cells absorb for reducing potassium of plants, and be used to prepare gene editing plant or
Purposes for plant breeding.
The callus that the further aspect of the present invention is related to the present invention is used to prepare genetically modified plants or is used for plant breeding
Purposes.
The present invention further aspect be related to it is a kind of promotion potassium of plants absorb method, the method includes by the present invention core
Nucleotide sequence and/or pC2301M1DPB+NtHAK11 recombinant vectors are transformed into plant, or the EHA105- with the present invention
PC2301M1DPB+NtHAK11 recombinant cells infection plant.
The further aspect of the present invention is related to a kind of method that reduction potassium of plants absorbs, and the method includes by the present invention's
SgRNA-Cas9+nthak11 edits carrier and is transformed into plant, or the EHA105-sgRNA-Cas9+nthak11 weights with the present invention
Group cell infection plant.
The method includes converting the callus of dicotyledon with the nucleotide sequence of the present invention.In this hair
In a bright embodiment, nucleotide sequence of the trans-utilization of the dicotyledon callus containing the present invention
Recombinant cell.In one embodiment of the invention, before being utilized in the conversion process of the dicotyledon callus
The recombinational agrobacterium EHA105-pC2301M1DPB+NtHAK11 stated.It is described double in one embodiment of the invention
The callus of cotyledon plant is tobacco healing tissue, and specifically, the tobacco is NC89.
The method includes converting the callus of dicotyledon with the target sequence editor of the present invention.In this hair
In a bright embodiment, the recombination of target sequence of the trans-utilization of the dicotyledon callus containing the present invention
Cell.In one embodiment of the invention, it is utilized in the conversion process of the dicotyledon callus above-mentioned
Recombinational agrobacterium EHA105-sgRNA-Cas9+nthak11.In one embodiment of the invention, the dicotyledonous plant
The callus of object is tobacco healing tissue, and specifically, the tobacco is NC89.
In the present invention, genetic plant transformations technology can be used target gene is inserted into Plant Genome, including agriculture
Bacillus mediated transformation, virus-mediated conversion, microinjection, particle bombardment, via Particle Bombardment Transformation and electroporation etc..This field week
Know, agriculture bacillus mediated genetic transformation is commonly used for the genetic transformation of dicotyledon and dicotyledon, but other conversion skills
Art can also be used for the genetic transformation of dicotyledon of the present invention.After genetic transformation, screened and again using general method
The raw plant for being integrated with expression unit.
In the present invention, plant gene editing technique can be used to the target gene in Plant Genome into edlin, wrap
Include CRISPR/Cas9, ZFNs, TALENs etc..Well known in the art, CRISPR/Cas9 technologies are commonly used for dicotyledon and double
The gene editing of cotyledon plant, but other editing techniques can also be used for the gene editing of dicotyledon of the present invention.Gene
After editor, the plant for being integrated with expression unit is screened and regenerated using general method.
An aspect of of the present present invention is related to a kind of method that promotion potassium of plants absorbs, and the described method comprises the following steps：
1) nucleotide sequence of the present invention and/or pC2301M1DPB+NtHAK11 recombinant vectors are transformed into plant callus
Tissue, or the EHA105-pC2301M1DPB+NtHAK11 recombinant cells infection plant callus with the present invention；
2) the callus regeneration genetically modified plants are utilized.
Another aspect of the present invention relates to a kind of methods that reduction potassium absorbs, and the described method comprises the following steps：
1) sgRNA-Cas9+nthak11 of the present invention is edited into carrier and is transformed into plant callus, or with the present invention's
EHA105-sgRNA-Cas9+nthak11 recombinant cells infection plant callus；
2) the callus regeneration gene editing plant is utilized.
In the present invention, the plant is preferably dicotyledon, and the dicotyledon includes but not limited to tobacco, cotton
Flower, soybean, sweet potato, potato, particularly preferably tobacco, the tobacco include but not limited to the big gold dollar of safflower, Yun yan85, cloud
Cigarette 87, cloud and mist 97, cloud and mist 99, cloud and mist 110, cloud and mist 105, cloud and mist 116, cloud and mist 116, Yunyan202, cloud and mist 317, Zhongyan-100, in
Cigarette 101, middle cigarette 103, middle cigarette 104, middle cigarette 201, middle cigarette 203, middle cigarette 206, Bi Na 1, gold sea 1, your cigarette 1, your cigarette 2
Number, your cigarette 3, Guiyan 4, leek level ground 2, your cigarette 202, Henan cigarette 7, Henan cigarette 11, Henan cigarette 12, Henan cigarette 13, Qin's cigarette 1
Number, Qin's cigarette 96, Qin's cigarette 201, peace cigarette 2, peace cigarette 3, turquoise No.1, Fujian cigarette 12, Fujian cigarette 35, Fujian cigarette 38, golden Shennong No.1, kingfisher
Green No. 2, innovation 3, E'yan 1, Hubei Province cigarette 213, Hubei Province cigarette 215, Hunan cigarette 3, Hunan cigarette 4, Hunan cigarette 5, distant cigarette 19, Longjiang 925,
Longjiang 935, lucky cigarette 10, Guangdong cigarette 216, K326, KRK26, TN90LC, NC297, NC102, PVH1452, NC55, PVH09,
RGH51,TN86,NC89,NC 628,PVH2254.In one embodiment of the invention, the tobacco is NC89.
In one embodiment of the invention, inventor expands to obtain gene NtHAK11 from tobacco NC89, by the gene
It is recombined into the pC2301M1DPB carriers newly built and obtains the recombinant expression carrier containing the gene, convert Agrobacterium tumefaciems, profit
With recombinational agrobacterium transformation of tobacco blade, measured by the GUS dyeing, DNA identifications and potassium content of tobacco leaf, and be not transferred to
The tissue of NtHAK11 genes or plant comparison, it was demonstrated that NtHAK11 genes are related to potassium absorption and potassium of plants absorption can be promoted to contain
Amount.
In one embodiment of the invention, inventor expands from tobacco NC89 after obtaining gene NtHAK11, designs it
Target sequence is recombined into sgRNA-Cas9 carriers and obtains the expression vector containing the target sequence by target sequence nthak11, converts root
Cancer Agrobacterium, using recombinational agrobacterium transformation of tobacco blade, identified by tobacco leaf DNA and potassium content measure, and with do not compile
Tissue or the plant comparison for collecting NtHAK11 genes further prove that NtHAK11 genes are related to potassium absorption and can promote plant
Potassium absorbs content.
The potassium that NtHAK11 genes of the present invention can greatly improve genetically modified plants absorbs content, it was demonstrated that NtHAK11
Gene is to absorb relevant functional gene with control tobacco potassium, this is beneficial on a molecular scale deeper into the discussion function shape
At physiological Mechanism and mechanism, reach to the effect of the Reasonable Regulation And Control of yield and quality, the genetic breeding of tobacco generated great
Meaning.
Description of the drawings
Fig. 1 is that sgRNA-Cas9 edits carrier schematic diagram.
Fig. 2 is pC2301M1DPB carrier schematic diagrames.
Fig. 3 is the GUS coloration result figures of the tobacco leaf of inverted NtHAK11.
Fig. 4 is NtHAK11-OE transfer-gen plants and the potassium content in WT.
Fig. 5 is nthak11 gene editings strain and the potassium content figure in WT plant.
Specific implementation mode
The embodiment of the present invention is described below in detail, examples of the embodiments are shown in the accompanying drawings, wherein from beginning to end
Same or similar label indicates same or similar element or element with the same or similar functions.Below with reference to attached
The embodiment of figure description is exemplary, it is intended to for explaining the present invention, and is not considered as limiting the invention.Embodiment
In particular technique or condition person is not specified, according to technology or condition described in document in the art or according to the description of product
Book carries out.Reagents or instruments used without specified manufacturer, being can be with conventional products that are commercially available.
The structure of the PCR amplification and pEASY-T1+NtHAK11 recombinant vectors of embodiment 1NtHAK11 genes
Design of primers and synthesis：It separately designs gene-specific primer and carries out gene cloning in Nicotiana tabacum.The primer
By Chengdu, Qing Ke Zi Xi Bioisystech Co., Ltd synthesizes.Primer sequence (5'to 3') is as follows：
NtHAK11F CGGGATCCCGATGGCTTCAGCGTTAGGGATGG SEQ ID NO:3；
NtHAK11R CGAGCTCGTACATAGAAAATTTGTCCAACGTTCAAG SEQ ID NO:4。
Wherein, underscore is I restriction enzyme sites of BamH in NtHAK11F, and underscore is I restriction enzyme sites of Sac in NtHAK11R.
Primer is synthesized by Chengdu Qing Ke Zi Xi Bioisystech Co., Ltd.
Tobacco Total RNAs extraction：The extraction of tobacco plant total serum IgE is with reference to TIANGEN RNA Pure Plant Kit kits
It carries out.It is polluted to prevent RNase, mortar alcohol high-temperature calcination, cooled to room temperature is spare；Pipette tips used in experiment,
Centrifuge tube is RNase-Free imported materials；It needs often to replace gloves in experimentation, in case RNA degrades.
Concrete operation step is as follows：
1) Plant material Tobacco NC89, the normal robust growth in the emergence of the kind and growth course are to be grown to 3-8
When piece leaf, material of the root system of healthy and strong plant as experiment is taken.It pulverizes rapidly in liquid nitrogen last, to what is be ready for
50-100mg plant tissue powder is added in 1.5mLRNase-Free centrifuge tubes, performs label, sequentially adds 450 μ L cracking
Liquid RL, 4.5 μ L beta -mercaptoethanols, be vortexed acutely concussion mixing.
2) Filter column CS is placed in collecting pipe, then the solution after oscillation mixing is transferred on filtering CS, 12,000rpm
5min is centrifuged, is carefully drawn in the supernatant to the centrifuge tube of RNase-Free in collecting pipe, suction nozzle avoids touching in collecting pipe
Pellet cell debris.
3) the RNase-Free absolute ethyl alcohols (being usually 225 μ L) of 0.5 times of supernatant volume are slowly added to, mixing (at this time may be used
Can precipitate appearance), obtained solution and precipitation are transferred to together in adsorption column CR3,12,000rp centrifugation 1min outwell receipts
Waste liquid in collector puts back to adsorption column CR3 in collecting pipe.
4) 350 μ L protein liquid removals RW1 are added into adsorption column CR3,12,000rpm centrifuge 1min, outwell in collecting pipe
Waste liquid puts back to adsorption column CR3 in collecting pipe.
5) I working solutions of DNase are prepared：It draws 10 μ LDNase, I storing liquids and is put into new RNase-Free from pipe, be added
70 μ LRDD solution, soft mixing.
6) I working solutions of DNase of 80 μ L are added to the centers adsorption column CR3, are placed at room temperature for 15min.
7) 350 μ L protein liquid removals RW1 are added to the centers adsorption column CR3,12,000rpm centrifuge 1min, outwell in collecting pipe
Waste liquid, adsorption column CR3 is put back in collecting pipe.
8) 500 μ L rinsing liquids RW (needing first to be confirmed whether that absolute ethyl alcohol has been added before use), room are added into adsorption column CR3
Temperature stands 2min, and 12,000rpm centrifugation 1min outwell the waste liquid in collecting pipe, adsorption column CR3 is put back in collecting pipe.
9) step 8) is repeated.
10) 12,000rpm centrifuges 3min, outwells waste liquid.Adsorption column CR3 room temperatures are put into superclean bench to air-dry, with thorough
Dry rinsing liquid remaining in centrifugal column in bottom.
11) adsorption column CR3 is put into a new RNase-Free centrifuge tube, is vacantly dripped to the intermediate position of adsorbed film
Add 30 μ LRNase-Free ddH2O, is placed at room temperature for 5min, and 12,000rpm centrifugation 2min collect RNA, measures its concentration and pure
Degree, RNA sample preserve in -80 DEG C.
RNA concentration and quality testing：RNA concentration and purity are measured with NanoDrop2000c ultraviolet specrophotometers.With new
The Ago-Gel of fresh 1 × TAE configuration 1.0%, 120V electrophoresis 18min under low temperature, detects RNA integralities.
Reverse transcription synthesizes cDNA：Reverse transcription is with reference to TaKaRa reverse transcription reagent box (Prime reagent
Kit perfect RealTime) operating instruction in RNase-Free PCR pipes, sequentially adds following reagent on ice：
After brief centrifugation, reverse transcription is carried out in PCR instrument.Program is as follows：
37℃ 15min；
85℃ 5s；
16℃ 5min。
Product is preserved in -20 DEG C of refrigerators.
The PCR amplification of target gene：
1) PCR is loaded：Respectively use target gene specific primer NtHAK11F and NtHAK11R, to target gene into
Row PCR amplification, amplified reaction are carried out with reference to TaKaRa Transtar Taq Buffer specifications, sequentially add following reagent：
PCR programs：94 DEG C of pre-degeneration 5min；(94 DEG C of denaturation 30,69 DEG C of annealing 30s, 72 DEG C of extension 1min40s) × 32 are followed
Ring；72 DEG C of extension 10min, 4 DEG C of preservations.After reaction, 3 μ LPCR products are taken, electrophoresis is carried out in 1.0% Ago-Gel
Detection.
The recycling of target gene：Target fragment recycling is with reference to TaKaRa Mini BEST AgaroseGeL DNA
Extraction Kit operating instructions carry out, and are as follows：
1) developing solution is added with the PCR product for running out of target stripe, agarose electrophoresis 15min is cut rapidly under ultraviolet light
Target DNA band is taken, is fitted into 2mL sterile centrifugation tubes.
2) 200 μ LBuffer Gm are added, melt in 42 DEG C.
3) Buffer WB700 μ L are added in centrifugal column, 12000rpm centrifuges 1min, is repeated 2 times.
4) liquid is outwelled, 12000rpm skies are from 3min.
5) lid opening is put and blows 5min in superclean bench, it is ensured that evaporated clean.
6) centrifugal column is placed in new centrifuge tube, the water that 30 μ L55 DEG C are preheated in advance, 12000rpm, centrifugation is added
1min, eluted dna.The DNA eluted is in -20 DEG C of preservations.
The connection and conversion of target gene
The target gene fragment being recovered to is connect with pEASY-T1Simple Cloning Vector carriers respectively, is deposited
In the sterile centrifugation tube of 2mL, linked system is as follows：
The 3.5 μ L of DNA of recycling；
pEASY-T1Simple 0.5μL。
It is placed on ice, connects 10h overnight.
The specific steps of conversion：
1) plus connection product in 50 μ LTrans1-T1 competent cells (melt on ice, just thaw when be added) flick it is mixed
It is even, ice bath 30min.
2) after 42 DEG C of heat shock 60s, it is immediately placed on 2min on ice.
3) 500 μ L are added to balance to the LB of room temperature (formula is shown in Table 2), in 37 DEG C of shaking table, 220rpm shaken cultivations, hatching
1h。
4) by the bacterium solution after hatching, being uniformly coated onto LB solid medium of the addition containing kalamycin resistance, (formula is shown in Table
2) it on, is inverted light culture for 37 DEG C and stays overnight.
The PCR of recombinant plasmid is identified
Bacterium solution PCR identifies recombinant plasmid：
1) Kana (formula is shown in Table 1) of 6 μ L of absorption, 600 μ L LB liquid mediums (formula is shown in Table 2) are in the sterilizing of 2.0mL
In centrifuge tube.
2) the white single bacterium colony after being incubated overnight with pipette tips picking is inoculated in LB solution (formula is shown in Table 2), in shaking table 37
DEG C, 220rpm shaken cultivation 4-6h, until bacterium solution is muddy.Using M13F, M13R primer, using bacterium solution as template, pass through bacterium solution PCR
Positive identification is carried out to recombinant clone respectively, sample-adding system is as follows：
3) PCR programs：95 DEG C of pre-degeneration 5min；(95 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 2min) × 35 is followed
Ring；72 DEG C of 10min, 4 DEG C of preservations.After reaction, 3 μ LPCR products are taken, are detected in 1.0% agarose gel electrophoresis.Picking sun
Property clone.
Carry plasmid procedure and sequencing
1) bacterium solution is gone in 1.5mL centrifuge tubes, 12000rpm room temperatures centrifuge 30s, and reject supernatant repeats 3-4 times；
2) 250 μ L Solution I (RNaseA is first added using preceding) are added into thalline, vortex oscillation keeps it fully mixed
It is even；
3) 250 μ L Solution II are added, turn upside down mixing, is placed at room temperature for 4min and becomes limpid to liquid；
4) 350 μ L Solution III are added, turn upside down mixing, has white flock precipitate appearance at this time, is placed at room temperature for
2min, 14000rpm room temperature centrifuge 10min；
5) supernatant is added in adsorption column and (is sure not to encounter white precipitate, avoid that protein contamination occurs), the rooms 12000rpm
Temperature centrifugation 1min, outwells waste liquid, adsorption column is put into collecting pipe；
6) 500 μ L HBC Buffer are added into adsorption column, are placed at room temperature for 12000rpm centrifugations 1min after 1min；
7) 700 μ L Wash Buffer (absolute ethyl alcohol is first added using preceding), 12000rpm centrifugations are added into adsorption column
1min outwells liquid, and adsorption column is put into collecting pipe；
8) repetitive operation step 7)；
9) blank pipe 12000rpm centrifuges 2min, and the adsorption column for being placed on new centrifuge tube is uncapped placement in 37 DEG C of baking ovens
10min, thoroughly to dry remaining rinsing liquid in adsorption column；
10) 100 μ L Elution Buffer are added dropwise to adsorbed film center is hanging, 5min are placed in 37 DEG C of baking ovens,
12000rpm centrifuges 2min, and what centrifuge tube was collected into is plasmid DNA solution；
11) it is correctly pEASY-T1+NtHAK11 recombinations to send the plasmid of above-mentioned acquisition to Hua Da gene sequencing, sequencing
Carrier.
The structure of embodiment 2pC2301M1DPB+NtHAK11 recombinant vectors
Target gene NtHAK11 is built into pC2301M1DPB carriers (see Fig. 2).
Target gene digestion system is：
Target fragment in digestion carrier T：Digestion system is as follows：
Carrier digestion system is：
Target fragment and carrier recovery：Specific steps are same as above.
The connection of target fragment and carrier：
37 DEG C, 2h connections.
Connection product converts Escherichia coli：Specific steps are same as above.
Bacterium solution PCR identifications：Specific steps are same as above, identification primer using clone be use primer (i.e. NtHAK11F with
NtHAK11R)。
Carry plasmid procedure and sequencing：Specific steps are same as above.
Embodiment 3 recombinates the preparation of Agrobacterium tumefaciems EHA105-pC2301M1DPB+NtHAK11 cells
Expression vector converts Agrobacterium
1) Plasmid DNA (the 2 gained pC2301M1DPB+ of embodiment of 10 μ L is added into Agrobacterium EH105 competent cells
The Plasmid DNA of NtHAK11 recombinant vectors) gently mixing；
2) competent cell is placed in liquid nitrogen freezes 8min later by ice bath 30min, then is immediately placed in 37 DEG C of water-bath water
5min is bathed, later ice bath 2min again；
3) on superclean bench, the 850 μ L of YEB fluid nutrient mediums of antibiotic-free are added, turn upside down mixing, in
28 DEG C of culture 4h on 225rpm shaking tables；
4) after cultivating 4h, 4000rpm centrifuges 5min, removes 800 μ L supernatants, and mixing is blown and beaten with sterile pipette tips；
5) remaining suspension liquid is coated on to the YEB solid cultures containing Kana (formula is shown in Table 1) and rif (formula is shown in Table 1)
On base tablet, until surface will be applied to drying；
6) tablet coated is placed in 37 DEG C of baking oven culture 2d；
7) picking monoclonal carries out PCR detections on tablet.
Bacterium solution PCR identifications：Specific steps are same as above, and identify that primer is NtHAK11F and NtHAK11R.
The genetic transformation of 4 tobacco of embodiment
Cultivate aseptic seedling
1) the NC89 seeds of main points are placed in 4 DEG C of vernalization.
2) take 800 μ L70% ethanol wash primary, static 2min.
3) it takes 800 μ LddH2O to wash twice, vibrates.
4) 800 μ LNaClO are taken to washed once, color fades to yellow by dark brown.
5) 800 μ LddH2O are taken to wash 3-5 times, oscillation.
6) washed seed is poured on filter paper, dipping 1-2 seed points with the tweezers of sterilizing is coated in prepared 1/2MS
On culture medium, 5 every bottle or so.
7) bottle is marked, is put into culturing room, first carry out light culture 48h, then carry out illumination cultivation to emerge after 4 days.
Agrobacterium is infected
1) by sterile wild-type tobacco NC89 blades be cut into 1cm × 1cm squares leaf dish (preferably it is current now cut, cut off leaf
Piece edge and master pulse surrounding form wound)；
2) 600-700 μ L bacterium solutions is taken to be added in the YEB liquid (formula is shown in Table 2) of 50mL antibiotic-frees, 28 DEG C, 225rpm shakes
Bed shaken cultivation 4h to OD600 values be about 0.6~0.8,4 DEG C, 4000rpm centrifuge 10min, outwell supernatant, thalline existed
MS fluid nutrient mediums ice-cold 20mL suspend, spare；
3) the square leaf dish sheared in advance is moved in aseptic bottle, suspension is added and infects 5min；
4) leaf dish is moved on aseptic filter paper and blot excess surface bacterium solution, then move to differential medium (formula is shown in Table 2)
Middle light culture 2d；
5) after 2d, the leaf dish after infecting is moved in tobacco screening and culturing medium and is cultivated, replace primary culture every 14d later
Base.
6) adventitious bud that will be survived in screening and culturing medium (formula is shown in Table 2), cutting insertion root media, (formula is shown in Table
2) it takes root in.
7) waiting for that root system is grown to 1-2cm can be transplanted in soil, obtain the plant of antiweed PPT.
8) Transgenic Tobacco plant screening and identification.
GUS dyes primary election
The GUS coloration results of the tobacco leaf of inverted NtHAK11 (see Fig. 3).Wherein, of the present invention by carrying
The tobacco leaf of the recombination Agrobacterium tumefaciems EHA105-pC2301M1DPB+NtHAK11 conversions of NtHAK11 genes (see the left sides Fig. 3)
Blue is presented after GUS is dyed；Without the recombination Agrobacterium tumefaciems EHA105-pC2301M1DPB of NtHAK11 genes of the present invention
Color does not change the tobacco leaf (see the right sides Fig. 3) of+NtHAK11 plasmids after GUS is dyed.
Utilize the forward primer before promoter on carrier+target fragment reverse primer, target fragment forward primer+Nos
Two pairs of primer PCRs are detected after terminator.(Huada gene company synthesis).
Primers F 35S3N in promoter：GGAAGTTCATTTCATTTGGAGAG SEQ ID NO:5；
Primer RNOS5N under terminator：TGCCAAATGTTTGAACGATCGGG SEQ ID NO:6.
The transfer-gen plant identified and WT lines are subjected to potassium content measurement respectively and compare its result (see figure
4).Grown under identical conditions with wild type by being overexpressed the transfer-gen plant that NtHAK11 technologies generate, the potassium of blade from
Sub- content, as can be seen from Figure 4 be overexpressed NtHAK11 genes generate strain NtHAK11-OE-1, NtHAK11-OE-2,
The blade potassium content of NtHAK11-OE-3, NtHAK11-OE-4, NtHAK11-OE-5, NtHAK11-OE-6, NtHAK11-OE-7
It is significantly improved than wild type pole, it was demonstrated that NtHAK11 genes can promote plant potassium to absorb.
The assembling of the target position point design and sgRNA carriers of embodiment 5NtHAK11 genes
1) the target position point design of NtHAK11 genes：Identify that sequence (being free of PAM sequences) ends 5' are added for knowing in sgRNA
Other restriction enzyme site joint sequence (sense primer 5 ' end add 5 '-GATT-3 ' connectors, 3 ' end add 5 '-GGG-3 ' connectors,
The end of downstream primer 5 ' adds 5 '-CAAA-3 ' connectors), synthetic primer (primer is by Hua Da gene chemical synthesis):
NtHAK11 target sequences F：GATTATTAGGCAAAGTACTAACACGGG SEQ ID NO:7；
NtHAK11 target sequences R：AAAC-GAGTTAGTACTTTGCCTAAT SEQ ID NO:8.
Assemble target site sgRNA：
1) sgRNA carriers digestion:By artificial synthesized sgRNA skeleton plasmids, sequence such as SEQ ID NO:Shown in 9：
It is BamHI restriction enzyme site sequences that wherein underscore, which is wave part, and lower stroke of dotted line is U3 promoter sequences, lower stroke
Single line is BbsI restriction enzyme site sequences, and lower stroke of two-wire is sgRNA sequences.Shanghai Xu Guan biotechnologies company synthesizes.
Digestion is carried out by following digestion system：
SgRNA carrier digestions:The sgRNA skeleton plasmids of synthesis are subjected to digestion by following digestion system：
2) after mixing, 37 DEG C of digestions 2 hours or more are detected into row agarose gel electrophoresis, are cut in the UV lamp later
Purpose band.
Purpose sgRNA segments recycle：Specific steps are same as above
The denaturation of target site primer, renaturation:
Wherein sense primer is NtHAK11 target sequences F；Downstream primer is NtHAK11 target sequences R.
After slight mixing, 95 DEG C of denaturation 5min, the 1h or more of room temperature denaturation later.Denatured products are pressed 1:25 ratios carry out dilute
It releases spare.
SgRNA skeleton carriers are connect with target site segment：
After slight mixing, 4 DEG C of connections are overnight.
Connection product converts Escherichia coli：Specific steps are same as above.
Positive clone identification：Using the monoclonal of picking on tablet as PCR amplification template, (drawn upstream with sgRNA vector primers
Object F), target site primer (NtHAK11 target sequence R) and target site primer (downstream primer R), target site primer (NtHAK11 target sequences
Arrange F) screening positive clone, carry out PCR amplification with Taq archaeal dna polymerases.(primer is synthesized by Huada gene company).
SgRNA vector primer upstream primer sequences F：GAATCTCGATCCGTAGAAACG SEQ ID NO:10；
SgRNA vector primer upstream primer sequences R：AGGTCTTCTGTGTAACGAAGAC SEQ ID NO:11.
1) PCR amplification system：
2) PCR reaction conditions：95℃for 5min；(95℃for 30s；55℃for 30s；72 DEG C of for 1Kb/min),
25-30 is recycled, 72 DEG C of for 10min；16 DEG C of preservations.1% agarose gel electrophoresis detection is carried out after PCR amplification.According to
By the positive colony of acquisition, picking is put into Amp (formula is shown in Table 1), LB liquid medium (formula is shown in Table 2) stripe size again,
37 DEG C of culture 16h on 225rpm shaking tables.
3) bacterium solution preservation and plasmid extraction：On superclean bench, it will shake to muddy bacterium solution and draw 850 μ L in 1.4mL
In centrifuge tube, the glycerine mixing of 150 μ L is added, is stored in -80 DEG C of refrigerators.
Extraction of plasmid DNA specific steps are same as above.
SgRNA insertion pCACas9 skeleton carriers obtain sgRNA-Cas9 and edit carrier (see Fig. 2)：：By containing for above-mentioned acquisition
Have the sgRNA of target site according to its both ends restriction enzyme site being assembled on pCACas9 skeleton carriers gradually.Digestion pCACas9 knots
Shu Houxu carries out dephosphorylation process, and recycling target fragment is attached, then connection product is converted bacillus coli DH 5 alpha, later
Positive monoclonal is detected, bacterium, extraction plasmid are shaken to it.
Plasmid converts Agrobacterium：In specific steps.
CRISPR/Cas9 pinpoints editor's system transformation of tobacco：Specific steps are same as above.
Gene editing strain is screened and detection：
1) CTAB methods extraction tobacco gene group DNA
2) beta -mercaptoethanol (content 2%) into 2%CTAB extracting solutions, is placed in 65 DEG C of thermostat water bath and preheats
10min or more.
3) take 100mg plant leafs in 1.5mL centrifuge tubes, be added the rapid grind into powder of liquid nitrogen grinding rod, to from
The CTAB extracting solutions of the preheating of 700 μ L are added in heart pipe, shake up.
Water-bath cracks 45-60min in 65 DEG C of thermostat water baths, preferably jiggles centrifuge tube up and down per 10min primary.
4) chloroform of isometric (700 μ L) is added in ice bath 10min after cracking：Isoamyl alcohol (24:1) gently turn upside down 2-
3min, 12 000rpm room temperatures centrifuge 10min, the supernatant of layering are moved in new centrifuge tube.
5) isometric chloroform is added again：Isoamyl alcohol (24:1) it repeats to extract once, turn upside down mixing, and 12
000rpm room temperatures centrifuge 10min.
6) by supernatant to new centrifuge tube, and the isopropanol (being stored in -20 DEG C of refrigerators) of 2/3 volume is added, up and down
Gently mixing, is placed in -20 DEG C of refrigerator 30min or more, and 12 000rpm room temperatures centrifuge 10min.
7) white precipitate is DNA, and 600 μ L, 75% ethyl alcohol is added into precipitation and gently overturns makes DNA suspend, and places
20min, then with the rinsing of 75% ethyl alcohol it is primary after, then with absolute ethyl alcohol be dehydrated 2min.
8) remove absolute ethyl alcohol, vacuum drying 12-15min is added until DNA is completely dried and (otherwise influences DNA dissolvings)
30-40 μ LddH2O dissolvings, it is spare to be stored in -20 DEG C of refrigerators.
Gene editing strain is screened：
1) PCR amplification template is made with transfer-gen plant DNA, in target site upstream and downstream design primer, with Taq archaeal dna polymerases
Carry out PCR amplification.
Sense primer F：GAAGCCAGGCCATCATCACT SEQ ID NO:12；
Downstream primer R：ACGTGAAACTTAATCAGGCTTTT SEQ ID NO:13.
2) PCR amplification system：
3) PCR reaction conditions：95℃for 5min；(95℃for 30s；55℃for 30s；72 DEG C of for 1Kb/min),
25-30 is recycled, 72 DEG C of for 10min；16 DEG C of preservations.PCR product direct Sequencing and wild-type sequence are compared, with true
Whether targeting gene mutates, and computational efficiency.
The measurement of mutation type：
1) it determines the plant to mutate, target fragment is expanded with high fidelity enzyme.
2) high fidelity enzyme PCR amplification system：
3) high fidelity enzyme PCR reaction conditions：95℃for 5min；(95℃for 30s；55℃for 30s；72℃for
1Kb/min), 25-30 is recycled, 72 DEG C of for 10min；16 DEG C of preservations.
The measurement of mutation type
1) PCR product that above-mentioned determining target gene mutates carry out after glue recycling with pEASY-T1Cloning
Vector carriers connect, and are stored in the sterile centrifugation tube of 2mL, linked system is as follows：
The 4 μ L of PCR product of recycling；
pEASY-T1Cloning Vector 1μL；
It is gently mixed, (20 DEG C -37 DEG C) reaction 5min of room temperature.After reaction, centrifuge tube is placed on ice
2) specific steps converted：
1. (adding when competent cell just thaws in 50 μ LTrans1-T1 competent cells in addition stating connection product
Enter connection product) flick mixing, ice bath 20-30min.
2. 42 DEG C of water-bath heat shock 30s, are immediately placed on 2min on ice.
3. 250 μ L are added to balance to the LB liquid medium of room temperature (formula is shown in Table 2), vibrated in 37 DEG C of shaking table, 220rpm
Cultivate 1h.
4. taking 8 μ L 500mM IPTG and 40 μ L 50mg/ml X-gal mixing, uniformly it is coated in containing Amp (formula is shown in Table 1)
LB solid mediums (formula is shown in Table 2) on, place 30min in 37 DEG C of incubators.
5. after IPTG and X-gal is absorbed, 200 μ L bacterium solutions is taken uniformly to be coated onto above-mentioned LB solid mediums (formula
It is shown in Table on 2), is inverted light culture for 37 DEG C and stays overnight.
It is blue hickie screening in place of difference；Hickie rather than locus coeruleus are selected when differentiating positive colony.By positive colony into
Row sequencing, every single plant need to survey no less than 5 monoclonals.Using DNAMAN softwares to the sequence and target base of all sequencing acquisitions
The reference sequences of cause are compared, and count target gene base mutation type and efficiency.
Editor plant is subjected to potassium content measurement with WT lines respectively and compares its result (see Fig. 5).Fig. 5 is to pass through
The editor plant that CRISPR-Cas9 technical editors generate grows with wild type under identical conditions, the potassium content of blade,
As can be seen from Figure 5 gene editing strain ntHAK11-1, ntHAK11-3, ntHAK11-7 are extremely more aobvious than the potassium content of wild type
Writing reduces, and ntHAK11-4 is significantly reduced than the potassium content of wild type, it was demonstrated that will reduce plant pair after NtHAK11 gene editings
The absorption of potassium ion.
Related culture medium prescription used in the embodiment of the present invention is described as follows：
Refer to the sterilizing of following condition below in connection with so-called " conventional sterilant " in culture medium：Steam sterilization at 121 DEG C
20min。
The preparation of antibiotic and biochemical reagents storage liquid：Common antibiotics and biochemical reagents store using solvent, storing for liquid
Concentration, working concentration or volume is deposited to see the table below.Configuration step：It weighs solid medicine to be dissolved in a small amount of solvent, rear constant volume to be dissolved,
It dispenses again and is stored in -20 DEG C.(wherein using water as the 0.22 μM of membrane filtration degerming of the need of solvent then dispense again)
1 antibiotic of table is with tabulation
2 culture medium of table is with tabulation
3 major experimental reagent of table and kit
Although the embodiments of the present invention has been shown and described above, it is to be understood that above-described embodiment is example
Property, it is not considered as limiting the invention, those skilled in the art are not departing from the principle of the present invention and objective
In the case of can make changes, modifications, alterations, and variations to the above described embodiments within the scope of the invention.
SEQUENCE LISTING
<110>Southwestern University
<120>NtHAK11 genes and application thereof
<130>P Southwestern Universities -0003
<160> 13
<170> PatentIn version 3.5
<210> 1
<211> 1561
<212> DNA
<213>Tobacco NC89
<400> 1
tccctgcata ttctcctaag aaacgcatat atatagtcaa tagcaatttt cttatagaac 60
ctagagtctc tccttgctct aactacagtg tttccaagaa tgtgtacaac cccagcatct 120
cgacaacgat ttaagaattc catttcgtcc acttctgcct ggctgctctc acggcccaac 180
gatgatgtga ctgtattgct tccttgagtg ggagatttca caggtactat tgattccacc 240
gtcgaacatg taaagtcatt atttcctgta gttgccaatt tgactttgat ttctgaatcc 300
agcagtgaca ccgatgcaaa gaatcataag tatccaattt atatcaggaa tataaatctg 360
cccaaggaac ttctttgacg tatgtacaac cttaactctt ggaaaacagc ctagtgccag 420
agcttgcttg attattgaaa atgtagcaga aatggttgct tgacttgcaa cgatagcagc 480
taaagttgca atgacaaaaa ctggccagta tatgctttct ggaatagaac ggtagaatgc 540
atcgacaaca tgttccttat tttgcatgag gtatgctgct tgccccgtat aggttaaaag 600
agggcatggg aaaacaatga ctgtgaaagc aagctgtatt gctgacactg gaaaatgagc 660
aagatcagca aaaagtgcct ctgtccctgt aatgctgagc attattcctc ccagagatgt 720
ccaaccctct ttctttctcc tcctaaaata cctatatatg tacacaggag aaaaagccct 780
caaaacagag ctatcgtact tccagatgtt gaagatgccg atacctccta ctaatagaaa 840
ccaaagcagc acaatgggag caaacagcca accaaccctg tctgtgccat agtgttgtaa 900
gctaaacaga ccaaccaata taatgactgc aacaaccacc actacgtcat tactcatctt 960
tggatgatcc accttgatcc cgccagtagc tgaaagagct gatatagccg gagtgagaat 1020
tccatcacct attaccgtgc aagtgccaac aattacaata ataagaagtg cattcttcct 1080
gaatgaatat gcctccaacc atcgttttgt ttttgcagca aatgaatgct catggaatgt 1140
gctacggcta taagttgtca gctcctcatc tgtccgatgt tggttgggaa ttgtctttat 1200
cttagcatgg cgacatagta aagaataaag agcaaaagtc ccgccttggc cattgtcatt 1260
cgctctacaa acaataaaaa catacttgag gagagggata agtgtgaggg aatatataat 1320
taatgaaagg gcgccaatga catcctctgt atcatcaatt ccatggggaa atgtattgta 1380
gaacacatac aaaggagaag ttcccaagtc tccataaacc acacctagac tctgaaaagc 1440
aagccgcaga agcaacaatg ccgagaattt cttttctcta tacatatttt tgagtctacc 1500
agcctcctca cccataggct gatcaatctt ttggtctaat tcccacatcc ctcctttagt 1560
t 1561
<210> 2
<211> 23
<212> DNA
<213>It is artificial synthesized
<400> 2
attaggcaaa gtactaacac ggg 23
<210> 3
<211> 32
<212> DNA
<213>It is artificial synthesized
<400> 3
cgggatcccg atggcttcag cgttagggat gg 32
<210> 4
<211> 36
<212> DNA
<213>It is artificial synthesized
<400> 4
cgagctcgta catagaaaat ttgtccaacg ttcaag 36
<210> 5
<211> 23
<212> DNA
<213>It is artificial synthesized
<400> 5
ggaagttcat ttcatttgga gag 23
<210> 6
<211> 23
<212> DNA
<213>It is artificial synthesized
<400> 6
tgccaaatgt ttgaacgatc ggg 23
<210> 7
<211> 27
<212> DNA
<213>It is artificial synthesized
<400> 7
gattattagg caaagtacta acacggg 27
<210> 8
<211> 24
<212> DNA
<213>It is artificial synthesized
<400> 8
aaacgagtta gtactttgcc taat 24
<210> 9
<211> 460
<212> DNA
<213>It is artificial synthesized
<400> 9
ggatccccgt gggagaaatc tcaaaattcc ggcagaacaa ttttgaatct cgatccgtag 60
aaacgagacg gtcattgttt tagttccacc acgattatat ttgaaattta cgctgagtgt 120
gagtgagact tgcataagaa aataaaatct ttagttggga aaaaattcaa taatataaat 180
gggcttgaga aggaagcgag ggataggcct ttttctaaaa taggcccatt taagctatta 240
acaatcttca aaagtaccac atcgcttagg taaagaaagc agctgagttt atatatggtt 300
agagacgaag tagtgattgg gtcttcgtta cacagaagac ctgttttaga gctagaaata 360
gcaagttaaa ataaggctag tccgttatca acttgaaaaa gtggcaccga gtcggtgctt 420
tttttgtccc ttcgaagggc ctttctcaca tcacggatcc 460
<210> 10
<211> 21
<212> DNA
<213>It is artificial synthesized
<400> 10
gaatctcgat ccgtagaaac g 21
<210> 11
<211> 22
<212> DNA
<213>It is artificial synthesized
<400> 11
aggtcttctg tgtaacgaag ac 22
<210> 12
<211> 20
<212> DNA
<213>It is artificial synthesized
<400> 12
gaagccaggc catcatcact 20
<210> 13
<211> 23
<212> DNA
<213>It is artificial synthesized
<400> 13
acgtgaaact taatcaggct ttt 23
Claims (11)
1. a kind of having the nucleotide sequence for promoting potassium of plants absorption function, the nucleotide sequence such as SEQ ID NO：Shown in 1
Or the nucleotide sequence to be complementary to.
2. a kind of carrier, which is characterized in that the carrier contains nucleotide sequence described in claim 1；Preferably, the load
Body is pC2301M1DPB+NtHAK11 recombinant vectors, and NtHAK11 is nucleotide sequence described in claim 1.
3. a kind of carrier, which is characterized in that the carrier contains the target sequence of nucleotide sequence described in claim 1, or contains
The target sequence of the complementary series for the nucleotide sequence having the right described in requirement 1；The target sequence is referred to SEQ ID NO：1
Shown nucleotide sequence carries out the nucleotide sequence of specific recognition, or can be to SEQ ID NO：1 complementary nucleotide sequence
The nucleotide sequence for carrying out specific recognition, such as SEQ ID NO：2；Preferably, the carrier is sgRNA-Cas9+nthak11,
Wherein nthak11 is the target sequence.
4. a kind of recombinant cell containing carrier described in claim 2；Preferably, the recombinant cell is recombinational agrobacterium
EHA105-pC2301M1DPB+NtHAK11。
5. a kind of recombinant cell containing carrier described in claim 3；Preferably, the recombinant cell is recombinational agrobacterium
EHA105-sgRNA-Cas9+nthak11。
6. the recombinant cell of the carrier and/or claim 4 of nucleotide sequence as claimed in claim 1 and/or claim 2 is used for
The purposes for promoting potassium of plants to absorb；Preferably, the plant is tobacco；It is furthermore preferred that the tobacco is NC89.
7. the purposes that the carrier of claim 3 and/or the recombinant cell of claim 5 absorb for reducing potassium of plants；Preferably,
The plant is tobacco；It is furthermore preferred that the tobacco is NC89.
8. the recombinant cell of the nucleotide sequence of claim 1 and/or the carrier of Claims 2 or 3 and/or claim 4 or 5
It is used to prepare genetically modified plants or the purposes for plant breeding；Preferably, the plant is tobacco；It is furthermore preferred that the cigarette
Grass is NC89.
9. conversion has the right the nucleotide sequence of requirement 1 and/or the carrier of Claims 2 or 3 and/or to want infected with containing having the right
The callus of 4 or 5 recombinant cell is asked to be used to prepare genetically modified plants or the purposes for plant breeding；Preferably, described
Plant is tobacco；It is furthermore preferred that the tobacco is NC89.
10. it is a kind of promotion or reduction potassium of plants absorb method, the method includes by the nucleotide sequence of claim 1 and/
Or the carrier of claim 2 is transformed into plant, or the recombinant cell infection plant with claim 4；Or by the load of claim 3
Body is transformed into plant, or the recombinant cell infection plant with claim 5；
Preferably, the plant is tobacco；It is furthermore preferred that the tobacco is NC89.
11. a kind of method for preparing promotion or reducing the genetically modified plants that potassium absorbs, the described method comprises the following steps：
1) carrier of the nucleotide sequence of claim 1 and/or claim 2 is transformed into plant callus, or uses right
It is required that 4 recombinant cell infection plant callus；Or the carrier of claim 3 is transformed into plant callus, or with power
Profit requires 5 recombinant cell infection plant callus；
2) the callus regeneration genetically modified plants are utilized；Preferably, the plant is tobacco；It is furthermore preferred that the tobacco
It is NC89.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810508861.9A CN108715853A (en) | 2018-05-24 | 2018-05-24 | NtHAK11 genes and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810508861.9A CN108715853A (en) | 2018-05-24 | 2018-05-24 | NtHAK11 genes and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108715853A true CN108715853A (en) | 2018-10-30 |
Family
ID=63900178
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810508861.9A Pending CN108715853A (en) | 2018-05-24 | 2018-05-24 | NtHAK11 genes and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108715853A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113897449A (en) * | 2021-04-28 | 2022-01-07 | 广西壮族自治区农业科学院 | Primer group and kit capable of accurately detecting expression quantity of sugarcane Sc HAK11 gene |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104419709A (en) * | 2013-09-04 | 2015-03-18 | 四川农业大学 | Potassium transporter gene in tobacco as well as encoding protein and application thereof |
-
2018
- 2018-05-24 CN CN201810508861.9A patent/CN108715853A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104419709A (en) * | 2013-09-04 | 2015-03-18 | 四川农业大学 | Potassium transporter gene in tobacco as well as encoding protein and application thereof |
Non-Patent Citations (8)
| Title |
|---|
| LU LM等: "Different tobacco cultivation regions lead to variations in tobacco leaf gene expression profiles involved in carbonhydrate metabolism and ion transportation", 《PLANT OMICS》 * |
| LU LM等: "Transcriptome analysis reveals dynamic changes in the gene expression of tobacco seedlings under low potassium stress", 《JOURNAL OF GENETICS》 * |
| 佚名: "登录号：NM_001349001.1", 《GENBANK》 * |
| 佚名: "登录号：XM_016582958.1", 《GENBANK》 * |
| 佚名: "登录号：XM_016647634.1", 《GENBANK》 * |
| 佚名: "登录号：XM_019410032.1", 《GENBANK》 * |
| 宋毓峰: "林烟草钾转运体基因NsHAK11的克隆与功能分析", 《中国优秀硕士学位论文全文数据库 基础科学辑》 * |
| 秦利军等: "超量表达烟草高亲和钾离子转运体蛋白基因(NtHAK1)提高烟草盐胁迫能力", 《农业生物技术学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113897449A (en) * | 2021-04-28 | 2022-01-07 | 广西壮族自治区农业科学院 | Primer group and kit capable of accurately detecting expression quantity of sugarcane Sc HAK11 gene |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104152475B (en) | Tobacco ε-lycopene cyclase gene and its application | |
| CN111593058B (en) | Bna-miR169n gene and application thereof in controlling drought resistance of brassica napus | |
| KR20210039306A (en) | Gene editing method using transgenic plants expressing CRISPR/Cas9 and gRNA, respectively | |
| CN110713529A (en) | Application of VvDUF642 gene in causing abortion of plant seeds | |
| CN107012147A (en) | A kind of arid and/or high salt evoked promoter SlWRKY8P and its application from tomato | |
| Rustgi et al. | Use of microspore-derived calli as explants for biolistic transformation of common wheat | |
| CN108676802A (en) | NtHAK5 genes and application thereof | |
| CN110628789B (en) | Breeding method of insect-resistant low-phenol cotton variety | |
| CN108715853A (en) | NtHAK11 genes and application thereof | |
| CN106591324A (en) | Millet siasr4 gene and application | |
| CN109355297A (en) | Dendrobium candidum DcWOX4 gene and its application in raising axis tiller | |
| CN108707613A (en) | NtHAK8 genes and application thereof | |
| CN107338231A (en) | The application of OsMPK21-1 albumen and its encoding gene in plant drought resistance is regulated and controled | |
| CA3089886A1 (en) | Compositions and methods for improving crop yields through trait stacking | |
| CN110734917B (en) | Lycoris longituba LlDFRc gene, protein expressed by same and application of gene | |
| CN110760530B (en) | Lycoris longituba LlDFRa gene, protein expressed by same and application of gene | |
| CN113832180A (en) | CRISPR/Cas13 b-mediated cotton RNA transcription regulation and control method | |
| CN101831429B (en) | Promoter and expression mode identification of rice endosperm specific expression gene | |
| CN111621503A (en) | Barley transcription factor HvWRKY70 gene and application thereof in stripe rust and powdery mildew resistance of wheat | |
| CN110747179A (en) | Lycoris longituba LlDFRb gene and protein expressed by same and application of gene | |
| CN110904106A (en) | Application of cymbidium goeringii miR159b in enhancing plant cold sensitivity | |
| CN104293808A (en) | Liriodendron hybrids LhMKK2 gene and expression protein and application thereof | |
| CN103451193B (en) | Populus deltoidesx populus nigra PdHSP70 gene and application thereof | |
| CN108588069A (en) | The precursor-gene of mulberry tree miR171a and its application in enhancing plant salt endurance | |
| CN113337516B (en) | Osmanthus fragrans rapid dedifferentiation related ofbZIP gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20181030 |
|
| WD01 | Invention patent application deemed withdrawn after publication |