CN112195189A - Barley transcription factor HvWRKY6 gene and application thereof in wheat stripe rust and leaf rust resistance - Google Patents

Abstract

The invention provides a barley transcription factor HvWRKY6 gene and application thereof in wheat stripe rust and leaf rust resistance. The invention relates to a gene sequence, and particularly discloses a barley transcription factor HvWRKY6, a nucleotide sequence of which is shown in SEQ ID No.1, and a preparation process of a wheat transgenic material for over-expressing HvWRKY 6. Experiments prove that the HvWRKY6 gene can obviously improve the resistance level of wheat to wheat stripe rust and wheat leaf rust.

Description

Barley transcription factor HvWRKY6 gene and application thereof in wheat stripe rust and leaf rust resistance

Technical Field

The invention belongs to the technical field of biological gene engineering, and relates to a barley transcription factor HvWRKY6 gene and application thereof in wheat stripe rust and leaf rust resistance.

Background

Wheat (Triticum aestivum) is one of the most important grain crops in the world, the quality and the yield of the wheat seriously influence the grain safety and the social stability of China, and the high yield and the stable yield of the wheat have important significance for the agricultural development of China. Wheat stripe rust and wheat leaf rust caused by Puccinia striiformis f.sp.tritici and wheat leaf rust (Puccinia triticina, Pt) respectively are important leaf fungal diseases which seriously affect wheat production in China. The occurrence and harm of wheat stripe rust and wheat leaf rust have the characteristics of long-term property, outbreak property, popularity, variability and the like, the pathogenic bacteria can be remotely transmitted along with high air flow, the effective prevention and control of the pathogenic bacteria are international problems, and the wide attention of relevant countries and international organizations in the world is caused. The disease has a wide distribution range, is distributed in five continents, and is one of countries with the largest area of wheat stripe rust and wheat leaf rust and the most serious damage loss in China all over the world. The history of occurrence, prevalence and prevention and control of the stripe rust and the leaf rust of the wheat in China is taken throughout, which indicates that the stripe rust is frequently in danger in the production of the wheat in China. Therefore, it is necessary to develop a broad spectrum of disease resistance genes.

WRKY transcription factors widely exist in higher plants, the core sequence of the transcription factors consists of 60 amino acid residues, the most conserved sequence is WRKYGQK, and the name of WRKY is also obtained from the most conserved sequence. Research shows that the WRKY transcription factor plays an important role in regulation and control in the process of plant disease-resistant defense reaction. WRKY6 was involved in many growth and development and stress response processes, WRKY6 was first reported to be involved in plant pathogen defense and senescence processes, and WRKY6 expression was significantly elevated during senescence leaf and bacterial infestation. After the continuous beta-aminobutyric acid (BABA) induction is carried out and then salicylic acid is used for treating, WRKY6 shows an enhanced response, which indicates that the plant hormone can directly or indirectly regulate the expression of WRKY transcription factors, and further indicates the important role of the plant hormone in the disease-resistant response of plants. The invention aims to provide a barley transcription factor HvWRKY6 gene and application thereof in wheat stripe rust and leaf rust resistance.

Disclosure of Invention

The invention provides a barley transcription factor HvWRKY6 gene, the nucleotide sequence of which is shown in SEQ ID No.1, or the nucleotide sequence which is formed by substituting, deleting and/or adding one or more nucleotides and is derived from SEQ ID No.1 and codes amino acid sequences with the same functions.

The invention provides a cloning method of the gene sequence, which comprises the following steps: cloning by using a Polymerase Chain Reaction (PCR) method by using a primer and using barley cDNA as a template to obtain the gene sequence; the nucleotide sequence of the primer is shown as SEQ ID No. 2-3.

The invention provides an expression vector containing the gene sequence. Preferably, the expression vector is a eukaryotic expression vector, and more preferably is a pLGY-02(Ubi:: Gene, T-DNA) vector. For example, the eukaryotic expression vector may be obtained by cloning the aforementioned gene sequence into a pLGY-02 vector.

The present invention provides a host containing the aforementioned expression vector. Alternatively, the host may be escherichia coli, agrobacterium, wheat, or the like. For example, the wheat may be common wheat spring wheat variety JW 1.

The invention provides application of the gene sequence in regulating and controlling the disease resistance of plants to wheat stripe rust and wheat leaf rust. Preferably, the plant is wheat. More preferably, the common wheat is common wheat spring wheat variety JW 1.

The invention has the beneficial effects that: the invention provides a barley HvWRKY6 gene sequence and a preparation process of a wheat transgenic material for over-expressing HvWRKY 6. Experiments prove that the disease resistance of the wheat transgenic material to wheat stripe rust and wheat leaf rust is remarkably improved.

Drawings

FIG. 1 shows that the disease resistance level of wheat stripe rust CYR32 inoculated with the wheat transgenic material over-expressing HvWRKY6 gene is obviously improved.

FIG. 2 shows that the disease resistance level of Puccinia triticina THTT inoculated with the wheat transgenic material with the over-expressed HvWRKY6 gene is remarkably improved.

Detailed Description

Preferred embodiments of the present invention will be described in detail with reference to the following examples. It is to be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the present invention. Various modifications and alterations of this invention will become apparent to those skilled in the art without departing from the spirit and scope of this invention.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Plant material: barley variety Golden Promise, common wheat spring variety JW 1.

Strain and carrier: coli TOP10 competent cells (CB104) were purchased from Tiangen Biochemical technology, Inc. (Beijing). The T cloning vector pGEM-Teasy was purchased from Beijing Quanyujin Biotechnology, Inc. Agrobacterium GV3101 and wheat transgenic vector pLGY-02 were maintained by the present laboratory. The wheat stripe rust fungus toxicity physiological race CYR32 is provided by Liubo teacher of plant protection institute of Chinese academy of agricultural sciences, and the wheat stripe rust fungus physiological race THTT is stored by the research laboratory.

The main reagents are as follows: agarose was purchased from SIGMA; 2 XPremix Taq enzyme was purchased from Shijieki Biotechnology Co., Ltd, restriction enzymes Kpn I, Spe I (TaKaRa engineering Co., Ltd., Boehringer Mannheim); sucrose, glucose, tryptone, agar powder, Tween-20, isopropanol, glycerol, beta-mercaptoethanol, sodium chloride, sodium hydroxide, absolute ethanol, boric acid, Tris-HCl and other reagents are purchased from Ministry of Wanke chemical reagents. The AL2000 DNA Marker, the plasmid small-scale extraction kit, the gel recovery and purification kit are purchased from Biotechnology, Inc., the QIAGEN plant total RNA extraction kit is purchased from Tiangen Biotechnology, Inc., and the SYBR Premix Dimer Eraser fluorescence quantitative kit and the reverse transcription kit are purchased from Beijing all-purpose gold biotechnology, Inc.

The main apparatus is as follows: applied Biosystems Veriti Thermal Cycler PCR amplification instrument (Thermo Fisher), WH-861 vortex mixer (science and education instruments, taicang), high-speed refrigerated Centrifuge 5810R (Eppendorf corporation), small-sized high-speed desktop Centrifuge 5415D (Eppendorf corporation), ultra-clean bench (AIR TECH corporation), constant temperature shaking incubator (shanghai su kusho ltd.), SX-500 sterilization pot (TOMY corporation), ice maker (SCOTSMAN corporation), molar element type ultrapure water machine (shanghai mor scientific instruments ltd.), microwave oven (Galanz corporation), water bath pot (beijing majo instruments), micro amount (Eppendorf corporation), SONY Carl Zeiss varia Sonnar camera (SONY), LightCycler96 real-time fluorescence quantitative PCR instrument (Roche corporation), sample grinder, and the like.

Example 1 cloning of the barley HvWRKY6 Gene

And (3) extracting barley leaf RNA: RNA Extraction was performed using the RNA Extraction Kit (QIAGEN, Hilden, Germany). The second leaf sample of the seedling stage of barley material "Golden Promise" was rapidly ground into powder in a sterilized mortar with liquid nitrogen for use. Preparing Buffer RLT mixed liquor, adding 10 mu L of beta-mercaptoethanol into each ml of Buffer RLT, mixing the mixture for use at present, and placing the mixture on ice after mixing. The ground RNA sample was taken out of the liquid nitrogen, and 500. mu.L of Buffer RLT mixture was added quickly, shaken well, and centrifuged at 10000g for 2 min. The supernatant was pipetted with a pipette and transferred to a purple spin column and centrifuged at 10000g for 1 min. Transferring the collected liquid into a pink centrifugal column, adding pre-cooled absolute ethyl alcohol (the addition amount is 1/2 of the collected liquid), reversing, uniformly mixing, and standing to separate out nucleic acid. The mixture was instantaneously separated for 30 seconds, and the collected liquid was decanted. Add 700. mu.L of RW1 (protein washed off), flash-cut for 30s, and discard the pool. 500 μ L of Buffer RPE (44 mL absolute ethanol was added before use) was added and the mixture was centrifuged off instantaneously for 30s and the collected solution was decanted off. Repeating the above steps once, centrifuging at 10000g for 2 min. The column was replaced with a new 2mL collection tube and left to empty for 1 min. After the centrifugation is finished, the pink centrifugal column is put into a 1.5mL centrifuge tube carried by the kit, 30 mu L of RNase-free water is added to the center of the adsorption membrane by a pipette, and the centrifugation is carried out for 1 min. The collected RNA samples were stored and the RNA concentration was measured by Nanodrop ultramicro spectrophotometry.

Reverse transcription of barley cDNA: for extracting the obtained RNA sample

First-Strand cDNA Synthesis Supermix reverse transcription kit (all gold) was inverted to generate cDNA. All RNA samples were normalized to 1000ng using RNase free ddH₂Complementing the amount of O to 8 mu L, then adding 1 mu L Oligo (dT)12-18Primer (50 mu M), blowing and sucking uniformly, and putting into a PCR instrument at 65 ℃/5min and 4 ℃/2 min. Then 10. mu.L of 2 × ES Reaction Mix, 1. mu.L was added

Mixing the RT/RI Enzyme Mix, putting the mixture into a PCR instrument again at 42 ℃/15min, and heating the mixture for 5s at 85 ℃ to ensure that

RT/RI lost activity and was stored at 4 ℃. The resulting cDNA template was purified with sterile water at a rate of 1: 5, and storing at-20 ℃ for later use.

And (3) PCR amplification: PCR amplification was performed using the HvWRKY6 gene amplification primer using barley cDNA as a template. The primer information is shown in SEQ ID No. 2-3. PCR amplification System: cDNA: mu.L of 1. mu.L of each F/R primer, 0.5. mu.L of 2 XPromix Taq 12.5. mu.L of ddH₂And O is supplemented to 25 mu L. The PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing: 60 ℃/30s, extension: 72 deg.C/1 min, 35 cycles, and finally an extension of 7min at 72 deg.C.

Electrophoresis of PCR products and recovery and purification of target fragments: preparing 1% agarose gel and 0.5 × TBE electrophoresis solution, wherein the electrophoresis conditions are as follows: U110V, I100 mA, P90W, Time 30 min. The target fragment was cut into gel under a gel cutter and recovered with a gel recovery kit (Bio-chemical Co.).

Construction of cloning vector: connecting the recovered product to a pGEM-Teasy vector, wherein the reaction system is as follows: mu.L of 2 XBuffer Buffer, 3.0. mu.L of PCR gel recovery product, 1.0. mu. L T4 DNA ligase, and 1.0. mu.L of pGEM T-easy vector, and centrifuging to mix the reagents well, and ligating at 22 ℃ for at least 1h or 4 ℃ overnight.

Transformation of recombinant plasmid: thawing DH5 alpha competent cells on ice for 5 min; adding all the connecting liquid, mixing, and ice-cooling for 20 min; performing heat shock on the metal bath for 60 s; adding 150 mu L of LB liquid culture medium after ice bath for 5 min; shaking at 37 deg.C and 200rpm for 50 min; and (3) coating a plate (Amp resistant solid culture medium) on an ultra-clean workbench, airing, sealing by using a sealing film, and culturing in an incubator at 37 ℃ overnight.

Screening of recombinant plasmids: 8 spots (half of each spot is reserved) are picked, positive and negative controls are made, and a universal primer T7-F/SP6-R or a cross primer is used for PCR identification; the positive colonies were selected for plaque shaking, inoculated into 6mL of Amp resistant liquid LB medium in a 10mL sterilized centrifuge tube, and shake cultured overnight at 200rpm in a shaker at 37 ℃.

And (3) plasmid extraction: use the worker

The DNA plasmid miniprep kit from Sangon Biotech company extracts plasmids. The cultured cell suspension was aspirated into a 2mL centrifuge tube (500. mu.L), and then 500. mu.L of 50% glycerol was added thereto, followed by storing the glycerol cells at-20 ℃. The remaining bacteria solution was centrifuged at 8000g for 2min to collect the cells, and the supernatant was decanted. 250. mu.L of Buffer P1 (RNase A was added before use, stored at 4 ℃) was added thereto, and the cells were suspended thoroughly by shaking. Add 250. mu.L Buffer P2 (color developing reagent added before use, stored at 28 ℃), mix by inversion, and let stand for 2 min. mu.L of Buffer P3 was added with a pipette and turned upside down to completely disappear the blue color until white floc appeared. Centrifuging at 12000g for 8min, precipitating impurities into the bottom of the tube, transferring the supernatant into an adsorption column, instantly separating, and discarding the waste liquid. Then 500. mu.L of Wash solution was added to the adsorption column, flash separated, and the waste solution was discarded. The Wash solution step is repeated once. The column was centrifuged for 1 min. The column was transferred to a sterile 1.5mL centrifuge tube, 40. mu.L of an Elution buffer preheated at 60 ℃ in advance was added, allowed to stand at room temperature for 1min, and centrifuged for 1 min. The collected DNA solution was stored. And (3) sucking 5 mu L of the extracted plasmid, sending the extracted plasmid to Beijing Huada Gene Limited for sequencing, and storing the successfully sequenced plasmid at-20 ℃. Sequencing results show that the connected T vector contains a 1026bp DNA insert comprising an ORF segment of HvWRKY6 gene, such as SEQ ID No. 1.Example 2 construction of wheat transgenic vector pLGY-02 for HvWRKY6 gene.

Construction of wheat transgenic vector pLGY-02: extracting the HvWRKY6-T recombinant plasmid and pLGY-02 vector plasmid with correct sequencing, and performing double enzyme digestion by using restriction enzymes KpnI + SpeI. The specific enzyme cutting system is as follows: plasmid 1.0. mu.g, KpnI (15U/. mu.L) 1.0. mu.L, SpeI (10U/. mu.L) 1.0. mu.L, 10 XBuffer 2.0. mu.L, ddH₂And O is supplemented to 20 mu L. The enzyme digestion mixture is cut in a metal bath at 37 ℃ for 3-5 h. And (3) after enzyme digestion product electrophoresis detection, recovering a target gene fragment and a pLGY-02 vector fragment by glue, and connecting. A connection system: 12. mu.L of the target fragment, 5. mu.L of the pLGY-02 vector fragment, 1.0. mu.L of T4 DNA Ligase, 2.0. mu.L of T4 DNA Ligase buffer, ddH₂And O is supplemented to 20 mu L. The reagents were mixed well by centrifugation and were either connected at 22 ℃ for at least 1h or in a refrigerator at 4 ℃ overnight. And (3) transforming the ligation product into escherichia coli, carrying out PCR detection, selecting positive bacterial colony shake bacteria, extracting plasmids for double enzyme digestion detection, sending the positive plasmids to a company for sequencing, and screening to obtain the HvWRKY6-pLYG-02 recombinant vector.

Example 3 preparation of HvWRKY6 overexpression wheat transgenic plant

The preparation of the agrobacterium-mediated wheat transgenic material is finished by Shandong Jinnan nation biology limited company, the transformation background material is common wheat spring material JW1, and an agrobacterium-mediated wheat immature embryo transformation method is adopted.

Extracting genome DNA by the SDS method: sampling and marking; adding 1 grinding bead into each tube, precooling with liquid nitrogen, then balancing, putting into a sample making machine, grinding for 1min at 1100g, taking out, then putting into 600 mu L Extraction buffer (100mL of 0.1M Tris-HCl pH 7.5, 100mL of 0.5M EDTA pH 8.0, 125mL of 10% SDS), shaking, and then putting into a 65 ℃ water bath kettle for 30 min; taking out, cooling on ice for 15min to room temperature, adding 300 μ L of 6M Ammonium Acetate, mixing, placing in 4 deg.C refrigerator for 15min, and centrifuging at 12000g for 15 min; and putting 600 mu L of the supernatant into a 1.5mL centrifuge tube which is already filled with 360 mu L of isopropanol, uniformly mixing, and putting the mixture in a refrigerator at 4 ℃ for precipitation for 15 min. Taking out, centrifuging at 12000g for 15min, and pouring out the supernatant; adding 400 μ L of 75% ethanol, centrifuging at 12000g for 15min, and removing supernatant; repeating the steps once; placing the tube containing the DNA on a superclean bench, opening a cover, and drying by blowing; DNA was redissolved in 100. mu.L of sterile water and allowed to stand at room temperature for about half a day. And carrying out PCR detection on the transgenic material genome DNA by using the transgenic vector detection primer to determine a transgenic positive plant.

Example 4 identification of stripe rust and leaf rust resistance of transgenic wheat Material HvWRKY6-OE

Purification and propagation of wheat stripe rust and wheat leaf rust: before inoculation, summer spores of a wheat stripe rust toxicity physiological race CYR32 and a wheat leaf rust toxicity physiological race THTT stored at low temperature are activated in warm water at 42 ℃ for 30min, then hydrated, 0.1% Tween-20 is added, activated strains are evenly inoculated on leaves of a wheat stripe rust-sensitive material JW1 with one heart and one leaf by a smearing method, and after inoculation, water mist is sprayed, the leaves are kept in the dark at 15 +/-5 ℃ for 12-18h and then transferred to a greenhouse for culture. Covering a glass cover and covering gauze, generating a large amount of spore piles on the surfaces of left and right leaves after 12 days of inoculation, collecting summer spores of the rust, scanning and inoculating fresh rust spores to a wheat material with one heart and one leaf to expand and propagate a large amount of rust for a test, collecting the rust spores under the dry condition for later use, storing the rust spores in a silica gel box at 4 ℃ for short term use, and vacuumizing and storing at-20 ℃ for long term storage.

The resistance identification of the wheat transgenic material to stripe rust and leaf rust comprises the following steps: after the wheat transgenic material and the wild type thereof are planted for one week, one-leaf one-heart-stage seedlings are obtained. When the first leaf blade is completely unfolded, purified wheat stripe rust CYR32 and wheat leaf rust THTT are inoculated by a shaking inoculation method. And (4) placing the inoculated wheat seedlings in a culture room at a proper temperature until the diseases occur. Taking a first leaf of the wheat transgenic material for transgenic identification; and (3) taking a second leaf of the wheat transgene and wild wheat for photographing, and analyzing data of sporulation area percentage by using plant disease phenotype statistics ASSESS software. The result shows that the overexpression of the barley transcription factor HvWRKY6 gene in wheat can obviously improve the resistance level of plants to wheat stripe rust (figure 1) and wheat leaf rust (figure 2).

Sequence listing

<110> university of agriculture in Hebei

<120> barley transcription factor HvWRKY6 gene and application thereof in wheat stripe rust and leaf rust resistance <130> MLOC _78461

<141> 2020-11-20

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1026

<212> DNA

<213> HvWRKY6 Gene sequence ()

<400> 1

atggcgtctt ccggcggcgg gcgctcaccg gcgacggcgg tcttagacga cctggtcgat 60

gttcgcgacc gagtggggat gttgcagacc gtactgcatg agtcttcgcc tcgggcgacc 120

gcggaggcgg gggagctggt ggaggggatg atggccaagc tgtcgagctc catgtcggtt 180

ctcggcaccg gtgatggcgt catagcgtcg tcgtcgggag caggtcggga atcgggcggg 240

aggagggaga gaaccggcgc ggcggcgtcc gggccgcacc gccggagcag cccgaggaga 300

aggatgaaga gccctctaat caagacggtc accactacaa tgctcacgga tggcaagtca 360

tggaggaaat acggacagaa gcagataaat gactctacta ggagctacta ccggtgcacg 420

cataagccag accaaggctg ccaggccaag aggcacgtcc aggaatccga gtccaacccg 480

gcggagtaca ccatcgacta ctacggccag cacacctgca gggatccctc cacattccca 540

tcactcatcg ctcaaggcgc cgccgcagct gccccgccgc cggacttcgc aaacctcatc 600

agcttcgcgc ccatcaatgg atccaaccgc ggtttcaccg caagcacgag cacaagtgct 660

tttgctcatc atctcatgaa agaagcggct gatcatcatt ctatgctctt ctcccgcttc 720

tccaaccaca gctcctcgcc gccggctcag gagggcgtgt ccagtggctc accgtcgccg 780

gcttgccacg ggaagttcat gcagtacgcc ggcggacagt tcatcaacgt tactggctta 840

agcacatcgc cgttgactgt gggatcggcg ccagcggagt actggccagt ggtgggggtc 900

gccggtgtcg acatggatgc tggcgcggcc atggacagct tcgcttcccc gccgagcagc 960

ccggggtttc tgtcgggctc gttggaggga tcatttggca acaacgtttg ccactggcga 1020

atctag 1026

<210> 2

<211> 23

<212> DNA

<213> Artificial sequence-Forward primer ()

<400> 2

ggtaccatgg cgtcttccgg cgg 23

<210> 3

<211> 28

<212> DNA

<213> Artificial sequence-reverse primer ()

<400> 3

actagtctag attcgccagt ggcaaacg 28

Claims (9)

1. The barley transcription factor HvWRKY6 gene is characterized in that the nucleotide sequence is shown in SEQ ID No. 1.

2. The method for cloning a gene sequence according to claim 1, wherein the gene sequence is cloned by PCR using a primer and a cDNA of barley "Golden Promise" material as a template.

3. The nucleotide sequence of the primer is as follows:

HvWRKY6-ORF-F：GGTACCATGGCGTCTTCCGGCGG

HvWRKY6-ORF-R：ACTAGTCTAGATTCGCCAGTGGCAAACG。

4. an expression vector comprising the gene sequence of claim 8981.

5. The expression vector of claim 4, wherein the expression vector is a eukaryotic expression vector.

6. The expression vector of claim 5, wherein the expression vector is the wheat transgene vector pLGY-02.

7. A host comprising the expression vector of any one of claims 4 to 6.

8. Use of the gene sequence of claim 1 for modulating disease resistance of a plant to wheat stripe rust and wheat leaf rust.

9. Use according to claim 8, wherein the plant is Triticum aestivum.

Images