CN117737254A - Biomarker for predicting or diagnosing early pregnancy of sow and application thereof - Google Patents
Biomarker for predicting or diagnosing early pregnancy of sow and application thereof Download PDFInfo
- Publication number
- CN117737254A CN117737254A CN202311762132.3A CN202311762132A CN117737254A CN 117737254 A CN117737254 A CN 117737254A CN 202311762132 A CN202311762132 A CN 202311762132A CN 117737254 A CN117737254 A CN 117737254A
- Authority
- CN
- China
- Prior art keywords
- mirna
- novel
- sow
- biomarker
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 230000035935 pregnancy Effects 0.000 title claims abstract description 45
- 239000000090 biomarker Substances 0.000 title claims abstract description 29
- 239000002679 microRNA Substances 0.000 claims abstract description 111
- 230000014509 gene expression Effects 0.000 claims abstract description 43
- 108091070501 miRNA Proteins 0.000 claims abstract description 42
- 238000003745 diagnosis Methods 0.000 claims abstract description 30
- 238000001514 detection method Methods 0.000 claims abstract description 20
- 239000002773 nucleotide Substances 0.000 claims description 19
- 125000003729 nucleotide group Chemical group 0.000 claims description 19
- 239000003153 chemical reaction reagent Substances 0.000 claims description 14
- 238000004458 analytical method Methods 0.000 claims description 11
- 238000012360 testing method Methods 0.000 claims description 8
- 150000001875 compounds Chemical class 0.000 claims description 3
- 108700011259 MicroRNAs Proteins 0.000 description 76
- 210000002381 plasma Anatomy 0.000 description 20
- 239000000523 sample Substances 0.000 description 17
- 238000000034 method Methods 0.000 description 11
- 238000000338 in vitro Methods 0.000 description 8
- 239000002299 complementary DNA Substances 0.000 description 6
- 238000002474 experimental method Methods 0.000 description 6
- 239000007788 liquid Substances 0.000 description 6
- 239000000243 solution Substances 0.000 description 6
- 239000002699 waste material Substances 0.000 description 6
- 238000006243 chemical reaction Methods 0.000 description 5
- 238000003753 real-time PCR Methods 0.000 description 5
- 238000010839 reverse transcription Methods 0.000 description 5
- 230000035945 sensitivity Effects 0.000 description 5
- 238000011529 RT qPCR Methods 0.000 description 4
- 210000004369 blood Anatomy 0.000 description 4
- 239000008280 blood Substances 0.000 description 4
- 239000006166 lysate Substances 0.000 description 4
- 238000001179 sorption measurement Methods 0.000 description 4
- HEDRZPFGACZZDS-UHFFFAOYSA-N Chloroform Chemical compound ClC(Cl)Cl HEDRZPFGACZZDS-UHFFFAOYSA-N 0.000 description 3
- 241001465754 Metazoa Species 0.000 description 3
- 238000009395 breeding Methods 0.000 description 3
- 230000001488 breeding effect Effects 0.000 description 3
- 238000013211 curve analysis Methods 0.000 description 3
- 230000013011 mating Effects 0.000 description 3
- 108020004999 messenger RNA Proteins 0.000 description 3
- 239000000203 mixture Substances 0.000 description 3
- 108090000623 proteins and genes Proteins 0.000 description 3
- 108091032973 (ribonucleotides)n+m Proteins 0.000 description 2
- IJGRMHOSHXDMSA-UHFFFAOYSA-N Atomic nitrogen Chemical compound N#N IJGRMHOSHXDMSA-UHFFFAOYSA-N 0.000 description 2
- 238000009007 Diagnostic Kit Methods 0.000 description 2
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 2
- 238000002123 RNA extraction Methods 0.000 description 2
- 102000006382 Ribonucleases Human genes 0.000 description 2
- 108010083644 Ribonucleases Proteins 0.000 description 2
- 230000015572 biosynthetic process Effects 0.000 description 2
- 229960001701 chloroform Drugs 0.000 description 2
- 238000005336 cracking Methods 0.000 description 2
- 238000005516 engineering process Methods 0.000 description 2
- 210000001808 exosome Anatomy 0.000 description 2
- 238000000605 extraction Methods 0.000 description 2
- 239000000463 material Substances 0.000 description 2
- 238000002156 mixing Methods 0.000 description 2
- 238000002360 preparation method Methods 0.000 description 2
- 238000004321 preservation Methods 0.000 description 2
- 102000004169 proteins and genes Human genes 0.000 description 2
- 230000001850 reproductive effect Effects 0.000 description 2
- 238000003786 synthesis reaction Methods 0.000 description 2
- 238000010998 test method Methods 0.000 description 2
- 206010000234 Abortion spontaneous Diseases 0.000 description 1
- 102000004190 Enzymes Human genes 0.000 description 1
- 108090000790 Enzymes Proteins 0.000 description 1
- 239000013614 RNA sample Substances 0.000 description 1
- 238000000692 Student's t-test Methods 0.000 description 1
- 108091036066 Three prime untranslated region Proteins 0.000 description 1
- 230000010100 anticoagulation Effects 0.000 description 1
- 238000003556 assay Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 238000007664 blowing Methods 0.000 description 1
- 230000015556 catabolic process Effects 0.000 description 1
- 210000004027 cell Anatomy 0.000 description 1
- 238000007405 data analysis Methods 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000006731 degradation reaction Methods 0.000 description 1
- 238000004925 denaturation Methods 0.000 description 1
- 230000036425 denaturation Effects 0.000 description 1
- 238000013461 design Methods 0.000 description 1
- 230000007515 enzymatic degradation Effects 0.000 description 1
- 230000008014 freezing Effects 0.000 description 1
- 238000007710 freezing Methods 0.000 description 1
- 238000009396 hybridization Methods 0.000 description 1
- 208000000509 infertility Diseases 0.000 description 1
- 230000036512 infertility Effects 0.000 description 1
- 231100000535 infertility Toxicity 0.000 description 1
- 230000009027 insemination Effects 0.000 description 1
- 150000002632 lipids Chemical class 0.000 description 1
- 244000144972 livestock Species 0.000 description 1
- 238000004519 manufacturing process Methods 0.000 description 1
- 238000011880 melting curve analysis Methods 0.000 description 1
- 239000012528 membrane Substances 0.000 description 1
- 208000015994 miscarriage Diseases 0.000 description 1
- 229910052757 nitrogen Inorganic materials 0.000 description 1
- 108091027963 non-coding RNA Proteins 0.000 description 1
- 102000042567 non-coding RNA Human genes 0.000 description 1
- 230000002265 prevention Effects 0.000 description 1
- 230000001737 promoting effect Effects 0.000 description 1
- 238000011002 quantification Methods 0.000 description 1
- 238000003762 quantitative reverse transcription PCR Methods 0.000 description 1
- 239000011535 reaction buffer Substances 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 210000002966 serum Anatomy 0.000 description 1
- 208000000995 spontaneous abortion Diseases 0.000 description 1
- 239000007858 starting material Substances 0.000 description 1
- 239000004575 stone Substances 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 208000024891 symptom Diseases 0.000 description 1
- 238000012353 t test Methods 0.000 description 1
- 238000010257 thawing Methods 0.000 description 1
- 238000012546 transfer Methods 0.000 description 1
- 238000013519 translation Methods 0.000 description 1
- 238000011144 upstream manufacturing Methods 0.000 description 1
- 238000012795 verification Methods 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The application discloses a biomarker for predicting or diagnosing early pregnancy of a sow and application thereof. The biomarker is selected from at least one of miRNA novel-216 and miRNA novel-138. These biomarkers exhibit expression differences in plasma extracellular vesicles of a sow population, and such expression differences are associated with sow pregnancy. These miRNAs are developed into molecular markers for early detection of pregnancy of sows, and can conveniently detect pregnancy conditions. And further develop the primer and kit for rapid detection of early pregnancy, and provide a new way for early pregnancy diagnosis of sow.
Description
Technical Field
The application relates to the technical field of early pregnancy prediction or diagnosis of sows, in particular to a biomarker for early pregnancy prediction or diagnosis of sows and application thereof.
Background
After the sow is bred, the pregnancy of the sow is predicted or diagnosed timely and accurately, so that the reproductive efficiency of the sow is improved. The early pregnancy prediction or diagnosis of sows can confirm the gestation state of sows after mating, take a miscarriage prevention measure and corresponding pregnancy management on sows which are already pregnant, take a compound measure on sows which are not pregnant in time, shorten the nonpregnant period of sows, and eliminate sows which are frequently matched with infertility in time. Early pregnancy or diagnosis can reduce the non-production days of the sow, reduce the feeding cost, improve the use efficiency of the sow and improve the annual productivity of the sow.
The traditional pregnancy diagnosis methods such as a test method, an external observation method, an ultrasonic diagnosis method, a vaginal examination method and the like have the defects of long diagnosis time days, undefined symptom diagnosis, influence by experience degree of a user and the like, and misdiagnosis and missed diagnosis exist at different degrees.
Disclosure of Invention
In view of the above, the present invention provides biomarkers for predicting or diagnosing early pregnancy of sow and application thereof, which solve one of the above technical problems to a certain extent.
For this purpose, the present application discloses at least the following technical solutions:
in a first aspect, the embodiment discloses application of a biomarker in preparation of a sow early pregnancy prediction or diagnosis product, wherein the biomarker is selected from miRNA novel-216 and/or miRNA novel-138, the nucleotide sequence of the miRNA novel-216 is shown as SEQ ID NO.1, and the nucleotide sequence of the miRNA novel-138 is shown as SEQ ID NO. 2.
In a second aspect, the embodiment discloses application of a reagent for detecting a biomarker in preparing a sow early pregnancy diagnosis product, wherein the biomarker is selected from miRNA novel-216 and/or miRNA novel-138, the nucleotide sequence of the miRNA novel-216 is shown as SEQ ID NO.1, and the nucleotide sequence of the miRNA novel-138 is shown as SEQ ID NO. 2.
In a third aspect, the embodiment discloses a detection product for early pregnancy of a sow, which comprises a primer for detecting the expression level of miRNA novel-216 and/or miRNA novel-138, wherein the primer for detecting the expression level of miRNA novel-216 is shown as SEQ ID NO.3, and the primer for detecting the expression level of miRNA novel-138 is shown as SEQ ID NO. 4.
In a fourth aspect, the embodiment discloses application of a biomarker in constructing a sow early pregnancy prediction model, wherein the biomarker is selected from miRNA novel-216 and/or miRNA novel-138, the nucleotide sequence of the miRNA novel-216 is shown as SEQ ID NO.1, and the nucleotide sequence of the miRNA novel-138 is shown as SEQ ID NO. 2.
Compared with the prior art, the application has at least one of the following beneficial effects:
the application finds the expression difference of two miRNA novel-216 and miRNA novel-138 in the extracellular vesicles of the plasma of the sow group, and the expression difference is related to the pregnancy of the sow. These miRNAs are developed into molecular markers for early detection of pregnancy of sows, and can conveniently detect pregnancy conditions. And further develop the primer and kit for rapid detection of early pregnancy, and provide a new way for early pregnancy diagnosis of sow.
Drawings
FIG. 1 is a ROC curve using miRNA novel-216 (A) alone as provided in the examples of the present application.
FIG. 2 is a ROC curve using miRNA novel-138 (B) alone as provided in the examples of the present application.
Fig. 3 is a ROC curve analyzed using miRNA novel-216 in combination with miRNA novel-138 as provided in the examples of the present application.
Detailed Description
In order to make the objects, technical solutions and advantages of the present application more apparent, the present application will be further described in detail with reference to examples. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the present application. Reagents not specifically and individually described in this application are all conventional reagents and are commercially available; methods which are not specifically described in detail are all routine experimental methods and are known from the prior art.
Early detection or diagnosis or auxiliary detection or diagnosis of pregnancy of sows by biomarkers is of great importance. The method can replace the traditional pregnancy diagnosis method, shortens the diagnosis time days, reduces the influence on the experience degree of the subject, and avoids misdiagnosis and missed diagnosis.
The embodiment of the application provides application of a biomarker in preparation of a sow early pregnancy prediction or diagnosis product, wherein the biomarker is selected from miRNA novel-216 and/or miRNA novel-138, the nucleotide sequence of the miRNA novel-216 is shown as SEQ ID NO.1 (GGUUCGAUCCCGGGCUCG), and the nucleotide sequence of the miRNA novel-138 is shown as SEQ ID NO.2 (CUGAGGGCUGGGCAUGGG).
MicroRNAs (miRNA) is a small size (about 22 nucleotides long) non-coding RNA present in extracellular vesicles, protected from ribonuclease enzymatic degradation by the lipid layer of the outer vesicle. Mirnas attached to the 3' untranslated region of mRNA induce degradation of mRNA or block translation of mRNA into protein are effective controllers of gene expression. In some embodiments, these mirnas are expressed in sow plasma exovesicles, making their expression level detection more suitable for in vitro detection, such as developing detection and/or diagnostic kits for in vitro samples.
In some embodiments, these kits may be qRT-PCR technology based kits.
In another aspect, the embodiment also discloses application of the reagent for detecting the biomarker in preparing a sow early pregnancy diagnosis product, wherein the biomarker is selected from miRNA novel-216 and/or miRNA novel-138, the nucleotide sequence of the miRNA novel-216 is shown as SEQ ID NO.1, and the nucleotide sequence of the miRNA novel-138 is shown as SEQ ID NO. 2.
In some embodiments, the reagents for detecting the expression levels of these mirnas include primers that detect the expression levels of miRNA novel-216 and/or miRNA novel-138. The primer for detecting the expression level of the miRNA novel-216 is shown as SEQ ID NO. 3. The primer for detecting the expression level of miRNA novel-138 is shown as SEQ ID NO. 4. Thus, the embodiment also discloses a detection product for early pregnancy of a sow, which comprises a primer for detecting the expression level of miRNA novel-216 and/or miRNAnovel-138.
Further, the embodiment also discloses the detection product, and further comprises a total RNA extraction reagent, a reverse transcription reagent and an RT-qPCR detection reagent.
In some embodiments, the detection product comprises a primer that detects the level of mirrnanovel-216 expression.
In some embodiments, the detection product comprises a primer that detects the expression level of miRNA novel-138.
In some embodiments, the detection product comprises primers that detect the expression levels of miRNA novel-216 and miRNAnovel-138.
On the other hand, the embodiment also discloses application of the biomarker in constructing a sow early pregnancy prediction model, wherein the biomarker is selected from miRNA novel-216 and/or miRNAnovel-138, the nucleotide sequence of the miRNAnovel-216 is shown as SEQ ID NO.1, and the nucleotide sequence of the miRNA novel-138 is shown as SEQ ID NO. 2.
In some embodiments, the predictive model is a joint analysis logic model. The general formula of the joint analysis logic model is shown as the formula (I) and the formula (II).
Logit(P)＝B 0 +B 1 X 1 +B 2 X 2 +…+B n X n A compound of formula (I);
in the formula (I), B 0 Represents a constant; b (B) n Is a regression coefficient; x is X n For the relative expression levels of different markers (2 -ΔCt )；
In formula (II), logit (P) is derived from formula (I), combine is a combined diagnostic value. Based on the combination values, ROC curve analysis can be performed. Therefore, the early pregnancy condition of the sample to be detected can be judged according to the Cut off value of ROC analysis. In some embodiments, the sample to be tested is an in vitro sample of sow plasma or an in vitro sample of sow plasma exovesicle extract.
In some embodiments, the predictive model is constructed with the relative expression levels of miRNA novel-216 and miRNAnovel-138:
Logit(P)＝1.708-0.001X 1 -0.188X 2 ；
X 1 : relative expression level of miRNA novel-138
X 2 : the relative expression level (2-delta ct) of miRNA novel-216;
in these embodiments, the relative expression amounts of miRNA-182 and miRNA-378 in the in vitro sample of the sow plasma or the in vitro sample of the sow plasma exosome extract are substituted into the prediction model, the combine value calculated according to the prediction model is subjected to ROC curve analysis according to the combine value, the Cut off value is obtained by ROC analysis, and the early pregnancy condition of the sample to be detected can be judged according to the Cut off value.
The present application will be described in more detail with reference to the following examples, which should not be construed as limiting the scope of the present application.
In some embodiments, pre-screened mirnas were validated in blood extracellular vesicles of 55 sow populations bred for 15 d: differences between miRNA novel-216 and miRNA novel-138.
The following examples utilized a sow blood outer vesicle miRNA: the differential expression of the differences between miRNA novel-216 and miRNA novel-138 establishes independent or combined prediction or diagnostic kits to analyze their feasibility as biomarkers in early pregnancy diagnosis in sows.
1. Materials and methods
1. Test materials
Test sample: the animals used in the experiment are all from Xinjiang Tiankang livestock science and technology limited company, 55 binary growing sows with normal hair condition, uniform and consistent reproductive performance and body condition and good body condition are selected in the experiment, and the breeding is carried out by adopting an artificial insemination method. The breeding is on day 0 of breeding. All experiments involving animals were performed in accordance with the guidelines approved by the animal protection and utilization committee of the university of chinese stone river (a 2016-085).
2. Test instrument
TABLE 1 Main instruments
TABLE 2 Main reagents
| Main experiment reagent | Manufacturer (S) |
| exoRNeasy Midi Kit | QIAGEN, germany |
| MiRNAcute enhanced miRNA cDNA first strand synthesis kit | TIANGEN BIOTECH (BEIJING) Co.,Ltd. |
| miRNAcute enhanced miRNA fluorescent quantitative detection kit (SYBR Green) | TIANGEN BIOTECH (BEIJING) Co.,Ltd. |
| Absolute ethyl alcohol | Tianjin Fuyu Fine chemical Co., ltd |
| Trichloromethane | Tianjin sea photochemical plant |
3. Test method
(1) Collection of experimental samples
Collecting blood of 55 sows on the 15 th day after hybridization, wherein 42 pregnant sows and 13 non-pregnant sows are marked, putting into a 5mLEDTA anticoagulation blood collection tube, fully and uniformly mixing, centrifuging at 3000 Xg for 15min, collecting plasma, immediately placing into liquid nitrogen for freezing preservation, and returning to a laboratory as soon as possible to be placed into a refrigerator at-80 ℃ for preservation for later use.
(2) Extraction of extracellular vesicles and RNA thereof from blood plasma
The experimental procedure was performed as per QIAGENE exoRNeasy Serum/Plasma Starter Kit kit extraction procedure and requirements:
1) A700. Mu.L plasma/1 mL plasma sample was placed in a 37℃water bath for thawing.
2) The plasma samples were placed in a refrigerated high-speed centrifuge, 16,000Xg, 4℃and centrifuged for 10min to remove cell debris and platelets.
3) An equal volume of Buffer XBP was added to the sample, the EP tube was inverted 5 times and immediately mixed well.
4) The mixture of 3) was added to exoEasy spin column and centrifuged at 500 Xg for 1min, the waste liquid was discarded and the column was returned to the same collection tube. (note: if there is liquid residue, the mixture is centrifuged again at 5000 Xg for 1 min)
5) After adding 3.5mL Buffer XWP to the column, the column was centrifuged at 5000 Xg for 5min, and the waste solution was discarded.
6) The spin column was transferred to a new collection tube.
7) To the center of the column adsorption membrane, 700. Mu.L QIAzol was added, centrifuged at 5000 Xg for 5min and the lysate was collected, followed by transfer of the lysate to a 1.5mL enzyme-free EP tube.
8) Vortex shaking the cracking liquid in the step (7), standing for 5min at room temperature, and promoting the cracking of the protein complex.
9) To the lysate was added 90. Mu.L of chloroform, vortexed for 15s, and incubated at room temperature for 3min.
10 Placing the lysate in a high-speed refrigerated centrifuge at 4deg.C, and centrifuging at 12000 Xg for 15min.
11 Transferring the upper liquid into a new 1.5mL enzyme-free EP tube (400 mu L), adding 2 times of volume of absolute ethyl alcohol, repeatedly blowing and fully mixing.
12 700. Mu.L of the above sample was placed in a new RNeasy MinElute adsorption column, centrifuged at 9000 Xg for 15s at room temperature, and the waste liquid was discarded; this step is repeated.
13 700. Mu.L Buffer RWT was added to the RNeasy MinElute column and centrifuged at 9000 Xg for 15s, and the waste solution was discarded.
14 500. Mu.L Buffer RPE was added to the RNeasy MinElute column and centrifuged at 9000 Xg for 15s, and the waste solution was discarded.
15 500. Mu.L Buffer RPE was added to the RNeasy MinElute column and centrifuged at 9000 Xg for 2min, and the waste solution and collection tubes were discarded.
16 RNeasy MinElute adsorption column was placed in a fresh 2mL collection tube and centrifuged at full speed for 5min.
17 RNeasy MinElute adsorption column was placed in a new 1.5mL enzyme-free EP tube, and after adding 14. Mu.L RNase-free water, the column was allowed to stand for 1min, and centrifuged at full speed for 1min.
18 After the RNA extraction was completed, the concentration and purity of the RNA samples were assessed by NanoDrop 2000.
(3) Reverse transcription of plasma extracellular vesicle miRNA
A miracute enhanced miRNA cDNA first strand synthesis kit (tengen) was used. The reverse transcription reaction system is carried out according to tables 2-3, at 42 ℃ for 60min, miRNA is added with A tail for reaction and reverse transcription reaction; 95 ℃ for 3min; the cDNA was stored at-20℃in a refrigerator at 4℃for further use.
TABLE 3 reverse transcription system
| Reagent(s) | Usage amount |
| Total RNA* | 2ug |
| miRNA RT Enzyme Mix | 2μL |
| 2×miRNA RT Reaction Buffer | 10μL |
| RNase Free ddH 2 O | up to 20μL |
(4) Differential expression miRNA fluorescent quantitative PCR primer design
The expression levels of differentially expressed mirnas in P (n=37) and NP (n=8) groups were detected by real-time fluorescent quantitative PCR. 3 miRNAs obtained through early screening in the laboratory are selected for quantitative verification, so that the possibility of using the miRNAs as potential biomarkers for pregnancy diagnosis is verified. As shown in table 4, the upstream primers of 2 mirnas were synthesized by Shanghai bioengineering company, inc., and the downstream primers were universal primers carried by miRcute enhanced miRNA fluorescent quantitative detection kit (SYBR Green) (TIANGEN, product number FP 411), U6 as a normalized reference gene.
TABLE 4 quantitative primer sequences for miRNAs
| Primer name | Sequence(5'-3') | Tm/℃ |
| 216F | GAGGTTCGATCCCGGGCTCG,SEQ ID NO.3 | 60 |
| 138F | TCGGAAAAGGATTGGCTCTG,SEQ ID NO.4 | 60 |
| U6-F | CGCTTCGGCAGCACATATACTA,SEQ ID NO.5 | 60 |
| U6-R | ATGGAACGCTTCACGAATTTGC,SEQ ID NO.6 | 60 |
(5) Real-time fluorescent quantitative PCR reaction
The expression level of cDNA of extracellular vesicle miRNAs in the plasma of the pregnant and non-pregnant sow of the 15d mating period was used as a template for the test, and the expression level of cDNA in the two libraries was analyzed. A miracute enhanced miRNA fluorescent quantitative detection kit (SYBR Green) (TIANGEN) was used. The quantitative PCR reaction system was carried out according to Table 5, using a LightCycler 96 real-time fluorescent quantitative PCR apparatus, two-step method: the initial denaturation temperature was 95℃for 15min, then at 95℃for 10s, at 60℃for 34s, 45 cycles, and finally the melting curve analysis. U6 is the same as above. Three biological replicates were performed for each qPCR analyzed sample.
Table 5 miRNA quantification System
| Reagent(s) | Usage amount |
| 2×miRNAcute Plus miRNA Premi(SYBR&ROX) | 10μL |
| Forward Primer | 0.4μL |
| Reverse Primer | 0.4μL |
| miRNA first strand cDNA | 2ng |
| ddH 2 O | up to 20μL |
4. Data analysis
Equation 2 was used for qRT-PCR data using Excel software -ΔΔCt Analysis was performed. Pair 2 using SPSS26.0 software -ΔCt Analysis was performed, data expressed as mean ± standard error, and differences between test samples were analyzed by t-test. P is less than or equal to 0.05 and represents significant difference, and P is less than or equal to 0.01 and represents extremely significant difference. Pair 2 with R software pROC, optimalCutpoints package -ΔCt Subject working characteristics (receiver operating characteristic curve, ROC) analysis was performed to calculate AUC, sensitivity, specificity, about log index and Cut off values.
2. Results and analysis
1. miRNA individual diagnostic efficacy assays
And according to the expression amounts of miRNA novel-216 and miRNA novel-138 in the plasma extracellular vesicles of the pregnant and non-pregnant sows of the mating 15d, evaluating the value of the plasma extracellular vesicle plasma in early pregnancy diagnosis by adopting an ROC curve. As shown in fig. 1, 2 and table 6, the area under the curve auc=0.617 for the extraplasmatic vesicle miRNA level-216 for early pregnancy diagnosis, sensitivity (true positive rate) and specificity (true negative rate) were 92.3% and 37.8%, respectively; the area under the curve auc=0.683 for plasma EVs novel-138 for early pregnancy diagnosis was 71.4% and 70.7% sensitivity and specificity, respectively.
TABLE 6 Single diagnosis of extravascular vesicles novel-216 and novel-138
| miRNA | AUC | Sensitivity of | Specificity of the sample | About step onIndex number | Cut off value |
| miRNA novel-216 | 0.617 | 0.923 | 0.378 | 0.301 | 1.953 |
| miRNAnovel-138 | 0.683 | 0.714 | 0.707 | 0.422 | 1.838 |
2. miRNA joint diagnostic efficacy analysis
Logit (P) =1.708-0.001X using a joint analytical logic model 1 -0.188X 2 ；
X 1 : relative expression level of miRNAnovel-138
X 2 : relative expression level of miRNA novel-216 (2 -ΔΔct )；
In these embodiments, the relative expression amounts of miRNA-138 and miRNA-216 in the in vitro sample of the sow plasma or the in vitro sample of the sow plasma exosome extract are detected, substituted into the prediction model, the combine value calculated according to the prediction model is subjected to ROC curve analysis according to the combine value, the Cut off value is obtained by ROC analysis, and the early pregnancy condition of the sample to be detected can be judged according to the Cut off value.
Two of the candidate mirnas are combined together and improved performance is obtained compared to a single miRNA. The results showed that miRNA novel-216 and miRNA novel-138 exhibited AUC of 0.645 (FIG. 3, table 7). It is shown that the combination of the two miRNAs can be used as biomarkers to realize early pregnancy diagnosis of the sow.
TABLE 7 diagnosis of the combinations of extracellular vesicles novel-216 and novel-138
| miRNA | AUC | Sensitivity of | Specificity of the sample | About sign index | Cut off value |
| miRNA novel-216、miRNA novel-138 | 0.645 | 0.452 | 0.857 | 0.309 | 1.177 |
The foregoing is merely a preferred embodiment of the present application, but the scope of the present application is not limited thereto, and any changes or substitutions easily contemplated by those skilled in the art within the technical scope of the present application should be covered by the scope of the present application.
Claims (10)
1. The application of the biomarker in preparing a sow early pregnancy prediction or diagnosis product is characterized in that the biomarker is selected from miRNA novel-216 and/or miRNA novel-138, the nucleotide sequence of the miRNA novel-216 is shown as SEQ ID NO.1, and the nucleotide sequence of the miRNA novel-138 is shown as SEQ ID NO. 2.
2. The application of the reagent for detecting the biomarker in preparing the sow early pregnancy diagnosis product is characterized in that the biomarker is selected from miRNA novel-216 and/or miRNA novel-138, the nucleotide sequence of the miRNA novel-216 is shown as SEQ ID NO.1, and the nucleotide sequence of the miRNA novel-138 is shown as SEQ ID NO. 2.
3. The use of claim 2, wherein the reagent comprises primers to detect miRNA level-216 and/or miRNA level-138 expression levels.
4. A detection product for early pregnancy of a sow comprises a primer for detecting the expression level of miRNA novel-216 and/or miRNA novel-138, wherein the primer for detecting the expression level of miRNA novel-216 is shown as SEQ ID NO.3, and the primer for detecting the expression level of miRNA novel-138 is shown as SEQ ID NO. 4.
5. The test product of claim 4, comprising a primer that detects the expression level of miRNA novel-216.
6. The test product of claim 4, comprising a primer that detects the expression level of miRNA novel-138.
7. The test product according to claim 4, comprising a primer for detecting the expression level of miRNA novel-216 and a primer for detecting the expression level of miRNA novel-138.
8. The application of the biomarker in constructing a sow early pregnancy prediction model is characterized in that the biomarker is selected from miRNA novel-216 and/or miRNA novel-138, the nucleotide sequence of the miRNA novel-216 is shown as SEQ ID NO.1, and the nucleotide sequence of the miRNA novel-138 is shown as SEQ ID NO. 2.
9. The use according to claim 7, wherein the predictive model is a joint analysis logic model of the general formula (I) and (II);
Logit(P)＝B 0 +B 1 X 1 +B 2 X 2 +…+B n X n a compound of formula (I);
in the formula (I), B 0 Represents a constant; b (B) n Is a regression coefficient; x is X n For the relative expression levels of different markers (2 -ΔΔct )；
In formula (II), logit (P) is derived from formula (I), combine is a combined diagnostic value.
10. The use of claim 9, wherein the predictive model is constructed with the relative expression levels of miRNA novel-138 and miRNA novel-216:
Logit(P)＝1.708-0.001X 1 -0.188X 2 ；
X 1 : relative expression level of miRNA novel-138 (2 -ΔΔct )；
X 2 : relative expression level of miRNA novel-216 (2 -ΔΔct )。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311762132.3A CN117737254A (en) | 2023-12-20 | 2023-12-20 | Biomarker for predicting or diagnosing early pregnancy of sow and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311762132.3A CN117737254A (en) | 2023-12-20 | 2023-12-20 | Biomarker for predicting or diagnosing early pregnancy of sow and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN117737254A true CN117737254A (en) | 2024-03-22 |
Family
ID=90260432
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202311762132.3A Pending CN117737254A (en) | 2023-12-20 | 2023-12-20 | Biomarker for predicting or diagnosing early pregnancy of sow and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117737254A (en) |
-
2023
- 2023-12-20 CN CN202311762132.3A patent/CN117737254A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| ES2488845T3 (en) | Prediction of the probability of cancer recurrence | |
| EP3543359B1 (en) | Molecular marker, kit and application for use in early diagnosis and prediction of sepsis as complication of acute kidney injury | |
| CN112469836B (en) | Method for determining endometrial status, method for detecting endometrial receptivity for female embryo implantation, kit and use | |
| CN111455044B (en) | Exosome miRNA marker for early pregnancy diagnosis of ewes and application thereof | |
| CN109161593B (en) | Application of circular RNA and microRNA in colorectal cancer screening and diagnosis | |
| US20230242986A1 (en) | Methods and markers for azoospermia characterisation | |
| Dülgeroğlu et al. | Serum levels of miR-223-3p and miR-223-5p in prostate diseases | |
| CN111500749B (en) | Exosome miRNA marker for early pregnancy diagnosis of sows and application thereof | |
| CN113832232A (en) | Biomarker for predicting responsiveness of lung adenocarcinoma to platinum-containing dual-drug chemotherapy, and related product | |
| CN117737254A (en) | Biomarker for predicting or diagnosing early pregnancy of sow and application thereof | |
| CN117887861A (en) | Biomarker for predicting or diagnosing early pregnancy of sow and application thereof | |
| CN111876497B (en) | Method for identifying or assisting in identifying quality of animal semen | |
| CN112522391B (en) | Application of hsa_circ_0008961 as gout diagnosis marker | |
| KR102505618B1 (en) | Urinary exosome-derived miRNA gene biomarkers for diagnosis of antibody-mediated rejection in kidney allografts and use thereof | |
| KR102505617B1 (en) | Urinary exosome-derived miRNA gene biomarkers for diagnosis of T cell-mediated rejection in kidney allografts and use thereof | |
| CN113862369A (en) | Marker related to sensitivity of lung adenocarcinoma to platinum-containing dual-drug chemotherapy and application thereof | |
| CN114032308A (en) | Use of FAM83A, KPNA2, KRT6A and LDHA in combination as a biomarker for lung adenocarcinoma | |
| CN114107461A (en) | Circular RNA marker and application thereof in diagnosis and prediction of recurrent abortion pathological pregnancy | |
| CN109628585A (en) | Application of the non-coding RNA in diagnosis of sepsis disease | |
| Albani | Enhancement of mRNA-based Methods for body fluid and cell type identification | |
| CN118326039B (en) | TsRNA biomarker for diagnosing hepatocellular carcinoma and application thereof | |
| KR102545543B1 (en) | Urinary exosome-derived miRNA gene biomarkers for diagnosis of BK virus nephropathy in kidney allografts and use thereof | |
| CN113817819B (en) | Application of LINC01996 in diagnosis of allergic airway inflammation | |
| EP4183888A1 (en) | Mirna signature for identification of the receptive endometrium | |
| CN111808950B (en) | Thyroid papillary carcinoma miRNA marker and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |