CN111455044B - Exosome miRNA marker for early pregnancy diagnosis of ewes and application thereof - Google Patents
Exosome miRNA marker for early pregnancy diagnosis of ewes and application thereof Download PDFInfo
- Publication number
- CN111455044B CN111455044B CN202010525877.8A CN202010525877A CN111455044B CN 111455044 B CN111455044 B CN 111455044B CN 202010525877 A CN202010525877 A CN 202010525877A CN 111455044 B CN111455044 B CN 111455044B
- Authority
- CN
- China
- Prior art keywords
- mir
- pregnant
- mirna
- ewe
- exosome
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an exosome miRNA marker for diagnosing early pregnancy of a ewe and application thereof, wherein the exosome miRNA molecular marker comprises oar-miR-22-3p and chi-miR-378-3p, the miRNA molecular marker presents high expression in the serum exosome of the early pregnancy of the ewe, and when the serum exosome miRNA is used singly for diagnosing and distinguishing the early pregnancy from the non-pregnant ewe, the area under ROC curve (AUC) is respectively 0.891 (0.728,1.000) and 0.922 (0.791,1.000); when the combined diagnosis is used for distinguishing the early pregnant ewes from the non-pregnant ewes, the AUC (95% CI) of the combined diagnosis is 0.984 (0.936,1.000), so that the exosome miRNA molecular marker provided by the invention has high sensitivity and high specificity in the early pregnant ewe pregnancy diagnosis, and has excellent diagnosis performance by combining a plurality of miRNA markers.
Description
Technical Field
The invention belongs to the field of biotechnology diagnosis, and particularly relates to an exosome miRNA marker for pregnancy diagnosis of a ewe and application thereof.
Background
Exosomes (Exosomes) are vesicles of 30-100nm in size produced by cells and released into the extracellular environment, and are commonly found in fluids such as saliva, blood, urine and milk of animals. MicroRNAs (miRNA) is a short-chain non-coding RNA of about 19-2 nucleotides in length that exert regulatory effects by complementing part or all of the sequence within the 3' -UTR region of mRNA, resulting in inhibition of transcription of the target gene, thereby participating in embryonic development of the animal. The unique form of mirnas present in exosomes makes them ideal biomarkers. Research shows that Exosomes, which is a carrier form of extracellular miRNA, can protect the miRNA therein from degradation by ribonuclease, so that the miRNA is highly stably expressed in Exosomes. miRNAs in exosomes have unique effects of mediating intercellular communication, and can specifically inhibit the expression of target genes corresponding to the miRNAs in cells. The unique stability and spatiotemporal specificity of mirnas in body fluids in Exosomes makes them ideal new markers gradually into the human field of view.
The pregnancy diagnosis of ewes has been paid importance to enterprises all the time, because the accurate diagnosis of early pregnancy can not only reduce economic losses caused by nonpregnant ewes, but also facilitate timely grouping of pregnant ewes, reasonable feeding and management, and meanwhile, the method is beneficial to improving sheep breeding efficiency, promoting intensive livestock management and improving benefits. The sheep industry has been plagued by how to find non-pregnant ewes, to shorten the gestation interval and to reduce the non-productive days (NPD) by an effective and accurate diagnostic method.
The existing pregnancy diagnosis methods have respective defects, such as the influence of the experience degree of a user and the longer detection days on the ultrasonic diagnosis; depending on the estrus cycle and pregnancy symptom diagnosis of the ewe, wig phenomenon may occur; hormone assays present a certain risk. In view of the drawbacks of the above diagnostic methods, there is an urgent need to find a more simple and accurate pregnancy diagnostic method for production management.
At present, the research on the maternal miRNA of the pregnant female sheep in early gestation is less, the problems of low specificity, low sensitivity and low diagnostic value are commonly existed, and the research on the serum exosome miRNA as a pregnancy diagnostic molecular marker has important significance for the breeding industry.
Disclosure of Invention
Aiming at the technical problems of low specificity, low sensitivity and low diagnostic value of an exosome miRNA marker for diagnosing early pregnancy of a ewe in the prior art, the invention aims to provide the exosome miRNA marker for diagnosing early pregnancy of the ewe and application thereof.
The invention is realized by the following technical scheme:
the invention provides an exosome miRNA marker for diagnosing early pregnancy of a ewe, which is characterized in that a new generation high-throughput sequencing technology is adopted, a bioinformatics analysis method of a system is combined, 17-day mating pregnancy and non-pregnant ewe peripheral blood samples are collected, so that differential exosome miRNAs in the pregnant and non-pregnant ewe samples are screened, two exosome miRNAs in peripheral blood closely related to early pregnancy of the ewe, namely oar-miR-22-3p and chi-miR-378-3p, any one or more than two kinds of exosome miRNAs are selected, the expression is carried out in the pregnant and non-pregnant serum samples, and the Real-time PCR verification is carried out, so that the oar-miR-22-3p and chi-miR-378-3p provided by the invention are finally proved to be highly related to early pregnancy of the ewe, and can be used as markers for rapidly detecting early pregnancy of the ewe, and the serum exosome miRNA marker has good diagnosis index.
In the invention, RNA sequences of oar-miR-22-3p and chi-miR-378-3p are respectively shown as SEQ ID NO.1 and SEQ ID NO. 2:
SEQ ID NO.1：AAGCUGCCAGUUGAAGAACUG；
SEQ ID NO.2：ACUGGACUUGGAGUCAGAAGGC。
in the invention, the RNA sequences of the forward primers of oar-miR-22-3p and chi-miR-378-3p are respectively shown as SEQ ID NO.3 and SEQ ID NO. 4:
SEQ ID NO.3：CCGAAGCTGCCAGTTGAAGAACT；
SEQ ID NO.4：ACTGGACTTGGAGTCAGAAGGC。
the reverse primer was a universal downstream primer designed and synthesized by TIANGEN corporation and contained in the miScript SYBR Green PCR Kit kit of TIANGEN corporation.
In the invention, oar-U6 is adopted as an internal reference gene, wherein the sequence of the internal reference primer oar-U6-F, oar-U6-R is shown as SEQ ID NO.5 and SEQ ID NO. 6:
SEQ ID NO.5:CGCTTCGGCAGCACATATACTA；
SEQ ID NO.6：ATGGAACGCTTCACGAATTTGC。
meanwhile, the invention provides a detection kit for an exosome miRNA marker, which comprises the exosome miRNA marker for the early pregnancy diagnosis of the ewe and a reagent commonly used in a PCR technology, wherein the exosome miRNA marker is selected from any one or combination of oar-miR-22-3p and chi-miR-378-3 p.
Preferably, the detection reagent in the kit comprises 2X miRNA RT Reaction Buffer, miRNA RT Enzyme Mix, RNase-Free ddH 2 O, 2X miRcute Plus miRNAPreMix, reverse Primer, miRNA first strand cDNA, 50X ROX Reference Dye, 75% ethanol, serum exosome lysate, chloroform and absolute ethanol, and the detection reagent is used for detecting the expression level of oar-miR-22-3p and chi-miR-378-3 p.
Preferably, the specific primers in the kit are specific primers for detecting the expression levels of oar-miR-22-3p and chi-miR-378-3 p.
Preferably, the RNA sequence of the specific primer in the kit is shown as SEQ ID NO.3-SEQ ID NO. 4.
Preferably, the internal reference is oar-U6, and the RNA sequence of the internal reference is SEQ ID NO.5-SEQ ID NO.6.
Furthermore, the invention provides the application of any one or combination of the exosome miRNA markers oar-miR-22-3p and chi-miR-378-3p in preparing a ewe early pregnancy diagnosis kit, blood samples are collected in 17 days of ewe breeding, real-time PCR is adopted to detect the expression levels of oar-miR-22-3p and chi-miR-378-3p in serum, if obvious low expression can be detected, the ewe should be subjected to next artificial insemination breeding to achieve the purposes of shortening the interval of fetal time and reducing non-production days (NPD), so that the non-production days of the ewe can be effectively reduced, and the economic benefit of a sheep raising enterprise is improved.
The principle of the invention is as follows: the applicant finds that oar-miR-22-3p and chi-miR-378-3p which are highly expressed in the plasma exosome of the early pregnant ewe can be released into extracellular matrix after being fused with cell membrane through a multi-vesicle outer membrane by a multi-vesicle particle formed by invagination, so that the invention mainly analyzes the expression condition of mature bodies (shown as SEQ ID NO:1-SEQ ID NO: 2) of serum oar-miR-22-3p and chi-miR-378-3p of the early pregnant ewe, and finds that the serum oar-miR-22-3p and chi-miR-378-3p can be used as quick detection female sheep early pregnancy molecular markers for the first time and can be applied.
The beneficial effects obtained by the invention are as follows:
(1) Aiming at the early pregnancy diagnosis of the ewe, screening characteristic exosome molecules, and collecting peripheral blood samples of the pregnant and non-pregnant ewe after 17 days of mating, so as to screen and detect exosome miRNA differentially expressed in the pregnant and non-pregnant ewe samples, and finally obtaining miRNA of differential exosome related to the early pregnancy of the ewe, and obtaining two exosome miRNAs which are obviously different from the non-pregnant and the pregnant and are obviously increased after 17 days of the pregnancy, namely: oar-miR-22-3p and chi-miR-378-3p, so that it is proved that the two miRNAs can be used singly for diagnosing the early pregnancy of the ewe.
(2) The invention provides application of any one or combination of an exosome miRNA marker oar-miR-22-3p and chi-miR-378-3p in preparation of a ewe early pregnancy diagnosis kit, blood samples are collected on 17 days of ewe breeding, and Real-time PCR is adopted to detect the expression levels of oar-miR-22-3p and chi-miR-378-3p in serum, if the expression level is obviously low, the ewe should undergo the next artificial insemination breeding so as to achieve the purposes of shortening the interval of the embryo and reducing the non-production days (NPD), further effectively reducing the non-production days of the ewe and improving the economic benefit of sheep raising enterprises.
(3) In the two exosome miRNA markers disclosed by the invention, the expression amounts of miR-22-3P and miR-378-3P in pregnant and non-pregnant ewes are extremely obvious in 17 days of hybridization (P < 0.01).
(4) Of the two exosome miRNA markers disclosed by the invention, the AUC (95% CI) of oar-miR-22-3p of the pregnant ewe and the non-pregnant ewe is 0.891 (0.728,1.000) in 17 days of mating, and the AUC (95% CI) of oar-miR-378-3p of the pregnant ewe and the non-pregnant ewe is 0.922 (0.791,1.000) in 17 days of mating, so that the two exosome miRNA markers can be independently used for early female sheep pregnancy diagnosis and have higher diagnostic value.
(5) When miR-22-3p and miR-378-3p are combined, AUC (95% CI) of pregnant ewes and non-pregnant ewes is 0.984 (0.936,1.000) in 17 days of mating, and the specificity and sensitivity of the miRNA are higher than those of single serum exosome miRNA serving as a diagnosis model, so that the serum exosome miRNA has the highest value for early female sheep pregnancy diagnosis when being combined, and the combined diagnosis accuracy is higher.
Drawings
FIG. 1 is a secondary structure diagram of oar-miR-22-3p_oar-miR-22.
FIG. 2 is a secondary structure diagram of chi-miR-378-3p_chi-miR-378.
Fig. 3 is a graph of qPCR validation results for two miRNA high throughput sequencing sample data.
FIG. 4 is a ROC curve of oar-miR-22-3p alone diagnosed pregnant and non-pregnant ewes.
FIG. 5 is an ROC curve of chi-miR-378-3p alone for diagnosing pregnant and non-pregnant ewes.
Fig. 6 is a ROC curve of a combination diagnosis of two mirnas for pregnant and non-pregnant ewes.
Detailed Description
The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to fig. 1 to 6 of the embodiments of the present invention, and it is obvious that the described embodiments are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.
The instrument used in this example is as follows:
instrument: a low temperature centrifuge at 4℃ (MIKRO 220R,UNIVERSAL 320R, hettich scientific instruments, germany), a LightCycler96 Real-time PCR instrument (Roche Co.), a super clean bench (BJ-1 CD, shanghai Bolus medical biological instruments Co., ltd.), a conventional PCR instrument (Labcycler, germany SENSO Co.).
Embodiment one: screening test of exosome miRNA
In this embodiment, the exosome miRNA obtained by peripheral blood separation and purification is screened out by using a bioinformatic technology, and specific exosome miRNA related to early pregnancy of ewes is specifically obtained by the following steps:
s1, preparation of serum samples: collecting peripheral blood samples of pregnant and non-pregnant ewes after 17 days, adding coagulant into a blood collection tube (BD vacutainer: belliver Industrial Estate, plymouth, belliverway, roborough, PL67BP UK), slowly and reversely mixing the collected peripheral blood, centrifuging the mixed whole blood at 4 ℃ for 15min, wherein the upper yellow semitransparent liquid is serum to be collected, gradually sucking downwards against the liquid surface when sucking the serum, and cutting without sucking out cell components; the collected serum can be directly used for subsequent experiments or packaged for preservation in a refrigerator at the temperature of minus 80 ℃.
S2, extracting and checking exosome RNA: the experimental procedure was performed according to the procedure and requirements of the QIAGEN exoRNeasy Serum/Plasma StarterKit kit ((supplier: QIAGEN, cat. No.: 77144):
(1) Serum was pretreated using a 0.8 μm filter.
(2) The XBP buffer solution and the sample are uniformly mixed in equal volume and gently turned for 5-6 times.
(3) The mixture of step (2) was aspirated and added to exoEasy, and the waste liquid was discarded after centrifugation at 500g for 1min, and if the liquid remained in the column, the mixture was centrifuged again at 500g for 1min.
(4) 3.5ml XWP was added to the column and centrifuged at 5000g for 5min, after which the centrifuged liquid was poured off and the column was then placed in a fresh EP tube.
(5) The pipette added 700. Mu.l QIAzol to the center of the adsorption membrane, centrifuged at 5000g for 5min and the centrifuged lysate was collected, followed by transfer of the lysate to a 2ml enzyme-free EP tube.
(6) Vortex shaking the lysate of the previous step, and standing at room temperature of 15-25deg.C for 5min to promote dissociation of protein complex.
(7) Adding 90 μl chloroform into the above lysate, shaking with vortex for 15s, and standing at room temperature for 2-3min.
(8) Placed in a refrigerated centrifuge at 4℃for 15min at 12000g, the temperature of the centrifuge was then set to room temperature, and the subsequent steps were all centrifuged at room temperature.
(9) Transferring the upper liquid into a new collecting pipe, adding about 400 mu l of 100% ethanol with the volume of 2 times, repeatedly blowing and stirring to fully mix, adding ethanol to precipitate, and having no influence on subsequent experiments.
(10) Mu.l of the above sample was aspirated and transferred to a new 2ml adsorption column (RNeasy MinElute), centrifuged at 12000rpm for 15s at 15-25℃at room temperature, the waste liquid was discarded, and the remaining sample was repeated in this step (9).
(11) 700. Mu.l Buffer RWT was added to the RNeasy MinElute column, centrifuged at 12000rpm for 15s, and the waste liquid was discarded.
(12) Add 500. Mu.l RPE to the above column, 12000rpm,15s and discard the centrifuged liquid.
(13) The step (12) was repeated, the column was carefully removed, RNeasy MinElute was transferred to a fresh Eppendorf tube without touching the waste liquid to avoid ethanol contamination, and centrifugation was performed at full speed for 5min.
(14) The RNeasy MinElute column was placed in a fresh 1.5ml collection tube, 14. Mu.l RNase-free water was added to the center of the column membrane, allowed to stand for 1min followed by full speed 1min of RNA elution.
(15) After the RNA extraction, the concentration and purity of the RNA were measured by NanoDrop 2000, and the samples with higher quality of the measurement result were sent to beijing Kang Pusen company, and the samples for RNA detection were detected by Agilent 2100, and then the database construction method was selected according to the quality detection result, and the information table of pregnant ewes and non-pregnant ewes from which the samples were derived was shown in table 1.
Table 1: sample source pregnant ewe and non-pregnant ewe information table
The method comprises the steps of carrying out exosome Small RNA sequencing on a sequencing sample in table 1, wherein the Small RNA sequencing adopts high-throughput sequencing, the sequencing sample comprises 3 pairs of pregnant and non-pregnant 3 samples, 6 samples are added, the total number of sequencing sequences obtained by each sample is not less than one million, and all Small RNAs after sequencing analysis are statistically analyzed with different types of RNA comparison results and annotation results.
In this embodiment, by collecting the peripheral blood samples of the pregnant and non-pregnant ewes after 17 days of mating, the exosome mirnas differentially expressed in the pregnant and non-pregnant ewe samples are screened and detected, so as to obtain two exosome mirnas with extremely significant differences between non-pregnant and extremely significant elevation of the pregnant 17 days, and finally obtain the mirnas of the differential exosome related to the early pregnancy of the ewes, namely: oar-miR-22-3p and chi-miR-378-3p, so that it is proved that the two miRNAs can be used singly for diagnosing the early pregnancy of the ewe.
Embodiment two: alignment of exosome miRNA sequence information
Two miRNA sequence information obtained in the application are arranged through information retrieval disclosed by a miRBase database, and the two miRNA sequence information is shown in table 2.
Table 2: two miRNA sequence information
Through comparison, the sequence information of the two miRNAs is consistent with the sequencing data, so that the sequences of the oar-miR-22-3p and chi-miR-378-3p obtained by the method are proved to be correct.
Embodiment III: detection kit for exosome miRNA markers and application thereof
The embodiment provides a detection kit for an exosome miRNA marker, which comprises the exosome miRNA marker for early pregnancy diagnosis of a ewe and a reagent commonly used in PCR technology, wherein the exosome miRNA marker is one or two combinations of oar-miR-22-3p and chi-miR-378-3p miRNA markers.
Preferably, the detection reagent in the kit comprises 2X miRNA RT Reaction Buffer, miRNA RT Enzyme Mix, RNase-Free ddH 2 O, 2X miRcute Plus miRNAPreMix, reverse Primer, miRNA first strand cDNA, 50X ROX Reference Dye, 75% ethanol, serum exosome lysate, chloroform and absolute ethanol, and the detection reagent is used for detecting oar-miR-22-3p and chi-miR-378-3p expression levels.
Preferably, the specific primers in the kit are specific primers for detecting the expression levels of oar-miR-22-3p and chi-miR-378-3 p.
Preferably, the RNA sequence of the specific primer in the kit is shown as SEQ ID NO.4-SEQ ID NO.6.
The embodiment provides the application of any one or combination of the exosome miRNA markers oar-miR-22-3p and chi-miR-378-3p in preparing a ewe early pregnancy diagnosis kit, blood samples are collected in 17 days of ewe breeding, real-time PCR is adopted to detect the expression levels of oar-miR-22-3p and chi-miR-378-3p in serum, if obvious low expression can be detected, the ewe should undergo the next artificial insemination breeding so as to achieve the purposes of shortening the interval of the embryo and reducing the non-production days (NPD), further effectively reducing the non-production days of the ewe and improving the economic benefit of a sheep raising enterprise.
Embodiment four: effect verification test of two exosome miRNA markers for early pregnancy diagnosis of ewe
(1) Differential expression data analysis of two miRNAs
In this embodiment, reverse transcription tests are performed on two mirnas obtained in the present application, and specific forward primers (Shanghai chemical synthesis) are designed and synthesized for the two mirnas, and specific steps are as follows:
s1, cDNA synthesis:
the kit used for reverse transcription was the TIANGEN miRcute Plus miRNA First-Strand cDNAKit kit (TIANGEN Co., product number: KR 211), which was thawed at first 2X miRNA RT Reaction Buffer and mixed well, miRNA RT Enzyme Mix was put in ice for use, the following reagents were added to a reaction tube pre-chilled RNase Free on ice to a total volume of 20. Mu.l, and miRNA RT Enzyme Mix was finally added.
8ul RNA is taken and is carried out based on miRcute Plus miRNA First-Strand cDNA Kit reverse transcription Kit, 10ul 2× miRNA RT Reaction Buffer and 2ul miRNA RT Enzyme Mix are added, no enzyme water is added to a 20ul total system, a 60min miRNA adding A tail reaction and reverse transcription reaction are carried out at 42 ℃, and after the reaction is finished, each miRNA needs to have a specific forward primer, so that specific forward primer sequences (Shanghai chemical synthesis) are respectively set and synthesized for two miRNAs, the specific forward primer sequences of the two miRNAs are shown in table 3, and the reverse transcription reaction of each miRNA is required to be independently carried out.
S2, performing Real-time PCR reaction on the cDNA product:
the reaction was carried out according to TIANGEN miRcute Plus miRNA qPCR Kit (SYBR Green) kit (TIANGEN Co., ltd., commercial number: FP 411) using oar-U6 as an internal reference primer (Shanghai chemical synthesis), wherein the internal reference primer sequence was as shown in SEQ ID No.7-SEQ ID No.8, 3 multiplex wells were prepared for all reactions, 10ul 2X miRcute Plus miRNAPreMix (SYBR & ROX), 0.4ul of each of the upstream and downstream primers, 2ul of template sample, and 7.2ul of sterilized water, 20ul of the total reaction system, and the PCR reaction conditions were set according to the two-step method. After the reaction is finished, the relative expression value of the target gene in the template is obtained according to a formula and according to a melting curve and a Ct value, and then analysis is carried out. 95 ℃ for 15min;95 ℃ for 20s; and (3) after the cycle of 62 ℃,34s and 45 times, collecting fluorescence at the end point, and obtaining the expression quantity of each miRNA in different samples through the reaction so as to carry out subsequent analysis.
In this example, the reverse primer is a universal primer sequence provided by TIANGEN, the specific forward primer sequences of the two miRNAs are shown in Table 3, SEQ ID NO.3 and SEQ ID NO.4 in the sequences shown in Table 3 are the core sequences of the forward primer sequences of miR-22-3p and miR-378-3p, respectively, and SEQ ID NO.5 and SEQ ID NO.6 in Table 4 are the core primer sequences of the internal references of ssc-U6-F, ssc-U6-R, respectively.
Table 3: specific forward primer sequences of two miRNAs
| MicroRNA | List name | Primer sequences |
| oar-miR-22-3p | SEQ ID NO.3 | CCGAAGCTGCCAGTTGAAGAACT |
| chi-miR-378-3p | SEQ ID NO.4 | ACTGGACTTGGAGTCAGAAGGC |
Table 4: internal reference primer sequences
| MicroRNA | Sequence(s)Table name | Primer sequences |
| oar-U6-F | SEQ ID NO.5 | CGCTTCGGCAGCACATATACTA |
| oar-U6-R | SEQ ID NO.6 | ATGGAACGCTTCACGAATTTGC |
S3, data analysis:
in the step, real-timePCR detects the relative expression level of miRNA, micronuclear RNAU6 is used as an internal reference gene, the fold change calculation method is 2-delta Ct, and the result shows that oar-miR-22-3P and chi-miR-378-3P have extremely significant differences (P < 0.01). The change of oar-miR-22-3p and chi-miR-378-3p differential expression (fold) is 3.130 and 3.179 respectively, and the result is consistent with the detection result of a sequencing technology, which shows that the detection result of the sequencing technology is reliable.
Secondly, the analysis result is represented by a histogram by utilizing Graphpadprism7 software, when P is smaller than 0.05, the significant difference exists, the difference of the expression levels of miR-22-3P and miR-378-3P in the serum exosomes of pregnant and non-pregnant ewes on the 17 th day of hybridization is shown in fig. 3, and the analysis of fig. 3 shows that the expression levels of oar-miR-22-3P and chi-miR-378-3P in pregnant ewes and non-pregnant ewes are extremely significant.
(2) ROC curve and area under curve AUC data analysis of two miRNAs
In the art, the area values below the ROC curve represent the predicted accuracy case, which is referred to as AUC value. Clearly, a larger AUC means a higher prediction accuracy, whereas a lower prediction accuracy is indicated. The AUC values are between 0 and 1, and the determination of the AUC values is described as follows: AUC <0.5: the method is not in line with the actual situation, the predictive diagnosis is worse than the randomness guess, and the actual situation should not appear; auc=0.5: the method has the advantages that the method has no prediction diagnosis value, and the prediction accuracy is the same as the guessing effect; 0.5< auc <0.7: predictive diagnostics are of low value, which is relatively common; 0.7< = AUC <0.9: the method has a certain predictive diagnosis value and has great practicability for actual diagnosis; AUC > =0.9: the prediction has high diagnostic value, and the situation is better but unusual; auc=1, which is a perfect prediction with no flaws, in most cases no perfect prediction diagnosis at all.
From the above examples, serum exosomes oar-miR-22-3P and chi-miR-378-3P were statistically significant (P < 0.05) in comparison between pregnant ewes and non-pregnant ewes at 17 days of breeding, and were evaluated using ROC curves and area under the curves AUC, with ROC curve analysis of both indices combined with binary logistic regression.
The diagnostic value of two miRNAs in the invention is judged and verified by the ROC curve and the area under the curve AUC data, and the specific steps are as follows:
firstly, two candidate miRNAs are expressed in an enlarged sample by Real-time PCR analysis, 8 pregnant samples and 8 non-pregnant samples are expressed and analyzed in a pregnant ewe and non-pregnant control group on 17 days of mating, and the final result is 2 -ΔΔCt Analysis, statistical analysis was performed using SPSS26 software, the statistical method was paired t-test, the statistical method between pregnant and non-pregnant samples was Mann-Whitney test, the data showed mean ± standard deviation, and the results are shown in fig. 4-6.
From the analysis of FIG. 4, the AUC (95% CI) of oar-miR-22-3p pregnant and non-pregnant ewes at 17 days of mating is 0.891 (0.728,1.000), and therefore, the oar-miR-22-3p exosome miRNA alone has higher diagnostic value in early pregnancy diagnosis of the ewes.
From the analysis of FIG. 5, it can be seen that the AUC (95% CI) of the chi-miR-378-3p pregnant ewe and the non-pregnant ewe is 0.922 (0.791,1.000) in 17 days of mating, and the chi-miR-378-3p exosome miRNA alone has higher diagnostic value in early female sheep pregnancy diagnosis.
As can be seen from the analysis of fig. 6, when two mirnas are combined, AUC (95% ci) of pregnant ewes and non-pregnant ewes at 17 days of mating is 0.984 (0.936,1.000), which is higher than the specificity and sensitivity of a single serum exosome miRNA as a diagnostic model, indicating that the value of the serum exosome miRNA for early pregnancy diagnosis of the ewes is highest when the serum exosome miRNA is combined, and the diagnostic accuracy after the serum exosome miRNA is combined is higher.
In conclusion, oar-miR-22-3p and chi-miR-378-3p are further verified in more samples by Real-time PCR in peripheral blood exosomes of ewes, and oar-miR-22-3p and chi-miR-378-3p have remarkable differences in maternal serum of pregnant ewes and non-maternal serum of the maternal, so that any one or combination of oar-miR-22-3p and chi-miR-378-3p can be used as a molecular marker for noninvasively detecting the early pregnancy of the ewes when the technical field of rapid detection of the early pregnancy of the ewes.
While the invention has been described in detail in the foregoing general description and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that modifications and improvements can be made thereto. Accordingly, such modifications or improvements may be made without departing from the spirit of the invention and are intended to be within the scope of the invention as claimed.
Sequence listing
<110> Xinjiang national academy of agricultural reclamation
SHIHEZI University
<120> exosome miRNA marker for diagnosing early pregnancy of ewe and application thereof
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> RNA
<213> oar-miR-22-3p
<400> 1
aagcugccag uugaagaacu g 21
<210> 2
<211> 22
<212> RNA
<213> chi-miR-378-3p
<400> 2
acuggacuug gagucagaag gc 22
<210> 3
<211> 23
<212> DNA/RNA
<213> oar-miR-22-3p forward primer (Artificial sequence)
<400> 3
ccgaagctgc cagttgaaga act 23
<210> 4
<211> 22
<212> DNA/RNA
<213> chi-miR-378-3 Forward primer (Artificial sequence)
<400> 4
actggacttg gagtcagaag gc 22
<210> 5
<211> 22
<212> DNA/RNA
<213> inner reference primer oar-U6-F (Artificial sequence)
<400> 5
cgcttcggca gcacatatac ta 22
<210> 6
<211> 22
<212> DNA/RNA
<213> inner reference primer oar-U6-R (Artificial sequence)
<400> 6
atggaacgct tcacgaattt gc 22
Claims (1)
1. The application of the exosome miRNA marker in preparing the early pregnancy diagnosis kit for the ewes is characterized in that the exosome miRNA marker is selected from any one or combination of oar-miR-22-3p and chi-miR-378-3p, and the sequences of oar-miR-22-3p and chi-miR-378-3p are respectively shown as SEQ ID NO.1 and SEQ ID NO. 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010525877.8A CN111455044B (en) | 2020-06-10 | 2020-06-10 | Exosome miRNA marker for early pregnancy diagnosis of ewes and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010525877.8A CN111455044B (en) | 2020-06-10 | 2020-06-10 | Exosome miRNA marker for early pregnancy diagnosis of ewes and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111455044A CN111455044A (en) | 2020-07-28 |
| CN111455044B true CN111455044B (en) | 2023-05-23 |
Family
ID=71674837
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010525877.8A Active CN111455044B (en) | 2020-06-10 | 2020-06-10 | Exosome miRNA marker for early pregnancy diagnosis of ewes and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111455044B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113311166B (en) * | 2021-04-28 | 2022-10-28 | 新疆农垦科学院 | Protein biomarker for diagnosing early pregnancy of sheep and method for detecting early pregnancy of sheep |
| CN113308533B (en) * | 2021-05-31 | 2023-10-24 | 东莞市人民医院 | Placenta exosome miRNA expression analysis method for gestational diabetes patient |
| CN114622009A (en) * | 2022-02-28 | 2022-06-14 | 广州天源高新科技有限公司 | miRNA molecular marker for early diagnosis of gestational diabetes and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011007815A1 (en) * | 2009-07-14 | 2011-01-20 | 森永乳業株式会社 | Method for screening feed enabling the production of milk having immunomodulating effect |
| CN104388561A (en) * | 2014-11-14 | 2015-03-04 | 浙江理工大学 | Liver cancer biomarkers and application thereof |
| WO2017037477A1 (en) * | 2015-09-04 | 2017-03-09 | The University Of Sussex | Sepsis biological marker |
| WO2018089894A1 (en) * | 2016-11-11 | 2018-05-17 | University Of Tennessee Research Foundation | Biomarkers for early embryonic viability and methods thereof |
| WO2020115270A2 (en) * | 2018-12-06 | 2020-06-11 | Erber Aktiengesellschaft | Biomarker |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20190038769A1 (en) * | 2010-12-01 | 2019-02-07 | Gowey Research Group, Pllc | Micro-rna profiling, compositions, and methods of treating diseases |
| US8541187B2 (en) * | 2011-03-01 | 2013-09-24 | Bio Tracking, LLC | Systems and methods for detecting animal pregnancy |
-
2020
- 2020-06-10 CN CN202010525877.8A patent/CN111455044B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011007815A1 (en) * | 2009-07-14 | 2011-01-20 | 森永乳業株式会社 | Method for screening feed enabling the production of milk having immunomodulating effect |
| EP2455486A1 (en) * | 2009-07-14 | 2012-05-23 | Morinaga Milk Industry Co., Ltd. | Method for screening for diet providing production of milk having immunoregulatory action |
| CN104388561A (en) * | 2014-11-14 | 2015-03-04 | 浙江理工大学 | Liver cancer biomarkers and application thereof |
| WO2017037477A1 (en) * | 2015-09-04 | 2017-03-09 | The University Of Sussex | Sepsis biological marker |
| WO2018089894A1 (en) * | 2016-11-11 | 2018-05-17 | University Of Tennessee Research Foundation | Biomarkers for early embryonic viability and methods thereof |
| CN110546260A (en) * | 2016-11-11 | 2019-12-06 | 田纳西大学研究基金会 | Biomarkers for early embryo viability and methods thereof |
| WO2020115270A2 (en) * | 2018-12-06 | 2020-06-11 | Erber Aktiengesellschaft | Biomarker |
Non-Patent Citations (3)
| Title |
|---|
| Bart Krist等.The Role of miR-378a in Metabolism, Angiogenesis, and Muscle Biology.International Journal of Endocrinology.2015,第281756页. * |
| Olanrewaju B. Morenikeji等.SNP Diversity in CD14 Gene Promoter Suggests Adaptation Footprints in Trypanosome Tolerant N’Dama (Bos taurus) but not in Susceptible White Fulani (Bos indicus) Cattle.Genes.2020,第11卷(第1期),第112页. * |
| 苗艳平等.吐鲁番黑羊黄体期和卵泡期卵巢microRNA差异表达分析.农业生物技术学报.2018,第26卷(第4期),第660-669页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111455044A (en) | 2020-07-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111455044B (en) | Exosome miRNA marker for early pregnancy diagnosis of ewes and application thereof | |
| CN109504784B (en) | MiRNA molecular marker for predicting early embryo quality in human assisted reproduction technology and application thereof | |
| CN111778326B (en) | Gene marker combination for endometrial receptivity assessment and application thereof | |
| CN111020026A (en) | Specific primer probe combination and application thereof in detection of folate metabolism capability gene by combining blood direct amplification with fluorescence PCR (polymerase chain reaction) method | |
| CN116287173A (en) | Application of sex tags, primers and kit of high-body Seriola exosome microRNAs | |
| CN112609003A (en) | Composition and kit for identifying benign and malignant thyroid nodules and application of composition and kit | |
| CN116004849A (en) | Exosome miRNA marker for early pregnancy diagnosis of sow and application thereof | |
| CN109913458B (en) | circRNA and application thereof in detecting hypoxic-ischemic brain injury | |
| CN109536502B (en) | PCR (polymerase chain reaction) internal reference applicable to plasma exosome miRNA of patient with gestational trophoblastic tumor | |
| CN111378742A (en) | MicroRNA biomarker and application thereof in preparation of autoimmune disease detection kit | |
| CN113755571B (en) | Biomarker for embryo implantation success rate detection and application | |
| CN113755570B (en) | Biomarker for predicting recurrent abortion caused by unknown reasons and application thereof | |
| CN111560429B (en) | Application of circRNA marker for diagnosing thalassemia | |
| CN110951857B (en) | Method and kit for noninvasively detecting fetal trisomy 21, 18 and 13 syndrome based on digital PCR (polymerase chain reaction) | |
| CN114410795A (en) | Liver cancer early detection based on miRNA (micro ribonucleic acid) feature marker | |
| CN108728528B (en) | Fluorescent quantitative PCR one-step kit for detecting specific gene of renal tubular epithelial cell based on Taqman probe | |
| CN109112194B (en) | Application of cynoglossus semilaevis sex label piR-mmu-72274 | |
| CN108546752B (en) | MiRNA marker or combination thereof for detecting and/or predicting human megaterium and application thereof | |
| CN112899358A (en) | Noninvasive prenatal fetal chromosome aneuploidy detection method and kit thereof | |
| CN109628585A (en) | Application of the non-coding RNA in diagnosis of sepsis disease | |
| CN116987791B (en) | Application of plasma markers in identification of benign and malignant thyroid nodule | |
| CN116515979B (en) | Application of sex tags, primers and kit for high-body Seriola serum exosome piRNAs | |
| EP4183888A1 (en) | Mirna signature for identification of the receptive endometrium | |
| CN109750043B (en) | LncRNA-containing systemic lupus erythematosus detection reagent and application thereof | |
| CN117737254A (en) | Biomarker for predicting or diagnosing early pregnancy of sow and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |