CN113862369A

CN113862369A - Marker related to sensitivity of lung adenocarcinoma to platinum-containing dual-drug chemotherapy and application thereof

Info

Publication number: CN113862369A
Application number: CN202111369767.8A
Authority: CN
Inventors: 杨承刚; 王丹; 范冰燕; 郭静; 李雨晨
Original assignee: Qingdao Yangshen Biomedical Co Ltd
Current assignee: Qingdao Yangshen Biomedical Co Ltd
Priority date: 2021-11-16
Filing date: 2021-11-16
Publication date: 2021-12-31

Abstract

The invention discloses a marker related to sensitivity of lung adenocarcinoma to platinum-containing double-drug chemotherapy and application thereof, wherein the marker comprises miR-3202, miR-3663-3p and/or miR-449a, and the marker has higher diagnostic efficacy when being used for predicting sensitivity of lung adenocarcinoma to platinum-containing double-drug chemotherapy through experiments.

Description

Marker related to sensitivity of lung adenocarcinoma to platinum-containing dual-drug chemotherapy and application thereof

Technical Field

The invention belongs to the technical field of biomedicine, and particularly relates to a marker related to sensitivity of lung adenocarcinoma to platinum-containing double-drug chemotherapy and application thereof.

Background

Lung cancer (Lung cancer) is the most common malignancy with the highest incidence and mortality worldwide, among which Non-small cell Lung cancer (Non-small cell Lung cancer, NSCLC) accounts for 80%, while Lung adenocarcinoma (Lung adenocarinoma) is the major histological type of NSCLC (Ji P, Diedirichs S, Wang W, et al MALAT-1, alpha novel Non-coding RNA, and thymosin beta 4 precursor tumor and subvalin early-stage-small cell Lung cancer [ J ]. Oncogene,2003,22(39): 8031-8041.). Although The related research and clinical trials on lung cancer are rapidly progressed, The prognosis of lung cancer is still poor, 80-85% of patients are diagnosed in middle and advanced stages, and The 5-year survival rate is less than 15% (Bailey-Wilson J E, Amos C I, Pinney S M, et al. A major lung cancer survival probability loci maps to chromosome 6q 23-25 [ J ]. The American Journal of Human Genetics,2004,75(3):460 plus 474.), therefore, in order to achieve early diagnosis and accurate and individual treatment of lung cancer patients, a new biomarker and an action target point need to be screened, The action mechanism of lung cancer development is researched, and The survival rate of The lung cancer patients is improved.

miRNA is a non-coding single-stranded RNA with a length of 19-22 nucleotides. They act by silencing mRNA, thereby regulating gene expression at the post-transcriptional level. The synthesis of miRNA is that pre-miRNA is firstly transcribed from miRNA coding gene, and then pri-miRNA is cut into hairpin pre-miRNA with length of about 80bp by RNase III family member Drosha, and the pre-miRNA is also miRNA precursor. Finally, pre-miRNA is processed in the cytoplasm to double stranded RNA by RNase iii family member Dicer. One of them is combined with an RNA-silencing complex (RISC) to form a RISC-miRNA complex, and then is combined again to the 3' UTR of mRNA of a target gene to regulate a target. With the recent gradual popularization and deepening of bioinformatics in the field of miRNA, scientists apply bioinformatics software to analyze the mechanism of miRNA, and show that a plurality of miRNA regulation targets are located on tumor regulation factors or pathways closely related to cell canceration, which has important significance for the research of tumor etiology. However, the current analysis of lung adenocarcinoma is mostly limited to the prediction of target genes.

At present, the conventional methods for treating lung adenocarcinoma comprise operation treatment, platinum-containing dual-drug chemotherapy, radiotherapy, targeted therapy and the like, wherein, platinum-containing double-drug chemotherapy is concerned as a treatment scheme of advanced lung adenocarcinoma, and is a treatment scheme which is widely applied to patients with advanced lung adenocarcinoma clinically, the platinum-containing double-drug chemotherapy refers to the combined application of platinum-type chemotherapeutic drugs (carboplatin and cisplatin) and other non-platinum single drugs (paclitaxel, gemcitabine and vinorelbine), however, it is still difficult to predict which lung adenocarcinoma patients will be sensitive to platinum-containing dual-drug chemotherapy treatment regimens, and predicting the sensitivity or responsiveness of lung adenocarcinoma patients to platinum-containing dual-drug chemotherapy remains a significant challenge, therefore, the biomarker which can be used for accurately predicting the sensitivity of the lung adenocarcinoma to the platinum-containing dual-drug chemotherapy is found, and the application of the compound in the screening of lung adenocarcinoma patients before chemotherapy is of great significance to the field.

Disclosure of Invention

In order to overcome the technical problems existing in the prior art, the invention aims to provide a marker related to sensitivity of lung adenocarcinoma to platinum-containing dual-drug chemotherapy and application thereof.

In order to achieve the purpose, the invention adopts the following technical scheme:

the invention provides application of a reagent for detecting the expression level of miRNA markers in a sample in preparing a product for predicting sensitivity or responsiveness of lung adenocarcinoma to platinum-containing dual-drug chemotherapy.

Further, the miRNA markers are miR-3202, miR-3663-3p and miR-449 a.

The sequence of the miR-3202 is shown as SEQ ID NO 1;

UGGAAGGGAGAAGAGCUUUAAU(SEQ ID NO:1)

the sequence of the miR-3663-3p is shown as SEQ ID NO. 2;

UGAGCACCACACAGGCCGGGCGC(SEQ ID NO:2)

the sequence of the miR-449a is shown in SEQ ID NO 3;

UGGCAGUGUAUUGUUAGCUGGU(SEQ ID NO:3)

further, the miRNA markers are miRNA of human source (hsa) of miR-3202, miR-3663-3p and/or miR-449 a.

Further, the agent is selected from:

a probe that specifically recognizes the miRNA marker; or

A primer that specifically amplifies the miRNA marker.

Further, the platinum-containing dual-drug chemotherapy treatment regimen comprises carboplatin + paclitaxel, cisplatin + gemcitabine, cisplatin + vinorelbine, carboplatin + gemcitabine.

Further, the product comprises a reagent for detecting the expression level of the miRNA marker in the sample by a high-throughput sequencing method, real-time quantitative PCR, RT-PCR, in-situ hybridization and a chip.

Furthermore, the high-throughput sequencing method comprises first-generation sequencing, second-generation sequencing and third-generation sequencing, wherein the first-generation sequencing is also called Sanger sequencing and is a sequencing technology utilizing DNA polymerase synthesis reaction, and the first-generation sequencing is a sequencing technology based on the Sanger method; the second generation sequencing is based on massively parallel sequencing technology (MPS), and can simultaneously complete the synthesis of a complementary strand of a sequencing template and the acquisition of sequence data; the third generation sequencing is based on single molecule sequencing and massively parallel sequencing technology.

Further, the real-time quantitative PCR as referred to in the present invention refers to a real-time quantitative polymerase chain reaction, PCR generally employs a plurality of cycles of denaturation, annealing of primer pairs to opposite strands, and primer extension to exponentially increase the copy number of a target nucleic acid sequence; RT-PCR, which is referred to herein as reverse transcription-polymerase chain reaction, uses reverse transcriptase to prepare complementary DNA (cDNA) from mRNA, and the cDNA is then amplified by PCR to produce multiple copies of the DNA.

Further, the in situ hybridization in the present invention refers to a process of hybridizing specifically labeled nucleic acids with known sequences as probes with nucleic acids in cells or tissue sections, thereby performing accurate quantitative localization of specific nucleic acid sequences, and the in situ hybridization can be performed on cell samples or tissue samples.

Further, the chip detection in the present invention refers to gene chip detection, also called DNA chip detection or biochip detection, which refers to fixing a large number of probe molecules on a support, hybridizing with a labeled sample, and analyzing the sequence and number of target molecules by detecting the intensity and distribution of hybridization signals.

Further, the sample is derived from blood or tissue of the subject.

In a second aspect of the invention, there is provided a product for predicting the sensitivity or responsiveness of a patient with lung adenocarcinoma to platinum-containing dual drug chemotherapy.

Further, the product comprises a reagent for detecting the expression level of miRNA markers in the sample, wherein the miRNA markers are miR-3202, miR-3663-3p and/or miR-449 a.

Further, the agent is selected from:

a probe that specifically recognizes the miRNA marker; or

A primer that specifically amplifies the miRNA marker.

Further, the product comprises a kit, a chip or test paper.

Further, the primers contained in the kit for specifically amplifying the miRNA marker may be prepared by chemical synthesis, appropriately designed with reference to known information by using a method well known to those skilled in the art, and prepared by chemical synthesis.

In certain embodiments, the kit is marketed, distributed or sold as a unit for performing the methods of the invention. Such kits may comprise carrier means compartmentalized to receive, in close confinement, one or more container means (e.g., vials, tubes, etc.), each container means comprising one of the separate components to be used in the method. For example, one of the container means may comprise a probe that carries or can carry a detectable label. Such probes may be polynucleotides specific for polynucleotides of one or more genes comprising gene expression characteristics. Where the kit utilizes nucleic acid hybridization to detect a target nucleic acid, the kit can also have a container containing one or more nucleic acids for amplifying the target nucleic acid sequence and/or a container containing a reporter means.

Further, the kit will generally comprise the above-described container and one or more additional containers containing commercially and user-desired materials, including buffers, diluents, filters, needles, syringes, and package inserts containing instructions for use. A label may be present on the container to indicate the particular application of the composition, and may also indicate the direction of in vivo or in vitro use, such as those described above. Other optional components of the kit include one or more buffers (e.g., blocking buffer, wash buffer, substrate buffer, etc.), other reagents (e.g., substrate chemically altered by enzymatic labeling), epitope retrieval solutions, control samples (positive and/or negative controls), control sections, and the like.

In a third aspect of the invention, a pharmaceutical composition for increasing the sensitivity or responsiveness of a patient with lung adenocarcinoma to platinum-containing dual-drug chemotherapy is provided.

Further, the pharmaceutical composition comprises an agent for increasing the expression level of miR-3202, an agent for increasing the expression level of miR-3663-3p, and/or an agent for reducing the expression level of miR-449 a.

Further, the pharmaceutical composition also comprises a pharmaceutically acceptable carrier and/or an auxiliary material.

Furthermore, the pharmaceutical composition of the present invention can be prepared into various dosage forms according to requirements. Including but not limited to: tablets, solutions, granules, patches, ointments, capsules, aerosols or suppositories for transdermal, mucosal, nasal, buccal, sublingual or oral use.

Further, the route of administration of the pharmaceutical composition of the present invention is not limited, including but not limited to: intravenous, intraperitoneal, intraocular, intraarterial, intrapulmonary, oral, intravesicular, intramuscular, intratracheal, subcutaneous, transdermal, pleural, topical, inhalation, transmucosal, cutaneous, gastrointestinal, intraarticular, intraventricular, rectal, vaginal, intracranial, intraurethral, intrahepatic, intratumoral. In some cases, the administration may be systemic. In some cases topical administration.

Further, the dosage of the pharmaceutical composition of the present invention is not limited as long as the desired effect is obtained, and may be appropriately determined depending on the symptoms, sex, age, and the like.

The fourth aspect of the invention provides application of miRNA markers miR-3202, miR-3663-3p and/or miR-449a in construction of a calculation model or a system embedded with the calculation model for predicting sensitivity or reactivity of a lung adenocarcinoma patient to platinum-containing dual-drug chemotherapy.

Further, the calculation model takes the expression levels of miRNA markers miR-3202, miR-3663-3p and/or miR-449a as input variables, and carries out operation through a bioinformatics method to output the sensitivity or reactivity of the lung adenocarcinoma patient to platinum-containing double-drug chemotherapy.

A fifth aspect of the invention provides a system or apparatus for predicting the sensitivity or responsiveness of a patient with lung adenocarcinoma to platinum-containing dual-drug chemotherapy;

further, the system or apparatus comprises:

(1) an evaluation device: comprises a control unit and a storage unit, and is used for predicting and evaluating the sensitivity or the responsiveness of a lung adenocarcinoma patient to platinum-containing dual-drug chemotherapy;

(2) information communication terminal apparatuses communicatively connected to each other: for providing data on the expression level of the miRNA markers miR-3202, miR-3663-3p, and/or miR-449a in a sample from a patient with lung adenocarcinoma;

the control unit of the evaluation device comprises the following four units:

1) a data receiving unit: for receiving data transmitted from the information communication terminal device regarding the expression level of the miRNA marker in a sample from a lung adenocarcinoma patient;

2) a discrimination value calculation unit: which calculates a discrimination value based on discrimination of the expression level of the miRNA marker received by the data receiving unit and the expression level of the miRNA marker stored in the storage unit as an explanatory variable;

3) discrimination value criterion evaluation unit: evaluating the sensitivity or reactivity of the lung adenocarcinoma patient to platinum-containing dual-drug chemotherapy based on the discrimination value calculated by the discrimination value calculation unit;

4) an evaluation result transmitting unit: which transmits the result of the predictive evaluation of the lung adenocarcinoma patient obtained by the discrimination value criterion evaluation unit to the information communication terminal device.

In order to further clarify the content of the present invention, some of the scientific terms referred to in the present invention are explained as follows.

In the context of the present invention, the term "miRNA marker", as well as "marker", "biomarker", refers to an indicator of a patient's phenotype, in particular embodiments of the present invention, to a marker that is differentially expressed between lung adenocarcinoma patients (responders) sensitive or responsive to platinum-containing dual drug chemotherapy and lung adenocarcinoma patients (non-responders) non-sensitive or responsive to platinum-containing dual drug chemotherapy, including, but not limited to: genes, proteins, small molecule metabolites, carbohydrates, glycolipid-based molecules, etc., preferably, the marker is a miRNA.

In the context of the present invention, the term "expression level", as well as "expression level of a miRNA marker" or "expression level of a biomarker", refers to the expression level of a miRNA according to the present invention in a sample.

In the context of the present invention, the term "sample", as well as "sample", "subject sample", "sample of a lung adenocarcinoma patient", refers to a composition obtained or derived from a subject of interest (lung adenocarcinoma patient) comprising cellular entities and/or other molecular entities to be characterized and/or identified, e.g. on the basis of physical, biochemical, chemical and/or physiological characteristics. The sample may be obtained from blood of a subject (lung adenocarcinoma patient) and other fluid samples of biological origin and tissue samples, such as biopsy tissue samples or tissue cultures or cells derived therefrom. The source of the tissue sample may be solid tissue, such as from a fresh, frozen and/or preserved organ or tissue sample, biopsy tissue or aspirate; blood or any blood component; a body fluid; cells from any time of pregnancy or development of the individual; or plasma. The term "sample" includes a biological sample that has been treated in any way after it has been obtained, e.g., by treatment with a reagent, stabilization, or enrichment for certain components (e.g., proteins or polynucleotides), or embedded in a semi-solid or solid matrix for sectioning purposes. Samples described in the present invention include, but are not limited to: tissue, whole blood, blood-derived cells, serum, plasma, lymph, synovial fluid, cell extracts and combinations thereof, preferably, the sample is a tissue.

In the context of the present invention, the term "primer", as well as "amplification primer", refers to a nucleic acid fragment comprising 5-100 nucleotides, preferably said primer or amplification primer comprises 15-30 nucleotides capable of initiating an enzymatic reaction (e.g., an enzymatic amplification reaction).

In the context of the present invention, the term "probe" refers to a nucleic acid sequence comprising at least 5 nucleotides, e.g.comprising 5 to 100 nucleotides, which probe is capable of hybridizing under the specified conditions with the expression product of the target gene or with the amplification product of this expression product to form a complex. The hybridization probes may also include labels for detection. Such labels include, but are not limited to, labels for fluorescent quantitative PCR or fluorescent in situ hybridization.

In the context of the present invention, the term "area under the working characteristic curve (AUC) of a subject" is an indicator of the performance or accuracy of a diagnostic procedure. The accuracy of a diagnostic method is best described by its Receiver Operating Characteristics (ROC). ROC plots are line graphs of all sensitivity/specificity pairs derived from continuously varying decision thresholds across the entire data range observed. In a specific embodiment of the present invention, the diagnostic efficacy of the miRNA marker of the present invention for predicting the sensitivity or reactivity of a patient with lung adenocarcinoma to platinum-containing dual-drug chemotherapy can be evaluated according to the area under the working characteristic curve (AUC) of the subject, wherein if the AUC > 0.6, it indicates that the miRNA marker has a certain diagnostic efficacy, and the miRNA marker can be used as a marker for predicting the sensitivity or reactivity of a patient with lung adenocarcinoma to platinum-containing dual-drug chemotherapy; if the AUC is greater than 0.7, the miRNA marker has relatively good diagnostic efficacy and can be used as a marker for predicting the sensitivity or the reactivity of a lung adenocarcinoma patient to platinum-containing dual-drug chemotherapy; if the AUC is greater than 0.8, the miRNA marker has better diagnostic efficacy and can be used as a marker for predicting the sensitivity or the responsiveness of a lung adenocarcinoma patient to platinum-containing dual-drug chemotherapy.

In the context of the present invention, the term "responsive" refers to a patient/subject having, suspected of having, or predisposed to having lung adenocarcinoma showing a response to a platinum-containing dual-drug chemotherapeutic treatment regimen. The skilled person will readily determine whether a patient/subject undergoing platinum-containing dual drug chemotherapy will show a response in accordance with the methods described herein.

In the context of the present invention, the term "sensitive" refers to a patient/subject having, suspected of having, or predisposed to having lung adenocarcinoma that shows a positive response to a platinum-containing dual-drug chemotherapeutic treatment regimen in some way. One skilled in the art will readily determine whether a patient/subject undergoing a platinum-containing dual-drug chemotherapy regimen will exhibit a response in accordance with the methods described herein.

Compared with the prior art, the invention has the advantages and beneficial effects that:

the invention discovers for the first time that the combination of genes miR-3202, miR-3663-3p and/or miR-449a can be used for predicting the sensitivity or reactivity of a patient suffering from lung adenocarcinoma to platinum-containing double-drug chemotherapy, has high accuracy, sensitivity, specificity and AUC value, can assist a clinician in judging the sensitivity or reactivity of a subject to platinum-containing double-drug chemotherapy, and further screens out the patient suffering from lung adenocarcinoma sensitive to platinum-containing double-drug chemotherapy to realize individualized treatment.

Drawings

Embodiments of the invention are described in detail below with reference to the attached drawing figures, wherein:

FIG. 1 is a graph showing the results of miR-3202 differential expression between patients with lung adenocarcinoma who responded to platinum-containing dual-drug chemotherapy and who did not respond to platinum-containing dual-drug chemotherapy;

FIG. 2 is a graph showing the results of miR-3663-3p differentially expressed between patients with lung adenocarcinoma who responded to platinum-containing dual-drug chemotherapy and those who did not respond to platinum-containing dual-drug chemotherapy;

FIG. 3 is a graph showing the results of miR-449a differential expression between patients with lung adenocarcinoma who responded to platinum-containing dual-drug chemotherapy and patients who did not respond to platinum-containing dual-drug chemotherapy;

FIG. 4 is a graph showing the results of miR-3202 on its diagnostic efficacy in predicting lung adenocarcinoma sensitivity to platinum-containing dual-drug chemotherapy;

FIG. 5 is a graph showing the results of miR-3663-3 p's diagnostic efficacy in predicting lung adenocarcinoma sensitivity to platinum-containing dual-drug chemotherapy;

FIG. 6 is a graph showing the results of miR-449a on predicting the diagnostic efficacy of lung adenocarcinoma sensitivity to platinum-containing dual-drug chemotherapy;

FIG. 7 is a graph showing the results of the diagnostic efficacy of miR-3202+ miR-3663-3p for predicting the sensitivity of lung adenocarcinoma to platinum-containing dual-drug chemotherapy;

FIG. 8 is a graph showing the results of miR-3202+ miR-449a on predicting the diagnostic efficacy of lung adenocarcinoma sensitivity to platinum-containing dual-drug chemotherapy;

FIG. 9 is a graph showing the results of miR-3663-3p + miR-449a on its diagnostic efficacy in predicting lung adenocarcinoma sensitivity to platinum-containing dual-drug chemotherapy;

FIG. 10 shows a graph of the results of the diagnostic efficacy of miR-3202+ miR-3663-3p + miR-449a for predicting the sensitivity of lung adenocarcinoma to platinum-containing dual-drug chemotherapy.

Detailed Description

The present invention is further illustrated by the following examples, which should be construed as being merely illustrative and not limitative of the remainder of the disclosure. As will be understood by those of ordinary skill in the art: various changes, modifications, substitutions and alterations can be made to the embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the claims and their equivalents. The following examples are examples of experimental methods not indicating specific conditions, and the detection is usually carried out according to conventional conditions or according to the conditions recommended by the manufacturers. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs, and any methods and materials similar or equivalent to those described herein may be applied.

Example 1 Gene screening related to susceptibility of Lung adenocarcinoma to platinum-containing Dual-drug chemotherapy

1. Data source

Before patients with pathologically diagnosed lung adenocarcinoma receive platinum-containing dual-drug chemotherapy, tumor tissues of the patients are collected, and the lung adenocarcinoma patients are divided into a response group (R, responder) or a non-response group (NR, non-responder) according to whether the lung adenocarcinoma is responsive to the platinum-containing dual-drug chemotherapy or not in combination with RECIST (standard for evaluating the curative effect of solid tumors); the lung adenocarcinoma patients do not receive platinum-based drug chemotherapy before receiving platinum-containing dual-drug chemotherapy; the response group comprises patients with lung adenocarcinoma with Complete Response (CR) and patients with lung adenocarcinoma with Partial Response (PR), and the non-response group comprises patients with Stable Disease (SD) and Progressive Disease (PD); data from this study were derived from GSE56264, non-responder: responder-24: 16;

further, in this study, the platinum-containing dual-drug chemotherapy regimen for patients with lung adenocarcinoma included carboplatin + paclitaxel, cisplatin + gemcitabine, cisplatin + vinorelbine, carboplatin + gemcitabine;

comparing the miRNAs differentially expressed between the lung adenocarcinoma patients in the responsive group and the lung adenocarcinoma patients in the non-responsive group; differential expression analysis was performed using the "limma" package in the R language, where the screening criteria for differentially expressed genes was p<0.05，|log₂FC|>1。

2. Results of the experiment

The results show that 43 genes are differentially expressed between the response group and the non-response group obtained by screening, wherein miR-3202, miR-3663-3p and miR-449a show significant differential expression between patients with lung adenocarcinoma in the response group and the non-response group, and the expression trends of miR-3202, miR-3663-3p and miR-449a in the response group are respectively up-regulated, up-regulated and down-regulated (see fig. 1-3), and the results indicate that miR-3202, miR-3663-3p and miR-449a are potential biomarkers for predicting the sensitivity of lung adenocarcinoma to platinum-containing dual-drug chemotherapy.

Example 2 application of differential expression gene obtained by screening in predicting sensitivity of lung adenocarcinoma to platinum-containing dual-drug chemotherapy

1. Experimental methods

Performing Receiver Operating Characteristic (ROC) analysis on the genes screened in example 1 and differentially expressed between the response group and the non-response group using R comprising "pROC" (version 1.15.0), and calculating the area under the operating characteristic curve (AUC) of the subject to evaluate the accuracy of a single differentially expressed gene, any two differentially expressed gene combinations, and three differentially expressed gene combinations, respectively, for predicting the sensitivity of lung adenocarcinoma to platinum-containing dual drug chemotherapy, wherein the AUC values range from 0 to 1;

wherein, when judging the diagnosis effectiveness of the single differential expression gene on predicting the sensitivity of the lung adenocarcinoma to the platinum-containing dual-drug chemotherapy, the expression quantity of the single differential expression gene is directly adopted for analysis, the level corresponding to the one point with the maximum Youden index is selected as the cutoff value, and the differential expression gene with the AUC of 0.5< AUC <0.8 is used for joint analysis;

when the diagnosis effectiveness of the combination of any two differential expression genes and the combination of three differential expression genes on the prediction of the sensitivity of the lung adenocarcinoma to the platinum-containing dual-drug chemotherapy is judged, Logitics regression analysis is carried out on the expression level of each differential expression gene, the probability of each lung adenocarcinoma individual on the sensitivity of the platinum-containing dual-drug chemotherapy is calculated through a fitted regression curve, different probability division threshold values are determined, and the accuracy, the specificity, the sensitivity and the like of the combination of any two differential expression genes and the combination of three differential expression genes on the prediction of the sensitivity of the lung adenocarcinoma to the platinum-containing dual-drug chemotherapy are calculated according to the determined probability division threshold values.

2. Results of the experiment

The results show that the gene combination miR-3202+ miR-3663-3p, miR-3202+ miR-449a, miR-3663-3p + miR-449a and miR-3202+ miR-3663-3p + miR-449a has diagnosis efficiency remarkably superior to that of a single gene in predicting the sensitivity of lung adenocarcinoma to platinum-containing double-drug chemotherapy, and the genes are combined to predict the sensitivity of lung adenocarcinoma to platinum-containing double-drug chemotherapy, and the AUC values are high (see Table 1 and figure 4-figure 10), which shows that the genes miR-3202, miR-3663-3p and/or miR-449a can be used for clinically assisting a doctor in judging the sensitivity of the lung adenocarcinoma patient to platinum-containing double-drug chemotherapy, and has very good clinical application prospects.

Diagnostic efficacy of the genes of Table 1 for predicting susceptibility of lung adenocarcinoma to platinum-containing dual-drug chemotherapy

Gene	AUC value
		miR-3202	0.607
miR-3663-3p	0.758
		miR-449a	0.690
miR-3202+miR-3663-3p	0.758
		miR-3202+miR-449a	0.753
miR-3663-3p+miR-449a	0.818
		miR-3202+miR-3663-3p+miR-449a	0.820

The above description of the embodiments is only intended to illustrate the method of the invention and its core idea. It should be noted that, for those skilled in the art, without departing from the principle of the present invention, several improvements and modifications can be made to the present invention, and these improvements and modifications will also fall into the protection scope of the claims of the present invention.

Sequence listing

<110> the Qingdao is dependent on deep-age biomedical GmbH

<120> marker related to sensitivity of lung adenocarcinoma to platinum-containing dual-drug chemotherapy and application thereof

<141> 2021-11-16

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> RNA

<213> Homo sapiens

<400> 1

uggaagggag aagagcuuua au 22

<210> 2

<211> 23

<212> RNA

<213> Homo sapiens

<400> 2

ugagcaccac acaggccggg cgc 23

<210> 3

<211> 22

<212> RNA

<213> Homo sapiens

<400> 3

uggcagugua uuguuagcug gu 22

Claims

1. Application of a reagent for detecting the expression level of a miRNA marker in a sample in preparation of a product for predicting sensitivity or reactivity of lung adenocarcinoma to platinum-containing dual-drug chemotherapy is characterized in that the miRNA marker is miR-3202, miR-3663-3p and/or miR-449 a.

2. The use according to claim 1, wherein the agent is selected from the group consisting of:

a probe that specifically recognizes the miRNA marker; or

A primer that specifically amplifies the miRNA marker.

3. The use of claim 1, wherein the product comprises reagents for detecting the expression level of the miRNA marker in a sample by high-throughput sequencing methods, real-time quantitative PCR, RT-PCR, in situ hybridization, or chip.

4. The use of claim 1, wherein the sample is derived from blood or tissue of a subject.

5. A product for predicting sensitivity or responsiveness of a patient with lung adenocarcinoma to platinum-containing dual-drug chemotherapy, comprising a reagent for detecting the expression level of a miRNA marker in a sample, wherein the miRNA marker is miR-3202, miR-3663-3p, and/or miR-449 a.

6. The product according to claim 5, wherein the agent is selected from the group consisting of:

a probe that specifically recognizes the miRNA marker; or

A primer that specifically amplifies the miRNA marker.

7. The product of claim 5, wherein the product comprises a kit, chip, or strip.

8. A pharmaceutical composition for improving sensitivity or reactivity of a patient with lung adenocarcinoma to platinum-containing dual-drug chemotherapy, which is characterized by comprising an agent for increasing miR-3202 expression level, an agent for increasing miR-3663-3p expression level, and/or an agent for reducing miR-449a expression level.

Use of miRNA markers miR-3202, miR-3663-3p, and/or miR-449a in constructing a computational model or a system embedded with the computational model for predicting the sensitivity or reactivity of a patient with lung adenocarcinoma to platinum-containing dual-drug chemotherapy;

the calculation model takes the expression levels of miRNA markers miR-3202, miR-3663-3p and/or miR-449a as input variables, and outputs the sensitivity or reactivity of the lung adenocarcinoma patient to platinum-containing double-drug chemotherapy through operation by a bioinformatics method.

10. A system or apparatus for predicting the sensitivity or responsiveness of a lung adenocarcinoma patient to platinum-containing dual-drug chemotherapy, said system or apparatus comprising:

the control unit of the evaluation device comprises the following four units: