CN117646024A

CN117646024A - Efficient microRNA gene knockdown vector construction method

Info

Publication number: CN117646024A
Application number: CN202311556018.5A
Authority: CN
Inventors: 张楠楠; 罗林杰; 张浩然; 刘利; 崔佳佳; 李雪阳; 朱本强
Original assignee: Anhui Normal University
Current assignee: Anhui Normal University
Priority date: 2023-11-21
Filing date: 2023-11-21
Publication date: 2024-03-05

Abstract

The invention discloses a high-efficiency microRNA gene knockdown vector construction method, which comprises the following steps of (1) constructing an entry vector: taking a plasmid RS300 as a template, obtaining a DNA fragment containing a target spot, bsaI endonuclease recognition and cleavage sites through PCR amplification reaction, and obtaining a complete entry carrier through enzyme cleavage ligation reaction; (2) construction of expression vectors by LR reaction: constructing an expression vector by using a gateway system, and carrying out LR reaction on the entry vector and the expression vector containing a promoter by using LR enzyme so as to obtain a complete expression vector; (3) Converting the expression vector obtained in the step (2) into competent cells of escherichia coli, and carrying out enzyme digestion identification on positive clones; (4) And performing transgenic operation after enzyme digestion identification until positive seedlings of transgenic plants are obtained. When the gene knockdown expression vector is constructed, a plurality of sequences containing targets can be connected together and simultaneously connected with the entry vector, so that the efficiency is higher.

Description

Efficient microRNA gene knockdown vector construction method

Technical Field

The invention relates to the technical field of biology, in particular to a high-efficiency microRNA gene knockdown vector construction method.

Background

microRNAs (miRNAs) is a non-coding small molecule RNA that can play a critical role in gene regulation. Plant mirnas are a class of endogenous micrornas consisting of 21-22nt nucleotides that inhibit gene expression by targeted RNA cleavage or translational inhibition (Achkar, n.p., cambiagno, d.a., and Manavella, p.a. (2016). MiRNA biogenesis: a dynamic pathway.trends Plant sci.21, 1034-1044). The structure of miRNAs has a certain specificity: at the 3' end there are two asymmetric structures with nucleic acid protrusions. In plants, miRNA precursors are first processed into miRNA-miRNA duplex and loaded into ARGONAUTE 1 (AGO 1) -centered RNA-induced silencing complex RNA-induced silencing complex (RISC), and then are involved in target mRNA degradation regulation (Schwarz, d.s., hutvagner, g., du, t., xu, z., aronin, n.and zacore, p.d. (2003) Asymmetry in the assembly of the RNAi enzyme complex. Cell 115, 199-208.).

artificial microRNAs (amiRNAs) are designed based on endogenous miRNA precursors and mimic the structure of miRNAs, an artificially synthesized miRNA consisting of 21 nucleotides for silencing a specific gene of interest (Yu, s.and Pilot, g. (2014) Testing the efficiency of plant artificial microRNAs by transient expression in Nicotiana benthamiana reveals additionala ction at thetranslational level. In the structure of the amiRNAs, the amiRNAs/amiRNA double chains are used for replacing miRNA/miRNA double chains, and meanwhile, the amiRNAs have a certain mismatch at a specific position, so that the efficiency of binding target mRNA is improved. As with endogenous mirnas, amiRNA/amiRNA duplex is processed by DICER LIKE (DCL 1), amiRNA is loaded into RISC, while target mRNA is degraded by the same asymmetric RISC assembly mechanism. amiRNAs, like endogenous miRNAs, have been shown to efficiently sink target genes in a variety of situations and have little off-target effect (Li, J.F., chung, H.S., niu, Y., bush, J., mcCormack, M.and Green, J. (2013) Comprehe nsive protein-based artificial microRNA screens for effective gene si lencing in plants Cell 25,1507-1522;Tang,G.and Galili,G (2004) Using RNAi to improve plant nutritional value: from mecha nism to application. Trends Biotechnol.22, 463-469).

artificial microRNAs provides a new method for gene knockout and helps people to better develop various researches on target genes. However, the existing artificial microRNAs working system has the following problems: (1) In the traditional method, a knock-down vector can be designed aiming at a single target point, and a mutant which is wanted to obtain multiple genes and knockdown simultaneously can be obtained by constructing multiple vectors and performing multiple transgenic operations. The method is long in time consumption and has high off-target risk by only designing a single target for a certain gene. (2) The efficiency is lower when the expression vector with the knockdown gene is constructed by relying on traditional endonuclease.

Disclosure of Invention

The invention aims to solve the defects in the prior art, and provides a high-efficiency microRNA gene knockdown vector construction method.

In order to achieve the above purpose, the present invention adopts the following technical scheme:

an efficient microRNA gene knockdown vector construction method, a flow chart is shown in figure 6, and specifically comprises the following steps:

(1) Construction of entry vector: the DNA fragment containing the target spot and BsaI endonuclease recognition and cleavage site is obtained by PCR amplification reaction by taking the plasmid RS300 as a template, the used primers comprise the primers containing the target spot sequence and the primers positioned at two ends, and a complete entry vector (Rebecca Schwab, stephan Ossowski, markus Riester, norman Warthmann, and Detlef Weigel (2006) Highly Specific Gene Silencing by Artificial MicroRNAs in Arabidopsis Plant Cell 18:1121-1133) is obtained by enzyme digestion ligation reaction (Stephan Ossowski, rebecca Schwab, detlef Weigel (2008) Gene silencing in plants using artificial microRNAs and other small RNAs The Plant Journal (4), 674-690) (Warthmann N, chen H, ossowski S, weigel D, herv E P. (2008) Highly Specific Gene Silencing by Artificial miRNAs in Rice PLoS ONE 3 (3): e 1829), and the entry vector base sequence is shown as SEQ ID NO.2;

(2) Construction of expression vectors by LR reaction: constructing an expression vector by using a gateway system, performing LR reaction by using LR enzyme, performing LR reaction on the entry vector and the expression vector containing a promoter by using LR enzyme to obtain a complete expression vector, and determining the concentration of the entry vector and the expression vector by electrophoresis, wherein the total amount ratio of the entry vector to the expression vector added into the system is 3:1, adding 2.5. Mu.L LR enzyme, supplementing water to 5. Mu.L, and incubating overnight at 25 ℃ (but not more than 16 h);

(3) Converting the connection product obtained in the step (2) into competent cells of escherichia coli, and carrying out enzyme digestion identification on positive clones;

(4) And performing transgenic operation after enzyme digestion identification until positive seedlings of transgenic plants are obtained.

In the above scheme, it is preferable that: the primers containing target sequences in the step (1) comprise a primer I, a primer II, a primer III and a primer IV, and the primers positioned at the two ends comprise a primer A and a primer B. Wherein the primer I, the primer II, the primer III and the primer IV are obtained by replacing N in target spots of target genes, the N is directly copied and replaced when the target sequences are inserted into the primer I and the primer III, the complementary sequences of the target sequences are required to be replaced by N when the target sequences are inserted into the primer II and the primer IV,

primer I	gaNNNNNNNNNNNNNNNNNNNNNNtctctcttttgtattcc
		Primer II	gaNNNNNNNNNNNNNNNNNNNNNNtcaaagagaatcaatga
Primer III	gaNNNNNNNNNNNNNNNNNNNNNNtcacaggtcgtgatatg
		Primer IV	gaNNNNNNNNNNNNNNNNNNNNNNtctacatatatattcct

In the above scheme, it is preferable that the primer A and the primer B are knocked out for multi-target genes, bsaI is used as enzyme used for enzyme digestion in the process of constructing plasmids, the BsaI forms complementary sticky end sequences between adjacent target mRNA, and the primer sequences selected in the process of designing the primer A and the primer B follow the following rules:

the BsaI recognition and cleavage sequences are connected to the 5' ends of the primer A and the primer B, so that paired sticky ends can be formed between adjacent nucleic acid fragments containing targets and between the nucleic acid fragments and the entry vector by means of BsaI enzyme, and the nucleic acid fragments and the entry vector are connected together by T4 ligase. Meanwhile, according to the specificity that the recognition site and the cleavage site of BsaI enzyme are two sections of different sequences, the BsaI cleavage site on the primer between adjacent target mRNA is designed to form a reverse complementary sticky end after enzyme cleavage, and the ends formed between the non-adjacent target mRNA cannot be paired.

In any of the above embodiments, the primer sequences of the primer a and the primer B are preferably as follows:

in any of the above embodiments, it is preferable that the PCR amplification reaction for the target mRNA in the step (1) is as follows:

	upstream primer (P1)	Downstream primer (P2)	Template
				Reaction 1	A	IV	Plasmid RS300
Reaction 2	III	II	Plasmid RS300
				Reaction 3	I	B	Plasmid RS300
Reaction 4	A	B	1 product+2 product+3 product

Step 1, step 2 and step 3 PCR reactions in the reaction system:

pre-denaturation at 95℃for 5 min- & gt (denaturation at 95℃for 30 s- & gt annealing at 55℃for 30 s- & gt extension at 72℃for 1 min) for 30 cycles- & gt 72℃for 5min; the primer concentration in the reaction system was 10. Mu.M.

Step 4, PCR reaction:

pre-denaturation at 95℃for 5 min- & gt (denaturation at 95℃for 30 s- & gt annealing at 55℃for 30 s- & gt extension at 72℃for 2 min) for 30 cycles- & gt 72℃for 5min; the primer concentration in the reaction system was 10. Mu.M.

In any of the above schemes, it is preferable that the cleavage ligation reaction system in step (1) is as follows:

(37 ℃ C. For 5min,10 ℃ C. For 5min, 20 ℃ C. For 5 min) for 15 cycles, 37 ℃ C. For 5min.

In any of the above embodiments, it is preferred that step (1) introduces the toxic protein sequence ccdB into the plasmid of the entry vector. And the screening of the later positive cloning bacteria is convenient.

In any of the above schemes, preferably, the specific operation in the step (3) is as follows: incubating the competence on ice, adding LR reaction product, placing on ice for 30min, heating in a water bath at 42 ℃ for 45s, immediately placing on ice for 2min after timing, adding 500 mu L of liquid LB, culturing at 200rpm on a shaking table at 37 ℃ for 1h, coating on a solid LB plate with SpeR resistance at 1%o after culturing, and culturing overnight with an incubator at 37 ℃ in an inverted manner; after the culture is finished, directly inoculating bacteria, shaking bacteria, culturing overnight, and performing enzyme digestion identification on the plasmid in the next day.

The beneficial effects are that:

compared with the defect of constructing plasmids by using the traditional artificial microRNAs, the method has the following innovation:

(1) Aiming at the problem that only a single target point can be aimed at in the traditional method, a novel expression system is constructed in the application: multiple sequences containing a target may be ligated together simultaneously into an entry vector, as shown in FIG. 1.

(2) Aiming at the problems of lower digestion and connection efficiency caused by the dependence of endonuclease in the traditional expression system, the application connects BsaI recognition and cleavage sequences at the 5' ends of the primer A and the primer B, so that paired sticky ends can be formed between adjacent nucleic acid fragments containing targets and between the nucleic acid fragments and the entry vector by means of BsaI enzyme, and simultaneously the adjacent nucleic acid fragments and the entry vector are connected together by T4 ligase. The efficiency of the ligation between the plurality of target mRNAs, the target mRNAs and the entry vector can be effectively improved, as shown in FIG. 2.

Meanwhile, according to the specificity that the recognition site and the cleavage site of BsaI enzyme are two sections of different sequences, the BsaI cleavage site on the primer between adjacent target mRNA is designed to form a reverse complementary sticky end after enzyme cleavage, and the ends formed between the non-adjacent target mRNA cannot be paired. As shown, the sticky ends formed by cleavage by BsaI enzyme at cleavage sites B1 'and B2' are complementary, whereas the ends formed by cleavage by BsaI enzyme at cleavage sites B1 'and B2' are not complementary. The design enables a plurality of target mRNAs and the connection of the target mRNAs and the entry carrier to be sequentially carried out, so that the reaction efficiency is further improved. The phylogenetic system can simultaneously connect 8 targets at most and complete plasmid construction, as shown in FIG. 3.

(3) In the process of constructing the entry vector, a plurality of target mRNAs are connected in series and then enter the entry vector of the Gateway system. The inventive introduction of the toxic protein sequence ccdB in the plasmid facilitates the screening of later positive clone bacteria, as shown in figure 4.

(4) The application constructs a plasmid to knock down two genes simultaneously and detects the expression condition of the mutant relative to two wild genes by a QRT-PCR method.

Drawings

FIG. 1 is a schematic diagram of a method of constructing an expression system according to the present application;

FIG. 2 is a schematic diagram showing the connection of the 5' ends of the primer A and the primer B to BsaI;

FIG. 3 is a schematic representation of the BsaI cleavage site on a primer designed between adjacent target mRNAs;

FIG. 4 is a schematic diagram of the introduction of the toxic protein sequence ccdB in the plasmid;

FIG. 5 is a schematic flow chart of designing a target point for each gene by taking simultaneous knockdown of Arabidopsis genes BRM and ARR7 as an example;

FIG. 6 is a flow chart of a method for constructing the efficient microRNA gene knockdown vector.

FIG. 7 is a graph showing the results of examining the relative expression level of the mutant amiR-BRM+ARR7 in vivo gene BRM and ARR7 using wild-type Arabidopsis thaliana as a blank group.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention.

An efficient microRNA gene knockdown vector construction method, a flow chart is shown in figure 6, comprises the following steps:

1. selection target

Logging in a website: http:// wmd3.Weigelworld. Org/cgi-bin/webapp. Cgi. Input gene name, experimental species automatically generated relevant targets. The following rules are referenced in selecting target sequences: selecting a sequence with a front position; selecting A, T, C, G as evenly distributed a sequence as possible; the target sequences on the Arabidopsis genes BRM, ARR7 were selected according to the above rules as shown in Table 1:

TABLE 1

ARR7	TTACTGCAGAGCCCTACTCCC
		BRM	GGAAGTAGGGCTCAGCAGTAT

2. Primer design:

the primer mainly comprises two types, namely a primer I, a primer II, a primer III and a primer IV which contain target sequences, and a primer A and a primer B which are positioned at two ends.

Primer I, primer II, primer III, primer IV: the target gene of interest was replaced by "N" according to Table 2 below, noting that the target sequence was directly replicated to replace "N" when inserted into primer I and primer III. When the target sequence is inserted into the primer II and the primer IV, the complementary sequence of the target sequence needs to be replaced by 'N'.

TABLE 2

I	gaNNNNNNNNNNNNNNNNNNNNNNtctctcttttgtattcc
		II	gaNNNNNNNNNNNNNNNNNNNNNNtcaaagagaatcaatga
III	gaNNNNNNNNNNNNNNNNNNNNNNtcacaggtcgtgatatg
		IV	gaNNNNNNNNNNNNNNNNNNNNNNtctacatatatattcct

Primer A and primer B: for multi-target gene knockout, bsaI is used as an enzyme for cleavage during plasmid construction, which forms complementary cohesive end sequences between adjacent target mrnas. The primer sequences selected during the design of primer A and primer B should follow the following rules, as shown in Table 3:

TABLE 3 Table 3

Taking two targets as examples: the primer is selected fromBsaIL+A-BsaI1+B-BsaI2+A-BsaIR+B。

The sequences of specific primers A and B are shown in Table 4 below:

TABLE 4 Table 4

BL+A	3’TTCAGAggtctcTctcgCTGCAAGGCGATTAAGTTGGGTAAC5’
		B1’+B	3’AGCGTGggtctcGtcagGCGGATAACAATTTCACACAGGAAACAG5’
B2+A	3’TTCAGAggtctcTctgaCTGCAAGGCGATTAAGTTGGGTAAC5’
		B2’+B	3’AGCGTGggtctcGagcgGCGGATAACAATTTCACACAGGAAACAG5’
B3+A	3’TTCAGAggtctcTcgctCTGCAAGGCGATTAAGTTGGGTAAC5’
		B3’+B	3’AGCGTGggtctcGcagaGCGGATAACAATTTCACACAGGAAACAG5’
B4+A	3’TTCAGAggtctcTtctgCTGCAAGGCGATTAAGTTGGGTAAC5’
		B4’+B	3’AGCGTGggtctcGacctGCGGATAACAATTTCACACAGGAAACAG5’
B5+A	3’TTCAGAggtctcTaggtCTGCAAGGCGATTAAGTTGGGTAAC5’
		B5’+B	3’AGCGTGggtctcGgtccGCGGATAACAATTTCACACAGGAAACAG5’
B6+A	3’TTCAGAggtctcTggacCTGCAAGGCGATTAAGTTGGGTAAC5’
		B6’+B	3’AGCGTGggtctcGtcttGCGGATAACAATTTCACACAGGAAACAG5’
B7+A	3’TTCAGAggtctcTaagaCTGCAAGGCGATTAAGTTGGGTAAC5’
		B7’+B	3’AGCGTGggtctcGagtcGCGGATAACAATTTCACACAGGAAACAG5’
B8+A	3’TTCAGAggtctcTgactCTGCAAGGCGATTAAGTTGGGTAAC5’
		BR+B	3’AGCGTGggtctcGaccgGCGGATAACAATTTCACACAGGAAACAG5’

The target sequence is replaced by "N" in the primer. It should be noted that the target sequence is inserted into primer I and primer III and directly copied to replace "N", and the complementary sequence of the target sequence is required to be replaced by "N" when the target sequence is inserted into primer II and primer IV, so as to obtain and send the primers synthesized by biological company as shown in the following Table 5:

TABLE 5

Primer (P)	Primer sequences
		Target ARR 7-primer I	gaTTACTGCAGAGCCCTACTCCCtctctcttttgtattcc
Target ARR 7-primer II	gaGGGAGTAGGGCTCTGCAGTAAtcaaagagaatcaatga
		Target ARR 7-primer III	gaGGAAGTAGGGCTCAGCAGTATtcacaggtcgtgatatg
Target ARR 7-primer IV	gaATACTGCTGAGCCCTACTTCCtctacatatatattcct
		Target BRM-primer I	gaGGAAGTAGGGCTCAGCAGTATtctctcttttgtattcc
Target BRM-primer II	gaATACTGCTGAGCCCTACTTCCtcaaagagaatcaatga
		Target BRM-primer III	gaATCCTGCTGAGCCGTACTTCCtcacaggtcgtgatatg
Target BRM-primer IV	gaGGAAGTACGGCTCAGCAGGATtctacatatatattcct

3. The experimental procedure is as follows: as shown in FIG. 5, the plasmid RS300 is used as a template, the base sequence of the plasmid RS300 is shown as SEQ ID NO.1, and I-IV are used as primers to obtain the DNA fragment comprising BsaI enzyme recognition, cleavage site and target. The PCR amplification reactions were as follows in Table 6:

TABLE 6

	Upstream primer	Downstream primer	Template
				Reaction 1	A	IV	Plasmid RS300
Reaction 2	III	II	Plasmid RS300
				Reaction 3	I	B	Plasmid RS300
Reaction 4	A	B	1 product+2 product+3 product

PCR amplification reaction procedure and system using plasmid RS300 as template are shown in Table 7 below:

step 1, step 2 and step 3 PCR reactions in the reaction system:

TABLE 7

Pre-denaturation at 95℃for 5 min- & gt (denaturation at 95℃for 30 s- & gt annealing at 55℃for 30 s- & gt extension at 72℃for 1 min) for 30 cycles- & gt 72℃for 5min; primer concentration in the reaction system was 10. Mu.M

Step 4 PCR reactions as in Table 8:

TABLE 8

4. The sequence comprising the target spot and the entry vector (the base sequence of the entry vector is shown as SEQ ID NO. 2) are subjected to enzyme digestion and ligation reaction: based on the recognition of BsaI endonuclease and the characteristic that cleavage sites are base sequences with two independent ends, the cleavage and ligation reactions are carried out in a reaction system. The reaction system is shown in Table 9 below:

TABLE 9

5. Transformation of plasmid into E.coli competent cells

Melting 20 mu L of escherichia coli DH5 alpha ice, adding 5 mu L of a connecting product, blowing, sucking, mixing uniformly, and standing on ice for 30min; heating in a water bath at a temperature of 42 ℃ for 45s, and immediately placing on ice for 2min after timing; adding 500 mu L of liquid LB, and culturing at 200rpm and 37 ℃ for 1h; after the culture is finished, the bacterial liquid is coated on a solid LB plate containing Kana (note: the coating is a gradient coating, and 100 mu L of the solid LB plate and the whole solid LB plate are coated respectively to avoid overgrowth of bacteria or too high conversion efficiency due to low conversion efficiency); after the coating was completed, the plate was placed upside down in an incubator at 37℃overnight.

6. Plasmid extraction and identification:

because the toxic protein ccdB is introduced into the entry vector, the normal colony after the transformation of the connection product is positive clone, and colony PCR verification is not needed. Positive clones were selected and cultured overnight (about 12 h) at 200rpm at 37℃in 4mL of liquid LB containing 1% Kana; plasmid extraction is carried out by using a plasmid extraction kit of the Norwegian biological company, a plasmid map is constructed according to snapgene, ecoRI enzyme is selected for enzyme digestion identification, and the size of an electrophoresis band is 2874bp+706 bp+1595 bp as shown in table 10;

table 10

The enzyme cutting program is 37-15 min, 85-10 min heat inactivation judges whether the plasmid is correct according to the electrophoresis result, and then the plasmid is sent to a biological company for sequencing, and whether the base is mutated is judged according to a sequencing peak diagram.

7. LR reaction

Constructing an expression vector by using a gateway system, carrying out LR reaction by using LR enzyme, and determining the concentration of the entry vector and the expression vector by electrophoresis, wherein the total ratio of the entry vector to the expression vector added into the system is 3:1, adding 2.5 mu L LR enzyme, supplementing water to 5 mu L, and incubating overnight at 25 ℃ (not more than 16 h); after incubation, the transformation is carried out again according to the step 5, and the bacterial colony growing after the LR reaction is positive and bacterial colony PCR is not needed to be carried out again because the toxic protein sequence ccdB is also contained in the expression vector. And (5) selecting single colony shaking bacteria, and carrying out enzyme digestion identification according to the step (6).

8. Agrobacterium transformation

After LR reaction, 3. Mu.L of the identified correct plasmid was added to 10. Mu.L of competent Agrobacterium ASE thawed on ice, left on ice for 20min, snap frozen in liquid nitrogen for 1min, and heat shock at 37℃for 4min. After the heat shock, 500. Mu.L of liquid LB containing Spe antibiotic at a concentration of 1% was directly added, and incubated at 200rpm at 37℃for 3 hours. After the cultivation is finished, the plating plate is inversely cultivated until colonies grow out.

9. Agrobacterium tumefaciens flower flocculation dip dyeing

Single colonies were picked into 2mL of liquid LB containing 1% Spe antibiotic and incubated overnight at 220rpm at 28℃for about 12h; transferring 100ul of bacterial liquid into 40mL of liquid containing 1%Spe antibiotic for culturing overnight for about 12h, and measuring OD value for multiple times after culturing until OD 600 is about 0.8, and ending culturing; the transformation solution was prepared at the late stage of bacterial culture, and about 50mL of transformation solution was required for each gene to be transfected. The formulation of the conversion solution is shown in the following table 11, and after adding a proper amount of water into each reagent according to the formulation, stirring and mixing uniformly, the conversion solution needs to be adjusted to pH value of 5.7 by KOH and then is subjected to constant volume.

TABLE 11

Centrifuging the bacterial liquid at 5000rpm for 15min, discarding the supernatant, adding the conversion liquid, and blowing and sucking the mixed bacterial body; pruning the grown fruit clips, horizontally placing the arabidopsis thaliana, gathering the arabidopsis thaliana branches, soaking inflorescences into a transformation solution containing agrobacterium for 30s; placing the infiltrated Arabidopsis thaliana in a plastic tray horizontally, adding a small amount of water for moisturizing, covering a transparent plastic cover, and carrying out light-shielding treatment for 12 hours. After the treatment is finished, the arabidopsis thaliana is righted and put back into a culture room to continue normal culture; after the arabidopsis is fully ripe, seeds are harvested and placed in a constant temperature seed drying oven for drying.

10. Screening of transgenic positive seedlings of Arabidopsis thaliana

The culture (containing 8%o agar) was performed in 1/2MS (Murashige and Skoog) solid medium plates containing 1%o Kana antibiotics, and subjected to high temperature and high pressure sterilization. Adding a proper amount of sterilizing solution (70% EtOH+5%Tween) into the dried seeds, and reversely washing for 10min; discarding the sterilizing solution, adding 95% EtOH, and washing for 2 times each for 2min; pouring the seeds on the filter paper subjected to sterilization and drying treatment, and blow-drying the seeds in an ultra-clean workbench by a fan; the hot 1/2MS was poured onto petri dishes (approximately 15mL each) on an ultra clean bench; taking seeds subjected to sterilization and drying treatment after the culture medium is solidified, wrapping a centrifugal pipe orifice filled with the seeds by gauze, and uniformly spreading the seeds on a 1/2MS flat plate containing Kana antibiotics; sealing the flat plate from the side by using a sterile sealing film; the flat plate is placed in a plant culture room for culturing for about 14 days, the growth vigor is good, and the green plants are transplanted into nutrient soil for continuous culture.

11. Extraction of Arabidopsis Total RNA

Aiming at the first generation of cultured or second generation of positive plants screened by a flat plate, taking the top end or seedling material of an arabidopsis inflorescence, putting the material into a round bottom centrifuge tube, freezing the centrifuge tubes containing the material by liquid nitrogen, adding 2 zirconia beads into each centrifuge tube, freezing the metal blocks in a high-flux grinding instrument by liquid nitrogen, and grinding the metal blocks by the high-flux grinding instrument for 3min; after full grinding, adding 1mL of Trizol reagent into a centrifuge tube on ice, and shaking for 30s on a vortex meter for uniform mixing; standing for 5min at 4 ℃ and centrifuging 10000g for 10min; taking the supernatant to a new centrifuge tube, adding 200 mu L of chloroform, fully and uniformly mixing for 30s, and standing for 10min;10000g is centrifuged at low temperature for 15min. Taking a proper amount of supernatant, adding isopropanol with the same volume as the supernatant, and uniformly mixing (avoiding sucking lower-layer liquid); standing at low temperature for 10min, centrifuging for 10min with 10000g, and retaining precipitate; washing the precipitate with 1mL of 75% EtOH, centrifuging at 4deg.C for 5min at 8000g, and repeating twice; removing the supernatant, sucking out 70% EtOH in the sediment by a pipetting gun, and drying the sediment by a fan in an ultra-clean bench for 5min; adding 40. Mu.L of ultra-pure water without RNase to dissolve the precipitate, and storing in an ultra-low temperature refrigerator.

12. Reverse transcription: the reaction was performed using a reverse kit, and reverse transcription was performed in a two-step method:

(1) gDNA was removed. (2) reverse transcriptase is added for inversion.

13. qRT-PCR experiments

And (5) placing the mixed experimental system into a Roche PCR instrument to operate according to the description of the kit. The data is processed and analyzed. The cDNA is used as a template, wild arabidopsis planted in the same batch is used as a blank control group, three strains of amiR-BRM+ARR7 1#, amiR-BRM+ARR 72 #, amiR-BRM+ARR7 3# which are positive in transgenesis are used as experimental group setting experiments, and the working condition of microRNA gene knockdown vectors is judged by detecting the expression conditions of genes BRM and ARR7 in the experimental group through qRT-PCR. The primer list is shown in Table 12 below:

table 12

Tublin F	GAGCCTTACAACGCTACTCTGTCTGTC
		Tublin R	ACACCAGACATAGTAGCAGAAATCAAG
BRM F	CCCACTCATCCAAACAACAG
		BRM R	GCTAGGCCGTCTTTTACCA
ARR7 F	TGAGGTCATGAGGATGGAGATTC
		ARR7 R	CAAGATACTGCAAAGCCCTAGTTC

The experimental results and their analysis are shown in table 13 and fig. 7 below: p value analysis P <0.05 "" P <0.01 "" P <0.001 "";

TABLE 13

As a result of the analysis, the expression levels of the genes BRMA and RR7 in the three experimental groups were significantly reduced in the arabidopsis thaliana compared with the wild-type control group. The results show that artificial microRNA works well when two gene systems are knocked down simultaneously.

The present invention is not limited to the above-mentioned embodiments, and any person skilled in the art, based on the technical solution of the present invention and the inventive concept thereof, can be replaced or changed within the scope of the present invention.

Appendix:

SEQ ID NO.1: plasmid RS300 base sequence:

GGAAATTGTAAACGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTCGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTGGGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTGATATCGAATTCCTGCAGCCCacaaacacacgctcggacgcatattacacatgttcatacacttaatactcgctgttttgaattgatgttttaggaatatatatgtagagagagcttccttgagtccattcacaggtcgtgatatgattcaattagcttccgactcattcatccaaataccgagtcgccaaaattcaaactagactcgttaaatgaatgaatgatgcggtagacaaattggatcattgattctctttgattggactgaagggagctccctctctcttttgtattccaattttcttgattaatctttcctgcacaaaaacatgcttgatccactaagtgacatatatgctgccttcgtatatatagttctggtaaaattaacattttgggtttatctttatttaaggcatcgccatgGGGGGATCCACTAGTTCTAGAGCGGCCGCCACCGCGGTGGAGCTCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTCCGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTG

SEQ ID NO.2: entry vector base sequence:

CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCTAGCATGGATCTCGGGGACGTCTAACTACTAAGCGAGAGTAGGGAACTGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGGAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTTGAACGTTGTGAAGCAACGGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGCATCAAACTAAGCAGAAGGCCATCCTGACGGATGGCCTTTTTGCGTTTCTACAAACTCTTCCTGTTAGTTAGTTACTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTTTCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTGATATCGAATTCCtcgagagacctctgaagtggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaagaaacagctatgaccatgattacgccaagctatttaggtgacactatagaatactcaagct

atgcatcaagctcaatgggtctagtctgtagatacccatcacactggcgaccgctcgaacatcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgccggggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcacgatgaccaccgatatggccagtgtgcctgtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaatgtcaggcctgaatggcgaatggacgcgccctgtagcggcgcattaagcgcggcgggtgagcgtgggtctcgcggtGGATCCACTAGTTCTAGAGCGGCCGCCACCGCGGTGGATCTAGACCCAGCTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGCTTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGAAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTCCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAACTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAATCAGAATTGGTTAATTGGTTGTAACATTATTCAGATTGGGCCCCGTTCCACTGAGCGTCAGACCCGGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTT

Claims

1. the efficient microRNA gene knockdown vector construction method is characterized by comprising the following steps of:

(1) Construction of entry vector: taking a plasmid RS300 as a template, obtaining a DNA fragment containing a target spot, bsaI endonuclease recognition and cleavage sites through PCR amplification reaction, and obtaining a complete entry vector through enzyme digestion connection reaction, wherein the primers comprise a primer containing a target spot sequence and primers positioned at two ends;

(2) Construction of expression vectors by LR reaction: constructing an expression vector by using a gateway system, performing LR reaction by using LR enzyme, and determining the concentration of the entry vector and the expression vector by electrophoresis, wherein the total ratio of the entry vector to the expression vector added into the system is 3:1, adding LR enzyme, and incubating at 25 ℃ for overnight;

(3) Converting the expression vector obtained in the step (2) into competent cells of escherichia coli, and carrying out enzyme digestion identification on positive clones;

2. The method for constructing the efficient microRNA gene knockdown vector according to claim 1, which is characterized by comprising the following steps: the primer (P) containing the target sequence in the step (1) comprises a primer I, a primer II, a primer III and a primer IV, and the primers at the two ends comprise a primer A and a primer B, so that multi-target gene knockdown is realized by constructing plasmids through multi-target tandem connection.

3. The method for constructing the efficient microRNA gene knockdown vector according to claim 2, which is characterized in that: the primer I, the primer II, the primer III and the primer IV are obtained by replacing N in target spots of target genes, the N is directly copied and replaced when the target sequences are inserted into the primer I and the primer III, and the complementary sequences of the target sequences are required to be replaced by N when the target sequences are inserted into the primer II and the primer IV.

4. The method for constructing the efficient microRNA gene knockdown vector according to claim 2, which is characterized in that: the primer A and the primer B are used for knocking out multi-target genes, bsaI endonuclease is used as enzyme for enzyme digestion in the process of constructing plasmids, the BsaI endonuclease forms complementary sticky end sequences between adjacent target mRNA, and the primer sequences selected in the process of designing the primer A and the primer B follow the following rules:

5. the method for constructing the efficient microRNA gene knockdown vector according to claim 4, which is characterized in that: the specific sequences of the primer A and the primer B used in the carrier construction process are as follows:

6. the method for constructing the efficient microRNA gene knockdown vector according to claim 1, which is characterized by comprising the following steps: the PCR amplification reaction for the target mRNA in step (1) is as follows:

Step 1, step 2 and step 3 PCR reactions in the reaction system:

pre-denaturation at 95℃for 5 min- & gt (denaturation at 95℃for 30 s- & gt annealing at 55℃for 30 s- & gt extension at 72℃for 1 min) for 30 cycles- & gt 72℃for 5min; primer concentration 10. Mu.M in the reaction system 4 th PCR reaction:

7. The method for constructing the efficient microRNA gene knockdown vector according to claim 1, which is characterized by comprising the following steps: the enzyme digestion connection reaction system in the step (1) is as follows:

8. the method for constructing the efficient microRNA gene knockdown vector according to claim 4, which is characterized in that: the specific operation in the step (3) is as follows: incubating escherichia coli in ice, adding LR reaction product, placing in ice for 30min, heating in a water bath at 42 ℃ for 45s, immediately placing in ice for 2min after timing, adding 500 mu L of liquid LB, culturing at 200rpm in a shaking table at 37 ℃ for 1h, coating on a solid LB plate with Spe resistance at 1%o after culturing, and culturing overnight in an incubator at 37 ℃ in an inverted manner; after the culture is finished, the bacteria are directly inoculated, the bacteria are shaken for overnight culture (about 12 hours), and the plasmid is extracted for enzyme digestion identification the next day.