CN112501195B - Application of rice miRNA gene smNRT2.3-1 - Google Patents
Application of rice miRNA gene smNRT2.3-1 Download PDFInfo
- Publication number
- CN112501195B CN112501195B CN202011319865.6A CN202011319865A CN112501195B CN 112501195 B CN112501195 B CN 112501195B CN 202011319865 A CN202011319865 A CN 202011319865A CN 112501195 B CN112501195 B CN 112501195B
- Authority
- CN
- China
- Prior art keywords
- rice
- nitrogen
- mirna
- artificial sequence
- mirna gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Virology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses application of a rice miRNA gene smNRT2.3-1. The application of the rice miRNA gene smNRT2.3-1 in regulating and controlling the heading time, the nitrogen utilization efficiency, the yield and/or the plant height of rice, wherein the nucleotide sequence of the rice miRNA gene smNRT2.3-1 is shown as SEQ ID No. 1. Preferably, the miRNA gene smNRT2.3-1 is silenced, knocked out or mutated by a genetic engineering means so as to delay the heading time of rice and improve the utilization efficiency and the plant height of the agronomic nitrogen. After mutation, the miRNA of the invention can promote nitrogen absorption and utilization under different nitrogen treatment conditions, the heading time is delayed by about two weeks, and the mutant plant height is increased compared with that of a wild type.
Description
Technical Field
The invention belongs to the technical field of agricultural biology, and relates to an application of a rice miRNA gene smNRT2.3-1.
Background
Abiotic stress has a significant inhibitory effect on the growth and development of plants and in severe cases even affects crop productivity. Among them, the efficiency of fertilizer application and utilization is one of the important factors affecting crop yield. The nitrogen is used as a vital element, so that the synthesis of chlorophyll can be promoted, the photosynthesis can be enhanced, sufficient nutrition can be provided for plants, and the growth of the plants can be promoted. Meanwhile, the fertilizer is also a component of vitamins, amino acids and an energy system in a plant body, can increase the content of protein in the plant, and is a necessary nutrient element with the largest required amount for the growth and development of the plant, but a great amount of researches on the input and utilization of chemical nitrogen fertilizers in rice production for a long time show that the utilization rate of the nitrogen fertilizers for rice in China is only 30-35 percent all the time and is far lower than 15-28 percent of the general level in the world (Jiangliping et al, 2003). Nitrogen fertilizers consumed by rice production in China account for about 37% of the total consumption of the nitrogen fertilizers of rice in the world, but the absorption and utilization efficiency of the nitrogen fertilizers in the rice field is lower and is obviously lower than the world average level (Zhang et al, 2015). Therefore, improving the nitrogen utilization efficiency of crops is not only an important scientific problem but also an urgent problem of saving resources and protecting the ecological environment. Over the past decades, more and more genes have been found to be involved in improving nitrogen utilization efficiency in plants, of which microrna (mirnas) family members also play an important role.
MiRNAs are non-coding RNAs with 20-24 bases and are endogenously expressed, and are formed by shearing precursors with stem-loop structures through the RNAse III enzyme DICLER-LIKE 1(DCL1) and modifying HEN1 (a small RNA methyl transferase) and the LIKE. miRNAs generally require the formation of a silencing complex (complementary base pairing with mRNA of a target gene, which cleaves or directly inhibits the translation process to regulate the expression and function of downstream genes).
At present, miRNAs reported in the aspect of influencing the utilization of plant nitrogen mainly comprise miR156, miR399 and the like, and the research tries to find more miRNAs related to the absorption and utilization of the rice nitrogen so as to improve the utilization efficiency of the nitrogen and the yield of the rice.
Disclosure of Invention
The invention aims to provide application of a rice miRNA gene smNRT2.3-1.
The purpose of the invention is realized by the following technical scheme:
the application of the rice miRNA gene smNRT2.3-1 in regulating and controlling the heading time, the nitrogen utilization efficiency, the yield and/or the plant height of rice, wherein the nucleotide sequence of the rice miRNA gene smNRT2.3-1 is shown as SEQ ID No. 1.
Preferably, the miRNA gene smNRT2.3-1 is silenced, knocked out or mutated by a genetic engineering means so as to delay the heading time of rice and improve the utilization efficiency and the plant height of agricultural nitrogen.
Has the advantages that:
after mutation, the miRNA of the invention can promote nitrogen absorption and utilization under different nitrogen treatment conditions, the heading time is delayed by about two weeks, and the mutant plant height is increased compared with that of a wild type.
Drawings
FIG. 1: position of rice novel miRNA gene smNRT2.3-1
Through carrying out miRNA sequencing analysis on a Nipponbare wild type, an OsNAR2.1 silencing material (OsNAR2.1-RNAi) and an OsNAR2.1 overexpression material (pUbi-OsNAR2.1), the Nipponbare wild type has two small RNA enrichment of about 22nt at an intron part of OsNRT2.3b, and two small RNA sequences smNRT2.3-1 and smNRT2.3-2 are obtained through sequencing data.
FIG. 2 is a schematic diagram: and (3) carrying out authenticity verification on the sequenced novel miRNA gene smNRT2.3-1.
M is 50bp DNA Ladder of department of Onychidae; 1-3 novel miRNA smNRT2.3-1
The sizes of PCR amplified fragments of the three miRNAs obtained by a stem loop method are all about 60bp, which accords with the rule and shows that the three miRNAs exist really.
FIG. 3: final vector map of miRNA mimic mutant.
FIG. 4: the spike time difference between novel miRNA gene smNRT2.3-1 and wild type under different nitrogen application conditions in the field.
(A) Plant spiking field phenotype under different nitrogen treatment conditions in wild type and mutant fields
(B) Time to begin heading for wild type and mutant (from transplantation)
Note: smNRT2.3-1-bATG, smNRT2.3-1aATG and smNRT2.3-1-mATG are three mutants of novel miRNA gene smNRT2.3-1. 0N, LN, MN and HN are field nitrogen application amounts which are 90kg/ha, 150kg/ha, 250kg/ha and 350kg/ha (calculated according to pure nitrogen) in sequence.
FIG. 5: agronomic characters of a novel miRNA gene smNRT2.3-1 mutant strain line in the milk stage under different nitrogen applying conditions in the field.
0N, LN, MN, HN are field nitrogen application amount, which is 90kg/ha, 150kg/ha, 250kg/ha, 350kg/ha (calculated according to pure nitrogen)
(A) Phenotypes of three mutants of the wild-type (WT-N) and novel miRNA gene smNRT2.3-1 (smNRT2.3-1-bATG, smNRT2.3-1-aATG, smNRT2.3-1-mATG) under different nitrogen treatment conditions.
(B) The plant heights of three mutants (smNRT2.3-1-bATG, smNRT2.3-1-aATG and smNRT2.3-1-mATG) of wild type (WT-N) and novel miRNA genes smNRT2.3-1 under different nitrogen treatment conditions.
(C) Tillering of three mutants of wild type (WT-N) and novel miRNA gene smNRT2.3-1 (smNRT2.3-1-bATG, smNRT2.3-1-aATG, smNRT2.3-1-mATG) under different nitrogen treatment conditions. The data was processed using SPSS 22.0 and STST for the study correlation analysis using Pearson analysis and ANOVA analysis with the criteria for difference determination following the Duncan method (P < 0.05). Software such as Excel and Sigmaplot is used for making a relevant graph, and standard errors in the paper data are SE values.
It can be seen that the plant height of the mutants smNRT2.3-1-bATG and smNRT2.3-1-aATG tended to increase compared to the wild type, while the mutant smNRT2.3-1-mATG tended to be shorter compared to the wild type at the milk stage, probably because the heading time of the mutant smNRT2.3-1-mATG was later than that of the wild type, resulting in a slower growth vigour. However, the mutants smNRT2.3-1-bATG, smNRT2.3-1-aATG and smNRT2.3-1-mATG are not very different from the wild type.
Note: zs125, zs121, zs123, zs124 are the corresponding numbers of Nipponbare wild type (WT-N), mutants smNRT2.3-1-bATG, smNRT2.3-1-aATG, smNRT2.3-1-mATG, respectively.
FIG. 6: plant-related traits under different nitrogen concentration nitrogen form conditions under water culture condition
(A) Phenotypes of three mutants of the wild-type (WT-N) and novel miRNA gene smNRT2.3-1 (smNRT2.3-1-bATG, smNRT2.3-1-aATG, smNRT2.3-1-mATG) under different nitrogen treatment conditions.
(B) The plant heights of three mutants (smNRT2.3-1-bATG, smNRT2.3-1-aATG and smNRT2.3-1-mATG) of wild type (WT-N) and novel miRNA genes smNRT2.3-1 under different nitrogen treatment conditions.
(C) Root length of three mutants (smNRT2.3-1-bATG, smNRT2.3-1-aATG, smNRT2.3-1-mATG) of wild type (WT-N) and novel miRNA gene smNRT2.3-1 under different nitrogen treatment conditions. The data was processed using SPSS 22.0 and STST for the study correlation analysis using Pearson analysis and ANOVA analysis with the criteria for difference determination following the Duncan method (P < 0.05). Related graphs are made by using software such as Excel and Sigmaplot, and standard errors in the paper data are SE values.
FIG. 7: the agronomic nitrogen utilization efficiency of the rice wild type and the miRNA gene smNRT2.3-1 mutant under the field condition.
Wherein 20 plants of each material are recorded as the cell product. The fertilizing amount HN is 350 kg/ha; 0N:90 kg/ha. Under field conditions, in a mature period, three mutants of the gene miRNA smNRT2.3-1 are found to have improved nitrogen utilization efficiency in agriculture compared with a wild type.
FIG. 8 shows partial sequence of IPS1 gene for constructing miRNA mutant, wherein underlined bases are positions of target gene segments of miRNA amplified by nested PCR
Detailed description of the preferred embodiments
First, microRNA sequencing and verification
In the laboratory, three materials of a Nipponbare rice OsNAR2.1 mutant, OsNAR2.1-RNAi, OE-OsNAR2.1 and wild type WT under the condition of normal nitrogen level are taken, a mixed sample of a leaf, a stem, a panicle in a flowering period and three parts is taken and sent to Kangcheng biological company for sequencing, sequencing analysis shows that the wild type Nipponbare has two small RNA enrichment of about 22nt at an intron part of OsNRT2.3b, and two small RNA sequences are obtained through sequencing data and are respectively named as smNRT2.3-1(SEQ ID No.1) and smNRT2.3-2(SEQ ID No. 2). And verifying the sequence of the microRNA by using a stem-loop method to obtain the novel miRNA gene smNRT2.3-1 which really exists.
II, obtaining the mutant material
The research subject group uses a Nipponbare wild type as a background to obtain smNRT2.3-1 and smNRT2.3-2 mutant groups by using a Target mixed mutation technology, extracts DNA, identifies the obtained materials, screens phenotypic strains, and breeds for multiple generations.
The main principle and implementation process of the Target micromicry technology are as follows:
according to the principle of Target mimicry technology created by Jose' Manual Franco-Zorrilla et al (2007), by utilizing nested PCR reaction, designing amplification primers containing BamHI and Sac1 restriction enzymes at two ends, converting the fragment of complementary sequence of miR399 in IPS1 gene into a complementary sequence fragment of novel miRNA selected by us, constructing a mimicry mutant material of novel miRNA, and simultaneously, in a sequencing result, inserting three basic groups of CTA (CTA and IPS1 pairs are added in the construction method) at the position before and 2bp after ATG in the miRNA sequence complementary with IPS1 sequence in order to not destroy ATG because ATG (transcription initiation site) complementary pairing just exists at the shearing site in the sequence fragment of novel miRNA smNRT2.3-1, and IPS1 sequence complementary pairing at the shearing site, and constructing CTA before and after 2bp of ATG (CTA and IPS1 pairing is added in the construction method), and inserting CTA before ATG-2 bp, and constructing CTA-BsmG (CTA-2 bp-CTA-2-BsAg), smNRT2.3-1-mATG (CTA insertion site between ATGs) and smNRT2.3-1-aATG (CTA insertion site 2bp after ATG). The specific process is as follows: the target sequence in IPS1 is changed into a complementary sequence of novel miRNA smNRT2.3-1-bATG, smNRT2.3-1-mATG and smNRT2.3-1-aATG through a nested PCR reaction, an IPS1 sequence amplification fragment containing the complementary sequence of novel miRNA smNRT2.3-1-bATG, smNRT2.3-1-mATG and smNRT2.3-1-aATG and a final vector sequence CUB vector (SEQ ID NO.24) which are generated through amplification of the nested PCR reaction are simultaneously digested for 3 hours in a 37-degree water bath by BamHI and Sac1 restriction endonuclease, the IPS1 sequence fragment and the CUB vector which are cut are recovered through gel, respectively connected with a pEASY-blunt cloning vector, a positive clone is taken out and sent, the IPS1 sequence fragment which is correctly sequenced and the CUB vector are transferred into a pEASY-blunt cloning vector according to a molar ratio of 7: 4, and then the Escherichia coli strain is added into a continuous product, and (3) coating an LB plate with Kan resistance for 8-12 hours, selecting and sequencing a single clone, and preserving bacteria for later use after positive clone plasmids pass sequencing. Successfully constructed coliform bacteria liquid and 30% of glycerol 1: 1, mixing, and storing in a refrigerator at-70 ℃. And transferring a part of plasmid with correct sequencing into agrobacterium by an electric shock method, and performing tissue culture to obtain a mutant plant.
The partial sequence of the IPS1 gene used for constructing miRNA mutants is shown in fig. 8, in which the underlined part is the position of the miRNA target gene fragment amplified by nested PCR.
Three constructed mutation sequences of novel miRNA gene smNRT2.3-1:
smNRT2.3-1-bATG (CTA insertion site 2bp before ATG):
GCTTAGCCTCTACC ATCTCCAACACGT (SEQ ID NO.3, normal CTA between italic positionsInsertion site, but to protect the ATG from cleavage, the mutant sequence insertion site was moved 2bp before the ATG) smNRT2.3-1-mATG (CTA insertion site between ATG):
GCTTAGCCTCC CTAATCTCCAACACGT(SEQ ID NO.4)
smNRT2.3-1-aATG (CTA insertion site 2bp after ATG):
GCTTAGCCTCCATCTACTCCAACACGT (SEQ ID NO.5, normal CTA insertion site between italic positions, but in order to protect ATG from being cut, the mutant sequence insertion site is moved 2bp behind ATG) primers and reaction processes for converting the target sequence in IPS1 into the complementary sequences of novel miRNAs smNRT2.3-1, smNRT2.3-ATG and smNRT2.3-1-ATG by nested PCR are as follows:
smNRT2.3-1-bATG：
first round two pairs of PCR primers:
a first pair of primers:
MIMIC-IPS1-F：CGCGGATCCAAGAAAAATGGCCATCCCCTAGC(SEQ ID NO.6)
smNRT2.3-1-bATG-R:ACGTGTTGGAGATTAGGGAGGCTAAGCTTTCTAGAGG(SEQ ID NO.7)
a second pair of primers:
MIMIC-IPS1-R：GCGGAGCTCAAGAGGAATTCACTATAAAGAG(SEQ ID NO.8)
smNRT2.3-1-bATG-F: GCTTAGCCTCTACCATCTCCAACACGTAGCTTCGGTTCC (SEQ ID NO.9) the substrates for the first round of PCR were all partial fragments of the IPS1 gene using the enzyme TOYOBO high-success-rate PCR enzyme KOD FX.
The reaction procedure is as follows:
①
②
the PCR reaction conditions were: pre-denaturation at 95 ℃ for 2 min; denaturation at 98 degrees for 20s, annealing at 55 degrees for 30s, extension at 68 degrees for 30s, and 35 cycles; the 72 degree extension was again 7 min. And detecting the PCR result by 1% agarose gel electrophoresis. Second round PCR primers:
MIMIC-IPS1-F：CGCGGATCCAAGAAAAATGGCCATCCCCTAGC(SEQ ID NO.10)
MIMIC-IPS1-R：GCGGAGCTCAAGAGGAATTCACTATAAAGAG(SEQ ID NO.11)
the substrate for the second round of PCR reaction is the product of the first round of two PCR reactions, and the enzyme used is the high power PCR enzyme KOD FX from TOYOBO.
The reaction procedure is as follows:
the reaction procedure was as above.
Through the two PCR reactions, the target sequence in the IPS1 can be changed into a complementary sequence of novel miRNA smNRT2.3-1-bATG.
smNRT2.3-1-aATG：
First round two pairs of PCR primers:
a first pair of primers:
MIMIC-IPS1-F：CGCGGATCCAAGAAAAATGGCCATCCCCTAGC(SEQ ID NO.12)
smNRT2.3-1-aATG-R:ACGTGTTGGAGATTAGGGAGGCTAAGCTTTCTAGAGGGAGATAAACAAAA (SEQ ID NO.13)
a second pair of primers:
MIMIC-IPS1-R：GCGGAGCTCAAGAGGAATTCACTATAAAGAG(SEQ ID NO.14)
smNRT2.3-1-aATG-F：GCTTAGCCTCCATCTACTCCAACACGTAGCTTCGGTTCCCCTCGGAATCA (SEQ ID NO.15)
second round PCR primers:
MIMIC-IPS1-F：CGCGGATCCAAGAAAAATGGCCATCCCCTAGC(SEQ ID NO.16)
MIMIC-IPS1-R：GCGGAGCTCAAGAGGAATTCACTATAAAGAG(SEQ ID NO.17)
smNRT2.3-1-mATG：
first round two pairs of PCR primers:
a first pair of primers:
MIMIC-IPS1-F：CGCGGATCCAAGAAAAATGGCCATCCCCTAGC(SEQ ID NO.18)
smNRT2.3-1-mATG-R:ACGTGTTGGAGATTAGGGAGGCTAAGCTTTCTAGAGGGAGATAAACAAAA (SEQ ID NO.19)
a second pair of primers:
MIMIC-IPS1-R：GCGGAGCTCAAGAGGAATTCACTATAAAGAG(SEQ ID NO.20)
smNRT2.3-1-mATG-F：GCTTAGCCTCCCTAATCTCCAACACGTAGCTTCGGTTCCCCTCGGAATCA (SEQ ID NO.21)
second round PCR primers:
MIMIC-IPS1-F：CGCGGATCCAAGAAAAATGGCCATCCCCTAGC(SEQ ID NO.22)
MIMIC-IPS1-R：GCGGAGCTCAAGAGGAATTCACTATAAAGAG(SEQ ID NO.23)
the process of converting the target sequence in IPS1 into the complementary sequence of novel miRNA smNRT2.3-1-bATG through the nested PCR reaction of novel miRNA smNRT2.3-1-mATG and smNRT2.3-1-aATG is completely consistent with the nested PCR reaction process of novel miRNA smNRT2.3-1-bATG, and thus, the details are not repeated.
Extraction of rice genome DNA
When the rice seedlings grow to 3-leaf stage, weighing about 0.1g of leaves, grinding with liquid nitrogen, fully grinding, adding into a 2ml centrifuge tube, quickly adding 1ml of DNA extracting solution (purchased from TIANGEN, China), fully shaking up and oscillating, extracting the genomic DNA of the wild type Nipponbare rice and smNRT2.3-1 mutant of the rice, and screening and verifying positive seedlings.
Fourth, statistics of field phenotype of mutant strain
At each stage during the growth of rice, corresponding wild type and mutant were selected for photography and recording of phenotypic data. The results are shown in FIG. 4, from which FIG. 4 can be seen: under different nitrogen conditions (0N 75kg/ha, LN 150kg/ha, MN 250kg/ha, HN 350kg/ha), two mutants (smNRT2.3-1-bATG, smNRT2.3-1-mATG) of the novel miRNA gene smNRT2.3-1 approximately coincide with the heading time of Nippon clear wild-type (WT-N), while the heading time of the other mutant (smNRT2.3-1-aATG) is about two weeks later than that of the wild-type, which indicates that the IPS1 can delay heading by shearing ATG in the sequence of the novel miRNA gene smT2.3-1.
Fifth, laboratory mutant hydroponic experiment
In a sterile super clean bench, firstly, wild type and mutant material rice seeds are soaked and sterilized in 70-75% (v/v) alcohol solution for one minute, then surface sterilization is carried out in 30% (v/v) NaClO solution for 30 minutes, then the rice seeds are cleaned by sterilized deionized water, the rice seeds are placed in a culture dish for drying, the rice seeds are placed on 1/2MS culture medium for germination in dark environment at 25 ℃ for 3 days till exposure to the white, and then the rice seeds are cultured in the following artificial climate chambers for 5 days again: the light cycle of 14 hours light/10 hours dark light and the temperature of day/night are 30 ℃/24 ℃, and the relative humidity is controlled to be about 60 percent. The air in the growth chamber was refreshed every 6 hours. Hydroponic experiments were performed using normal rice nutrient solutions from IRRI. 20 seedlings were cultured in each culture vessel having a size of 320mm × 215mm × 105mm containing 7L of the nutrient solution, and the solution was changed every two days with the pH of the nutrient solution being controlled between 5.0 and 5.5. After germination for 10 days, rice seedlings with almost consistent growth vigor grow to three leaves and one core in full-strength culture solutions of 1/8, 1/4, 1/2 and 1.25mM NH4NO3 in sequence. The seedlings were then grown in nitrogen-deficient nutrient solution for 3 days. Followed by treatment with different concentrations of calcium nitrate or ammonium sulfate for 1 week. After one week of treatment, the seedlings were photographed under different nitrogen morphologies and nitrogen concentration treatment conditions, respectively, and phenotype was collected, and the results are shown in FIG. 6. As can be seen from FIG. 6, the mutants smNRT2.3-1-bATG, smNRT2.3-1-aATG and smNRT2.3-1-mATG showed an increased tendency of aerial parts and a less difference in root length compared to the wild type under the different nitrogen treatment conditions at the seedling stage.
Sequence listing
<110> Nanjing university of agriculture
Application of <120> rice miRNA gene smNRT2.3-1
<160> 23
<170> SIPOSequenceListing 1.0
<210> 1
<211> 24
<212> DNA
<213> Rice (Oryza sativa)
<400> 1
acgtgttgga gatggaggct aagc 24
<210> 2
<211> 24
<212> DNA
<213> Rice (Oryza sativa)
<400> 2
aggcgacgga gttctggctc ttct 24
<210> 3
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gcttagcctc taccatctcc aacacgt 27
<210> 4
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gcttagcctc cctaatctcc aacacgt 27
<210> 5
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
gcttagcctc catctactcc aacacgt 27
<210> 6
<211> 32
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
cgcggatcca agaaaaatgg ccatccccta gc 32
<210> 7
<211> 37
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
acgtgttgga gattagggag gctaagcttt ctagagg 37
<210> 8
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
gcggagctca agaggaattc actataaaga g 31
<210> 9
<211> 39
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
gcttagcctc taccatctcc aacacgtagc ttcggttcc 39
<210> 10
<211> 32
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
cgcggatcca agaaaaatgg ccatccccta gc 32
<210> 11
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
gcggagctca agaggaattc actataaaga g 31
<210> 12
<211> 32
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
cgcggatcca agaaaaatgg ccatccccta gc 32
<210> 13
<211> 50
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
acgtgttgga gattagggag gctaagcttt ctagagggag ataaacaaaa 50
<210> 14
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
gcggagctca agaggaattc actataaaga g 31
<210> 15
<211> 50
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
gcttagcctc catctactcc aacacgtagc ttcggttccc ctcggaatca 50
<210> 16
<211> 32
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
cgcggatcca agaaaaatgg ccatccccta gc 32
<210> 17
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
gcggagctca agaggaattc actataaaga g 31
<210> 18
<211> 32
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
cgcggatcca agaaaaatgg ccatccccta gc 32
<210> 19
<211> 50
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
acgtgttgga gattagggag gctaagcttt ctagagggag ataaacaaaa 50
<210> 20
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
gcggagctca agaggaattc actataaaga g 31
<210> 21
<211> 50
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
gcttagcctc cctaatctcc aacacgtagc ttcggttccc ctcggaatca 50
<210> 22
<211> 32
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
cgcggatcca agaaaaatgg ccatccccta gc 32
<210> 23
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 23
gcggagctca agaggaattc actataaaga g 31
Claims (2)
1. The application of the rice miRNA smNRT2.3-1 in regulation and control of rice heading time, nitrogen utilization efficiency and plant height is disclosed, wherein the nucleotide sequence of the rice miRNA smNRT2.3-1 is shown as SEQ ID No. 1.
2. The use according to claim 1, characterized in that the encoding gene of the miRNA according to claim 1 is silenced, knocked out or mutated by genetic engineering means, so as to delay the heading time of rice and increase the utilization efficiency of agricultural nitrogen and the plant height.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011319865.6A CN112501195B (en) | 2020-11-23 | 2020-11-23 | Application of rice miRNA gene smNRT2.3-1 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011319865.6A CN112501195B (en) | 2020-11-23 | 2020-11-23 | Application of rice miRNA gene smNRT2.3-1 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112501195A CN112501195A (en) | 2021-03-16 |
| CN112501195B true CN112501195B (en) | 2022-09-13 |
Family
ID=74959379
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011319865.6A Active CN112501195B (en) | 2020-11-23 | 2020-11-23 | Application of rice miRNA gene smNRT2.3-1 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112501195B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108587963A (en) * | 2018-05-02 | 2018-09-28 | 山东农业大学 | One plant of Lysinibacillus macroides screened from manioc waste and its application |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102586277B (en) * | 2012-03-05 | 2014-04-16 | 南京农业大学 | Set of DTH2 genes for controlling heading stage of paddy rice and haplotypes and application thereof |
| CN104995304B (en) * | 2013-02-05 | 2022-07-26 | 植物生物科学有限公司 | Transgenic plants |
| WO2014121436A1 (en) * | 2013-02-05 | 2014-08-14 | Plant Bioscience Limited | Transgenic plants |
| CN104263730B (en) * | 2014-09-30 | 2017-01-18 | 中国计量学院 | miRNA of rice and precursor gene of miRNA, and applications of miRNA in breeding of cadmium sensitive transgenic rice |
| CN109679949B (en) * | 2018-08-30 | 2022-05-17 | 南京农业大学 | Breeding method for regulating miR156 and target gene IPA1 thereof and simultaneously improving disease resistance and yield of rice |
-
2020
- 2020-11-23 CN CN202011319865.6A patent/CN112501195B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108587963A (en) * | 2018-05-02 | 2018-09-28 | 山东农业大学 | One plant of Lysinibacillus macroides screened from manioc waste and its application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112501195A (en) | 2021-03-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113337520B (en) | Upland cotton GhA0749 and GhD0744 transcription factors and application thereof in flowering regulation | |
| CN108977445B (en) | Application of Arabidopsis thaliana microRNA400 in regulation and control of cadmium tolerance of plants | |
| CN109825501B (en) | Long-chain non-coding RNA T5120 from arabidopsis thaliana and application thereof | |
| CN110904106B (en) | Application of cymbidium goeringii miR159b in enhancing plant cold sensitivity | |
| CN108192913A (en) | A kind of method for improving plant abiotic stress resistance | |
| CN108424910B (en) | RNA fragment for target gene interference and application thereof | |
| CN112501195B (en) | Application of rice miRNA gene smNRT2.3-1 | |
| CN109852634A (en) | A method of cultivating high nodulation and nitrogen fixation genetically modified plants | |
| CN112513274B (en) | Application of miR396 or mutant of encoding gene thereof | |
| CN102559676B (en) | Rice root specific promoter and application thereof | |
| CN105039279A (en) | Protein kinase in arabidopsis thaliana, coding gene and application of coding gene | |
| CN115094070A (en) | Discovery method and application of corn salt-tolerant gene Zm00001d033878 | |
| CN102533760A (en) | Small-molecule ribonucleic acid (RNA) Osa-miR393 for improving rice tillering and application | |
| CN111793625A (en) | Oligo DNA group of sgRNA for site-directed knockout of rice OsAUR2 gene | |
| CN110964729A (en) | Cloning method, application and application method of common wheat gene TaSNX1 | |
| CN104805065B (en) | A kind of paddy rice histone deacetylase and its encoding gene and application | |
| CN115786361B (en) | New application of wheat TaCBF B gene | |
| CN116410985B (en) | Wheat TaNF-YB3D gene, alternative splicing form and application thereof | |
| CN113637679B (en) | Stress-resistant plant gene and application thereof | |
| CN116751812B (en) | Application of OsABI gene in enhancing nitrogen deficiency stress resistance of rice | |
| CN117402877B (en) | Application of long-chain non-coding RNA NATAL to regulation of rice yield-related traits | |
| CN110863006B (en) | Method for improving tillering and regeneration of rice | |
| CN111187780B (en) | Genetic engineering application of rice potassium ion transport protein gene OsHAK18 | |
| CN105112443A (en) | Genetic engineering application for rice potassium ion transport protein gene OsHAK5 | |
| CN116218856A (en) | miRNA for regulating and controlling plant cold resistance and salt resistance and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |