CN104263730B - miRNA of rice and precursor gene of miRNA, and applications of miRNA in breeding of cadmium sensitive transgenic rice - Google Patents
miRNA of rice and precursor gene of miRNA, and applications of miRNA in breeding of cadmium sensitive transgenic rice Download PDFInfo
- Publication number
- CN104263730B CN104263730B CN201410519370.6A CN201410519370A CN104263730B CN 104263730 B CN104263730 B CN 104263730B CN 201410519370 A CN201410519370 A CN 201410519370A CN 104263730 B CN104263730 B CN 104263730B
- Authority
- CN
- China
- Prior art keywords
- mir268
- rice
- dna
- mirna
- centrifuged
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention relates to the field of rice gene biology, and particularly relates to a miRNA of rice and a precursor gene of the miRNA, and applications of the miRNA in the breeding of cadmium sensitive transgenic rice. The base sequence of the miRNA of rice is shown in SEQ ID NO.1. According to the invention, the miR268 of rice is converted to a rice callus, and an obtained T2-generation seed is sowed in a cadmium-containing culture medium, then a fact that a rice plant overexpressing the miR268 is sensitive to cadmium is found. According to the invention, a precursor gene containing the miRNA of rice is connected to a carrier, then the obtained product is converted to the rice callus in an agrobacterium tumefaciens mediated mode, and by screening and culturing, a homozygous rice transgenic strain is obtained. By means of transgenosis, the fact that miRNA has an effect of significantly increasing the sensibility of rice to cadmium is found.
Description
Technical field
The present invention relates to paddy gene biological field, more particularly, to a kind of mirna of Oryza sativa L. and its precursor-gene and they
Breeding to cadmium sensitivity transgenic paddy rice is applied.
Background technology
In recent years, with the continuous development of China's industrialization and urbanization process, the soil pollution situation that heavy metal causes
Increasingly severe, the sustainable development healthy and agriculture to the ecological environment of China, food safety, the common people constitutes serious prestige
The side of body.It is reported that, the whole nation reaches 12,000,000 tons because of heavy metal pollution grain every year, causes direct economic loss more than 20,000,000,000 yuan.This year
CPPCC's " motion " explicitly points out that China's agricultural development pattern is extensive, and pollution is on the rise, whole nation arable land heavy metal pollution face
Amass more than 16%, big city, industrial and mining area periphery situation are even more serious.As Guangdong Province's cleaning soil only has 11%, slight pollution
Account for the 77% of total quantity of cultivated land, serious pollution soil accounts for the 12% of total amount；Taihu Lake basin, about 1/3rd arable land is subject to dirt
Dye；Hubei Province is reached 400,000 hectares by the cultivated area of three-waste pollution, accounts for the 10% of the whole province's cultivated area；Hunan cold water river
Seriously polluted, more than 37% times of rice terrace heavy metals exceeding standard；Zhejiang Province is reached 33.33 ten thousand hectares by the cultivated area of three-waste pollution, accounts for
More than the 20% of the whole province total cultivated area, Taizhou plain road and bridge, Wenling, Yuhuan three ground are put into national heavy metal keypoint control area
Domain.It can be seen that, the heavy metal pollution problem of China's soil is quite serious, and development green agriculture is very urgent.
Oryza sativa L. is most important crops in the world, and with rice as staple food, China is the world to the global population of more than half
The first rice big country upper, in current China rice, heavy metals exceeding standard phenomenon has caused the great attention of national each ministries and commissions.With much money
Belong to and be difficult to exclude once entering Soil-rice System.Excessive heavy metal is long-pending in the root of Oryza sativa L., stem, leaf and seed
Tired, the not only quality of impact Oryza sativa L., yield and farmland ecosystem, and human body can be entered by food chain, cause multiple diseases,
Finally it is detrimental to health.The edible food suffering cadmium pollution, is likely to result in cadmium in people's cylinder accumulation, causes injury of kidney,
Osteomalacia etc. can be led to.Japan's famous " itai-itai ", that is, nineteen fifty occurs the poisoning in Toyama County, Japan is exactly cadmium
Caused by pollution.Therefore, physiology and the molecule mechanism of the absorption of Oryza sativa L. heavy metal, transhipment rule and Heavy Metal Tolerance are verified, light
Carry out the safety in production of crops in the soil of degree heavy metal pollution, and carry out the reparation of massive pollution soil using plant,
This promotes the Significance of Sustainable Development of agricultural production great Ensuring Food Safety, ecological safety and people's health.But this
The enforcement envisioned depends on the Molecular Physiological Mechanism of the absorption of crop heavy metal, the understanding of transhipment rule and heavy metal patience
Disclose.Plant heavy metallic poison is many, and the resistance mechanism of its heavy metal is also sufficiently complex, limits a huge sum of money including plant
Belong to ionic absorption, heavy metal is combined with extra-corporeal secretions, the outer row of heavy metal, root system is enriched with, cell wall fetters, across plasma membrane, liquid
Vacuolar membrane is transported, antioxidation response etc..Wherein, organic acid, aminoacid, nitrogen-containing compound, phytochelatin (phytochelatin,
) and metallothionein (mt) etc. has played critical function in the Detoxication of plant heavy metal pc.Some are with plant with much money
Belong to the description that the related gene of patience has also obtained identification and function, they essentially directly participate in the effect of metabolism and physiological change
Answer gene, participate in degeneration-resistant process by controlling the expression of metabolism small molecule or albumen.It is generally acknowledged that the heavy metal stress of plant should
Answering mechanism is probably by controlled by multiple genes, and the heavy metallic poison of plant and its toleration are the comprehensive anti-of various physiological processes
Should, but wherein what is that key factor is not known so far.
Micro- rna (microrna, or mirna) is a kind of small molecule rna of new controlling gene expression, mainly in transcription
The expression of horizontal negative regulation target gene afterwards.In plant, mirna passes through to regulate and control the expression of its target gene, the growth of wide participation plant
Growth, cellular metabolism, organ morphology are built up, the process such as hormone secretion, signal transduction, stress response.Recent studies indicate that,
Mirna plays key player in plant heavy metal stress response process.In the model plant M. truncatula of pulse family, part
The expression of mirna can by heavy metal cadmium, hydrargyrum, the induction of aluminum with adjust (zhao, s.z., si, q.h., zhi,
m.y.bioinformatic identification and expression analysis of new micrornas
from medicago truncatula.biochem.biophys.res.commun,2008,374:538–542.).In Caulis et Folium Brassicae capitatae
In type Brassica campestris L, the expression of mir156, mir171, mir393 and mir396a suppressed by cadmium (xie, f.l., huang,
s.q.,guo,k.,xiang,a.l.,zhu,y.y.,nie,l.,yang,z.m.computational identification
of novel micrornas and targets in brassica napus.febs lett,2007,581:1464–
1474.).Huang etc. (2009) builds the small rna library of rice seedling under Cd stress, has cloned 19 new mirna,
And find that wherein most mirna express under Cd stress and change.Under in rice seedling root, mir604 expresses under Cadmium treated
Adjust, the expression of its target gene lipid transfer proteins rises.And the multiple resistance of lipid transfer proteins involved in plant is reacted and mediated plant swashs
The processes such as plain signal transduction (huang, s.q., peng, j., qiu, c.x., yang, z.m.heavy metal-regulated
new micrornas from rice.j.inorg.biochem,2009,103:282e287.).Kong etc. (2010) is intending south
In mustard, clone obtains 8 mirnas related to Fe Deficiency, their equal up-regulateds under the conditions of iron deficiency, and wherein 5
The promoter region of mirna upstream region of gene is predicted exist iron deficiency abduction delivering controlling element (ide1/ide2) (kong, w.,
yang,z.m.identification of iron-deficiency responsive microrna genes and cis-
elements in arabidopsis.plant physiol.biochem,2010,48:153e159.).Sunkar etc.
(2006) research finds that mir398 plays a role in the oxidative stresses such as arabidopsiss opposing high light, heavy metal cu, fe: in the oxidation side of body
Under the conditions of compeling, the expression of mir398 is induced to reduce, cu/zn superoxide dismutase (csds) mrna's of mir398 regulation and control
Expression raises, and superoxides rapidly can be transformed into peroxide and molecular oxygen, constitute by cu/zn superoxide dismutase
The first line of defence of opposing high toxicity superoxides, leads to the toleration of arabidopsiss heavy metal stress also to greatly increase
(sunkar,r.,kapoor,a.,zhu,j.k.posttranscriptional induction of two cu/zn
superoxide dismutase genes in arabidopsis is mediated by downregulation of
mir398and important for oxidative stress tolerance.plant cell,2006,18:2051–
2065.).
Content of the invention
First purpose of the present invention is to provide a kind of mirna of Oryza sativa L., and second object of the present invention is that offer is above-mentioned
The mirna of Oryza sativa L. precursor-gene, third object of the present invention is to provide the above-mentioned mirna of Oryza sativa L. and precursor-gene
Application, fourth object of the present invention is to provide a kind of breeding method having to cadmium sensitivity transgenic paddy rice.
In order to realize above-mentioned first purpose, present invention employs following technical scheme:
A kind of mirna of Oryza sativa L., its base sequence is as shown in seq id no.1.
In order to realize above-mentioned second purpose, present invention employs following technical scheme:
The precursor-gene of the mirna of above-mentioned Oryza sativa L., the base sequence of precursor-gene is as shown in seq id no.2.
In order to realize above-mentioned the 3rd purpose, present invention employs following technical scheme:
The invention also discloses the mirna of above-mentioned Oryza sativa L. or precursor-gene are in Oryza sativa L. Cd stress response regulatory mechanism
Application.
The invention also discloses the pmd19-t carrier of above-mentioned precursor-gene.
The invention also discloses the plasmid of above-mentioned precursor-gene.
The invention also discloses the Agrobacterium competent cell eha105 of above-mentioned precursor-gene.
In order to realize above-mentioned the 4th purpose, present invention employs following technical scheme:
A kind of breeding method having to cadmium sensitivity transgenic paddy rice, the method comprises the following steps: above-mentioned by comprising
Precursor-gene be connected on carrier, by agrobacterium mediation converted to Rice Callus, screening and culturing, obtain the water of homozygosis
Rice transgenic line.
The invention provides a kind of application in Oryza sativa L. Cd stress response regulatory mechanism for mirna.
(or: application in Oryza sativa L. Cd stress response regulatory mechanism for the mir268).
The base sequence of described Oryza sativa L. mirna is as shown in seq id no.1.
Preferably, described plant is Oryza sativa L..
The precursor-gene comprising described Oryza sativa L. mirna is connected on carrier, is healed to Oryza sativa L. by agrobacterium mediation converted
Injured tissue, screening and culturing, obtain the Transgenic Rice strain of homozygosis.
Because mirna sequence itself is very short, only 20 several bp, and precursor sequence is relatively long, is connected on carrier, has
Realize it is preferred that the base sequence of described precursor-gene is as shown in seq id no.2 beneficial to conversion.
The present invention, by Oryza sativa L. mir268 is transformed into Rice Callus, the t2 of acquisition is being trained containing cadmium for seed sowing
In foster base, find that the rice plant of overexpression mir268 is sensitive to cadmium.
Our seminars utilize high flux, high specific and the method such as highly sensitive mirna chip and bioinformatics,
In rice seedling root screening obtain a kind of new mirna mir268 (this be according to chip probe information oneself name
, also there is no this mirna in data base) express under Cd stress and significantly raised.And tested further using rt-pcr
Demonstrate,prove this result it was confirmed differential expression under Cd stress for the mir268.Through miru software prediction, the target gene of mir268 is
Natural resistance associated macrophages albumen (nramp).Fluorescent quantitation pcr detection mir268 and its target gene nramp is in Cd stress
Under expression, find that the expression of mir268 and nramp has shifting relation, thus experimental verification nramp is
The target gene of mir268.Nramp member generally existing, bivalent metal ion such as responsible manganese, zinc, copper, ferrum, cadmium in various biologies
Transport.In Oryza sativa L., there are 5 members in nramp family, and they are the important members in plant heavy metal response to network.There is research report
Road display nramp5 is mainly responsible for manganese and Cd uptake and transport, and while reducing cadmium content, manganese content also declines to a great extent
(sasaki,a.,yamaji,n.,yokosho,k.,ma,j.f.nramp5is a major transporter
responsible for manganese and cadmium uptake in rice.plant cell,2012,24:2155-
2167.)
The present invention and then be connected on carrier by comprising the precursor-gene of described Oryza sativa L. mirna, by agriculture bacillus mediated
It is transformed into Rice Callus, screening and culturing, obtain the Transgenic Rice strain of homozygosis.Being found by transgenic approach should
Mirna has the effect dramatically increasing Oryza sativa L. to cadmium sensitivity.
Brief description
Fig. 1 is the mirna chip collection of illustrative plates that 7 day age rice seedling 60um cd coerces 6h root, and (cy3 compares；Cy5 processes sample
Product)；
Fig. 2 is rt pcr figure (the control comparison of mir268 in the lower 6h root of 60 μm of cd stress of 7 day age rice seedling；cd
Process sample)；
The process gel pattern that Fig. 3 builds for mir268 over-express vector.A.mir268 precursor pcr expands gel pattern；
B.pmd19-t-mir268 plasmid enzyme restriction qualification figure；C.p1301-mir268 recombiant plasmid bacterium solution pcr expands gel pattern；
D.p1301-mir268 recombiant plasmid enzyme action qualification figure；
Fig. 4 is phenotype after mir268 overexpression rice paddy seed sprouts 7d under 60um cd process, and (wt compares；35s:
Mir268 transgenic paddy rice)；
Specific embodiment
The acquisition of embodiment 1 gene
With seven days seedling age seedling of wild rice (in spend 11) as material, take 60um cdcl2Process 6h and matched group are (not
Process) root 0.1g, with liquid nitrogen grinding and add 1ml trizol (invitrogen production) to continue to be ground to homogenate, proceed to
In 1.5ml centrifuge tube, 12000 × g is centrifuged 10min, collects supernatant to new centrifuge tube.Room temperature places 5min, adds 0.2ml chlorine
Imitative firmly concussion 15s, makes solution fully mix.Room temperature places 5min, and 12000 × g is centrifuged 15min, collects supernatant.Plus in twice
The isopropanol of clear volume, -20 DEG C of overnight precipitation.12000 × g is centrifuged 10min, removes supernatant, plus 75% ethanol of 1ml pre-cooling
(depc-h2O prepares) wash precipitation.12000 × g is centrifuged 10min, liquid to the greatest extent, drying at room temperature 5min, and precipitation is dissolved in 50 μ l again
Depc (pyrocarbonic acid diethyl ester) water.Take 2 μ g total rna to carry out electrophoresis detection, and dilute sample surveys od260/280, od
260/230 and concentration.Using the total rna sample of 2-5 μ g, fragment is obtained by the micro- centrifugal filtration post of ym-100 (millipore) little
Little rna in 300nt.Poly (a) polymerase adds poly (a) tail at the little rna 3 ＇ end being separated to, then by an oligomerization
Nucleotide marker is connected with this poly (a) tail, and (ligation) is used for follow-up fluorescent labeling.With two different labellings
Thing cy3 and cy5 carrys out two rna samples of labelling treatment group and matched group.
The 2100 mirna sequences predicted using lindow etc. (2007) and Oryza sativa L. mirna data base (mirbase
Release 11.0, http://microrna.sanger.ac.uk) in mirna sequence, fabricated in situ mirna chip, inspection
Survey the expression that the growth regulation Oryza sativa L. of seven days coerces mirna in 6h root tissue in heavy metal cadmium.Through 7 after 60 μm of Cadmium treated 6h
The root of its age rice seedling, extracts total rna using trizol method, after purification mirna, fluorescent labeling, and and mirna chip hybridization,
Through chip scanning, data collection and analysis, find expression and raise or lower more significant mirna.Chip results show (figure
1), in the mirna of lindow etc. (2007) Bioinformatics Prediction, mir268 expression ratio after cd processes 6h compares (not
Process) improve more than 2 times.
According to tigr data base, find that Oryza sativa L. mir268 is located at No. 4 chromosomes, from intergenic region.Mature sequence
As shown in seq id no.1, precursor sequence is as shown in seq id no.2.
Mature sequence ccagtcaggggctcgttgctgg
Precursor sequence
tggtttccagccgggggctcctgattagcaccgactctagcttcggctgactggtttccagtcaggggctcgttgct
gggttcta(85bp)
According to miru microRNA target prediction software discovery mir268 targeting natural resistance associated macrophages albumen (nramp).
And expression under Cd stress for mir268 and nramp is detected using fluorescent quantitation pcr, finds the expression of mir268 and nramp
There is shifting relation, thus experimental verification nramp is the target gene (Fig. 2) of mir268.
Concrete operations are as follows:
With seven days seedling age seedling of wild rice (in spend 11) as material, take 60um cdcl2Process 6h and matched group are (not
Process) root adopt trizol method extract rna, and with rnase-free dnase i (takara) digestion with remove dna pollute.
Use reverse transcription reagent box primescripttm1stStrand cdna synthesis kit (takara) reverse transcription becomes cdna.
Reaction system is 20 μ l, respectively 2 μ g rna, 1 μ l oligo dt primer (50 μm), 1 μ l dntp mixture (10mm)
With rnase free h2O to 10 μ l, 65 DEG C of 5min, chilling on ice, then sequentially add 4 μ l 5 × primescript
Buffer, 0.5 μ l rnase inhibitor (40u/ μ l), 1 μ l primescript rtase (200u/ μ l) and 4.5 μ l
rnase free dh2O, slight mix homogeneously, 42 DEG C of 60min, 70 DEG C of 15min, last -20 DEG C of preservations.Then with the first chain
Cdna expands mir268 and nramp, pcr response procedures: denaturation, 95 DEG C of 1min for template；Pcr reacts, the first step: 94 DEG C of changes
Property 10s；Second step: 55 DEG C of annealing extend 15s；3rd step: 72 DEG C of 15s.Detection fluorescence signal change in annealing process simultaneously,
Carry out 45 circulations altogether.Using 2-△△ctRelative quantification method calculates the relative expression quantity of gene.Using β-actin as internal reference, β-
The forward primer sequence of actin: 5 '-gccgtcctctctctgtatgc-3 ', reverse primer sequences: 5 '-
ggggacagtgtggctgac-3’.The pcr amplimer using is as follows:
Mir268-f, 5 '-gattagcaccgactcta-3 '；
Mir268-r, 5 '-gaagccatctgacatag-3 '；
Nramp (os03g11010) f, 5 '-cttcatctttttattcctg-3 '；
Nramp (os03g11010) r, 5 '-ttgtttgtgtcaatcttcc-3 '.
Embodiment 2 gene cloning and conversion
Spend 11 7 days seedling age seedling dna as template with wild rice, expand mir268 precursor base using pcr method
The sequence of cause.Concrete operations are as follows: first, extract in wild rice and spend 11 7 day age seedling dna.Take about 0.2g rice leaf
Become powder with liquid nitrogen grinding, transfer of powders is to added with 500 μ l extracting solution (100mm tris-hcl, ph 8.0；20mm edta；
500mm nacl) centrifuge tube in, gently mix.Xiang Guanzhong adds 100 μ l 10%sds solution, mixes, 65 DEG C of insulations
20min.Then chlorination imitates/isoamyl alcohol/ethanol (20:1:4) mixed liquor 600 μ l, the static 10min of room temperature.4 DEG C, 12000rpm from
Heart 10min, transfer supernatant is to another centrifuge tube.The dehydrated alcohol adding 1ml pre-cooling fully mixes, -20 DEG C of precipitation dna
20min.4 DEG C, 12000rpm is centrifuged 10min, abandons supernatant, plus 70% ethanol 500 μ l is washed.4 DEG C, 12000rpm is centrifuged
10min, abandons supernatant.Residual liquid is blotted by gentle centrifugation with pipettor.After drying up dna precipitation, it is dissolved in 100 μ l enzymes containing rnase
In (10 μ g/ml) te, 37 DEG C of water-bath 30min, -20 DEG C of preservations.According to mir268 precursor sequence, database consults its institute
In the sequence at the two ends of genomic locus, design primer respectively at the about 50bp of precursor hairpin structure two ends, set primer is as follows:
Mir268-f, 5 '-cggggtacctaacaggagagctggacc-3 '
Mir268-r, 5'-aactgcagcatccgagtgacaatcag-3'
Then with dna as template, using set primer amplification mir268 precursor-gene.Pcr reaction system is 50 μ l, successively
Add dna template 1 μ l, 10 × pcr buffer 5 μ l, 10mm dntps 4 μ l, 10 μm of forward primer (mir268-f) 0.8 μ l,
10 μm of reverse primer (mir268-r) 0.8 μ l, takara taq (5u/ μ l) polymerase 0.5 μ l, finally plus ddh2O mends to 50 μ l.
Pcr reaction condition: 94 DEG C of 5min of denaturation, 94 DEG C of 30s of degeneration, anneal 59 DEG C of 30s, extends 72 DEG C of 30s, and 30 circulate, finally
Extend 72 DEG C of 10min, 4 DEG C of preservations.Pcr product gel collection of illustrative plates is as shown in Fig. 3 .a.
By mir268 precursor-gene dna product after amplification, using the fine jade of TIANGEN Biotech's production
Sepharose dna QIAquick Gel Extraction Kit reclaims, and operation is as follows: dna band is cut from agarose gel and puts into 1.5ml's
In eppendorf pipe, weigh weight.Add 6 times of volume sol solutionses pn, 30min is placed in 50 DEG C of water-baths.Sol solutionses are added absorption
In post ca2, room temperature places 2min, and 12000rpm is centrifuged 60s, outwells the waste liquid in collecting pipe.Add 600 μ l rinsing liquid pw,
12000rpm is centrifuged 60s, outwells the waste liquid in collecting pipe.12000rpm is centrifuged 2min, and room temperature is placed several minutes and thoroughly dried.Will
Adsorption column ca2 is put in a clean centrifuge tube, adds 40 μ l elution buffer eb, it is molten that 12000rpm centrifugation 2min collects dna
Liquid.
The mir268 precursor-gene dna reclaiming is attached reacting with pmd19-t carrier (takara), linked system 10
μ l, is separately added into 0.5 μ l pmd19-t carrier, the dna of mir268 precursor of 4.5 μ l purification, 5 μ l solution i.At 16 DEG C
After connecting 3h, connection product is transformed in escherichia coli dh5 α competent cell.Screened by amp, picking positive colony, warp
Pcr reaction checking and sequencing identification correct after, choose correct bacterium solution and extract plasmid pmd19-mir268.Using the life of Tiangeng company
It is as follows that the little extraction reagent kit of ordinary plasmids producing extracts plasmid operation:
Take 3ml bacterium solution to add in centrifuge tube, 12000rpm is centrifuged 1min, suction out supernatant as far as possible.To leaving bacterial sediment
Centrifuge tube in add the solution p1 (containing rnasea) of 250 μ l, thorough suspended bacterial precipitation.Add 250 μ l solution p2, gentle
Spin upside down 6-8 time and so that thalline is fully cracked.Add 350 μ l solution p3, gentle immediately spins upside down 6-8 time, fully mix,
12000rpm is centrifuged 10min.Collect supernatant, transfer in adsorption column cp3,12000rpm is centrifuged 60s, outwells waste liquid.Add
600 μ l have added the rinsing liquid pw of dehydrated alcohol, and 12000rpm is centrifuged 60s, outwells waste liquid and rinses twice.By adsorption column cp3
Put into collecting pipe, 12000rpm is centrifuged 2min, is placed in room temperature and thoroughly dries.Add 55 μ l elution buffer eb, room temperature is placed
2min, 12000rpm are centrifuged 1min, and plasmid solution is collected in centrifuge tube.
The plasmid pmd19-mir268 extracting and dna binary plasmid carrier pcambia1301 is used takara public simultaneously
Kpni and psti that department produces carries out double digestion.Enzyme action system 50 μ l, including 5 μ l 10 × m buffer, 28 μ l pmd19-
Mir268 plasmid (or pcambia1301 plasmid), 1 μ l kpni, 1 μ l psti and 15 μ l ddh2O, 37 DEG C of water-baths are overnight.
Pmd19-mir268 plasmid enzyme restriction result is as shown in Fig. 3 .b.By dna binary plasmid carrier pcambia1301 and cloned plasmids
After pmd19-mir268 enzyme action, dna fragment is reclaimed in rubber tapping.Then t4 ligase is used to connect, linked system 10 μ l, including 1 μ l
Pcambia1301 carrier, 7.5 μ l mir268dna, 1 μ l 10 × t4 ligase buffer and 0.5 μ l t4 ligase, 16 DEG C of companies
Take over night.Then connection product is transformed in escherichia coli dh5 α competent cell, carries out bacterium solution pcr, and extract plasmid entering
Row enzyme action identifies, result is as shown in Fig. 3 .c and Fig. 3 .d.Correct plant expression vector p1301-mir268 is imported Agrobacterium
Competent cell eha105, operation is as follows: takes 200 μ l Agrobacterium competent cells, adds 1 μ g p1301-mir268 plasmid, mixes
Even, ice bath 5min, quick-freezing 5min in liquid nitrogen, 37 DEG C of water-bath 5min, it is subsequently adding 28 DEG C of renewal cultivation 4h of 1ml ym culture medium.
10000g is centrifuged 30s, abandons supernatant, and suction 200 μ l bacterium solution are coated the ym containing 50mg/l kanamycin and 40 μ g/l rifampicin and put down
Plate, 28 DEG C of cultures, grow Agrobacterium single bacterium colony after about 48h.Shake bacterium, extract Agrobacterium plasmid dna and again proceed to escherichia coli dh5
In α, then extract plasmid and carry out enzyme action identification.
Identified correct positive plasmid p1301-mir268, by Agrobacterium-mediated transformation to rice callus.Operation
As follows: activate Agrobacterium first, the ym culture medium of kanamycin containing 50mg/l and 40mg/l rifampicin is rule, 28 DEG C of dark trainings
Support.Collect Agrobacterium thalline, be suspended in containing in 200 μm the aam fluid suspension culture base of acyl syringone (as).Adjustment
Cell concentration is 0.8～1.0 to od600, pours the aseptic triangular flask containing the successive transfer culture Rice Callus of 1 week into, infects
10min, and frequently rock.Then calluss are placed on aseptic filter paper and drain after 30min, be placed in and be covered with one layer of aseptic filter
On the solid co-cultivation medium of paper, 25 DEG C of light culture 3 days.Calluss sterile water wash 5-6 time after co-culturing, then
With the sterile water wash containing 500mg/l cefradine 1～2 time, it is placed on aseptic filter paper and drains 1 hour.The wound healing dried is turned
Enter and first round selection is carried out on cefradine containing 500mg/l and the Selective agar medium of 50mg/l hygromycin, 28 DEG C, light culture 14
My god.Then the initial wound healing of long resistant wound healing is gone to new cefradine containing 500mg/l and the culture of 50mg/l hygromycin
Second wheel selection is carried out on base, 28 DEG C, illumination cultivation, until the resistant calli of graininess grows.Growth selection is vigorous
Resistant calli is transferred on the division culture medium containing hygromycin, in 25 DEG C, cultivates under 12h illumination/12h dark condition.
When seedling to be regenerated grows up to that about 1cm is high, it is moved into strong sprout on root media, 25 DEG C, trains under 12h illumination/12h dark condition
Support.Finally transgenic seedling is chosen, add appropriate distilled water seedling exercising 3 days to a week about, wash away agar, incubator water planting 1 week,
It is transplanted to growth in the native alms bowl in greenhouse.Select the normal plant of growth, carry out the screening of hygromycin pcr and gus dyeing, obtain positive
T0 is for plant, totally 21 strains.Harvest t1 and for seed breeding and identify the transgenic line obtaining homozygosis to t2 generation.
The adjusting function identification of embodiment 3mirna Cd stress response
Take t2 for transgenic line seed and the middle seed spending 11 wild types, 1% dilute hno3Broken dormancy processes 16h.Go
Dilute hno3, after 10%naclo (effective chlorine about 1～1.2%) sterilization 20min, use distilled water flushing.Seed is immersed in water, 37
DEG C dark place accelerating germination about two days, then in the culture dish being covered with moistening filter paper culture one day to showing money or valuables one carries unintentionally.Select consistent the showing money or valuables one carries unintentionally of growth
Transgenic line and wild type seed (plumule 2mm), be transferred to 0um, 60um cdcl simultaneously2、100um cdcl2Agar
In culture medium (in each culture dish, the left side is wild rice seed, and the right is transgenic paddy rice seed).It is placed in illumination cultivation
After cultivating 7 days in case (day/night: 28 DEG C/22 DEG C, 13h/11h), observation transgenic line is sprouted with wild rice seed
Heat condition.As shown in figure 4, under cadmium not treatment conditions, the sprouting situation basic of transgenic line and wild rice seed
Cause.And 60 μm and 100 μm of cdcl2Process the sprouting significantly inhibiting rice paddy seed for 7 days, the length of Ye Hegen reduces, the number of root
Also substantially reduce.And, in 60um cdcl2With 100um cdcl2Under process, the transgenic seedlings of mir268 overexpression compare open country
Raw type seedling, Biomass, leaf length, the number of root and all significantly reduce with length, illustrate that mir268 overexpression increased right
The sensitivity of cadmium.
Sequence table
<110>China Measures Institute
<120>a kind of mirna of Oryza sativa L. and its precursor-gene should in the breeding to cadmium sensitivity transgenic paddy rice with them
With
<160>2
<210> 1
<211> 12
<212> mirna
<213>Oryza sativa L.
<400> 1
ccagtcaggg gctcgttgct gg 12
<210> 1
<211> 1654
<212> mirna
<213>Oryza sativa L.
<400> 1
tggtttccag ccgggggctc ctgattagca ccgactctag cttcggctga ctggtttcca 60
gtcaggggct cgttgctggg ttcta 85
Claims (1)
1. a kind of have the breeding method to cadmium sensitivity transgenic paddy rice it is characterised in that the method comprises the following steps:
1) extract in wild rice and spend 11 7 day age seedling dna:
About 0.2 g rice leaf liquid nitrogen grinding is taken to become powder, transfer of powders, in the centrifuge tube added with 500 μ l extracting solution, carries
Liquid is taken to include 100 mm tris-hcl, ph 8.0；20 mm edta；500 mm nacl, gently mix；Xiang Guanzhong adds 100
μ l 10% sds solution, mixes, 65 DEG C of insulation 20 min；Then chlorination imitates/isoamyl alcohol/alcohol mixeding liquid 600 μ l, chloroform/different
Amylalcohol/ethanol volume ratio is 20:1:4, static 10 min of room temperature；4 DEG C, 12000 rpm are centrifuged 10 min, and transfer supernatant is extremely another
In centrifuge tube；The dehydrated alcohol adding 1ml pre-cooling fully mixes, -20 DEG C of precipitation dna 20 min；4 DEG C, 12000 rpm centrifugations
10 min, abandon supernatant, plus 70% ethanol 500 μ l is washed；4 DEG C, 12000 rpm are centrifuged 10 min, abandon supernatant；Slight from
Residual liquid is blotted by the heart with pipettor；Dry up dna precipitation after, be dissolved in 100 μ l enzyme containing rnase te, rnase enzyme dense
Spend for 10 μ g/ ml, 37 DEG C of water-bath 30 min, -20 DEG C of preservations；According to mir268 precursor sequence, consult in database
The sequence at the two ends of its place genomic locus, designs primer, set primer respectively at the bp of precursor hairpin structure two ends about 50
As follows:
Mir268-f, 5 '-cggggtacctaacaggagagctggacc -3 '
Mir268-r, 5'- aactgcagcatccgagtgacaatcag -3'；
2) then with dna as template, using set primer amplification mir268 precursor-gene, the base sequence such as seq of precursor-gene
Shown in id no.2:
Pcr reaction system is 50 μ l, sequentially adds dna template 1 μ l, 10 × pcr buffer 5 μ l, 10 mm dntps 4
μ l, 10 μm of forward primer mir268-f 0.8 μ l, 10 μm of reverse primer mir268-r 0.8 μ l, takara of 5 u/ μ l
Taq polymerase 0.5 μ l, finally plus ddh2O mends to 50 μ l；Pcr reaction condition: 94 DEG C of 5 min of denaturation, 94 DEG C of degeneration
30s, anneal 59 DEG C of 30s, extends 72 DEG C of 30s, 30 circulations, finally extends 72 DEG C of 10 min, 4 DEG C of preservations；
3) by mir268 precursor-gene dna product after expanding, reclaimed using agarose gel dna QIAquick Gel Extraction Kit, operation is as follows:
Dna band is cut in the eppendorf pipe putting into 1.5 ml from agarose gel, weighs weight；Add 6 times of volumes
Sol solutionses pn, 30 min are placed in 50 DEG C of water-baths；By sol solutionses add adsorption column ca2 in, room temperature place 2 min, 12000rpm from
Heart 60s, outwells the waste liquid in collecting pipe；Add 600 μ l rinsing liquid pw, 12000rpm is centrifuged 60s, outwell useless in collecting pipe
Liquid；12000rpm is centrifuged 2min, and room temperature is placed several minutes and thoroughly dried；Adsorption column ca2 is put in a clean centrifuge tube, plus
Enter 40 μ l elution buffer eb, 12000rpm centrifugation 2 min collects dna solution；
4) the mir268 precursor-gene dna of recovery and pmd19-t carrier takara is attached reacting:
Linked system 10 μ l, is separately added into 0.5 μ l pmd19-t carrier, the dna of mir268 precursor of 4.5 μ l purification, 5 μ l
solution i；After connecting 3 h at 16 DEG C, connection product is transformed in escherichia coli dh5 α competent cell；Sieved by amp
Choosing, picking positive colony, after pcr reaction is verified and sequencing identification is correct, choose correct bacterium solution and extract plasmid pmd19-
mir268；
5) the plasmid pmd19-mir268 extracting and dna binary plasmid carrier pcambia1301 is used takara company simultaneously
Kpni and psti producing carries out double digestion:
Enzyme action system 50 μ l, including 5 μ l 10 × m buffer, 28 μ l pmd19-mir268 plasmids or pcambia1301 matter
Grain, 1 μ l kpni, 1 μ l psti and 15 μ l ddh2O, 37 DEG C of water-baths are overnight；By dna binary plasmid carrier pcambia1301
After cloned plasmids pmd19-mir268 enzyme action, dna fragment is reclaimed in rubber tapping；Then t4 ligase is used to connect, linked system 10 μ
L, including 1 μ l pcambia1301 carrier, 7.5 μ l mir268 dna, 1 μ l 10 × t4 ligase buffer and 0.5 μ l
T4 ligase, 16 DEG C connect overnight；Then connection product is transformed in escherichia coli dh5 α competent cell, carries out bacterium solution
Pcr, and extract plasmid and carry out enzyme action identification, will correct plant expression vector p1301-mir268 to import Agrobacterium competence thin
Born of the same parents eha105；
6) identified correct positive plasmid p1301-mir268, by Agrobacterium-mediated transformation to rice callus, operation is such as
Under:
Activate Agrobacterium first, the ym culture medium containing 50 mg/l kanamycin and 40 mg/l rifampicin is rule, 28 DEG C dark
Culture；Collect Agrobacterium thalline, be suspended in containing in 200 μm the aam fluid suspension culture base of acyl syringone；Adjustment
Cell concentration is 0.8～1.0 to od600, pours the aseptic triangular flask containing the successive transfer culture Rice Callus of 1 week into, infects 10
Min, and frequently rock；Then calluss are placed on aseptic filter paper and drain after 30min, be placed in and be covered with one layer of aseptic filter paper
Solid co-cultivation medium on, 25 DEG C of light culture 3 days；Calluss sterile water wash 5-6 time after co-culturing, then
With the sterile water wash containing 500 mg/l cefradines 1 ~ 2 time, it is placed on aseptic filter paper and drains 1 hour；The wound healing dried is turned
Enter and first round selection is carried out on the Selective agar medium containing 500 mg/l cefradines and 50 mg/l hygromycin, 28 DEG C, light culture
14 days；Then by the initial wound healing of long resistant wound healing go to new containing 500 mg/l cefradines and 50 mg/l hygromycin
Second wheel selection is carried out on culture medium, 28 DEG C, illumination cultivation, until the resistant calli of graininess grows；Growth selection is prosperous
The resistant calli contained is transferred on the division culture medium containing hygromycin, in 25 DEG C, 12 h illumination/12 h dark conditions
Lower culture；Seedling to be regenerated grow up to about 1 cm high when, be moved into strong sprout on root media, 25 DEG C, 12 h illumination/12 h
Cultivate under dark condition；Finally transgenic seedling is chosen, add appropriate distilled water seedling exercising 3 days to one week, wash away agar, incubator
Water planting 1 week, is transplanted to growth in the native alms bowl in greenhouse；Select the normal plant of growth, carry out the screening of hygromycin pcr and gus dyeing,
Obtain positive t0 for plant, totally 21 strains；Harvest t1 and for seed breeding and identify the transgenic line obtaining homozygosis to t2 generation
System；
Described extraction plasmid be using the little extraction reagent kit of ordinary plasmids extract plasmid, operation as follows: take 3 ml bacterium solution add from
In heart pipe, 12000rpm is centrifuged 1 min, suctions out supernatant as far as possible；Add 250 μ l's in the centrifuge tube leave bacterial sediment
The p1 of solution containing rnasea, thorough suspended bacterial precipitation；Add 250 μ l solution p2, gentle spinning upside down 6-8 time makes thalline fill
Division solution；Add 350 μ l solution p3, gentle immediately spins upside down 6-8 time, fully mix, 12000rpm is centrifuged 10 min；
Collect supernatant, transfer in adsorption column cp3,12000rpm is centrifuged 60 s, outwells waste liquid；600 μ l are added to add anhydrous second
The rinsing liquid pw of alcohol, 12000rpm are centrifuged 60 s, outwell waste liquid and rinse twice；Adsorption column cp3 is put into collecting pipe,
12000rpm is centrifuged 2 min, is placed in room temperature and thoroughly dries；Add 55 μ l elution buffer eb, room temperature places 2 min,
12000rpm is centrifuged 1min, and plasmid solution is collected in centrifuge tube；
The operational approach that described p1301-mir268 imports Agrobacterium competent cell eha105 is as follows: takes 200 μ l Agrobacteriums
Competent cell, adds 1 μ g p1301-mir268 plasmid, mixes, ice bath 5 min, quick-freezing 5 min in liquid nitrogen, 37 DEG C of water-baths 5
Min, is subsequently adding 28 DEG C of renewal cultivation 4 h of 1 ml ym culture medium；10000 g are centrifuged 30 s, abandon supernatant, inhale 200 μ l bacterium solution and apply
It is distributed in the ym flat board containing 50 mg/l kanamycin and 40 μ g/l rifampicin, 28 DEG C of cultures, after about 48 h, grow Agrobacterium list bacterium
Fall；Shake bacterium, extraction Agrobacterium plasmid dna proceeds in escherichia coli dh5 α again, then extract plasmid and carry out enzyme action identification.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410519370.6A CN104263730B (en) | 2014-09-30 | 2014-09-30 | miRNA of rice and precursor gene of miRNA, and applications of miRNA in breeding of cadmium sensitive transgenic rice |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410519370.6A CN104263730B (en) | 2014-09-30 | 2014-09-30 | miRNA of rice and precursor gene of miRNA, and applications of miRNA in breeding of cadmium sensitive transgenic rice |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104263730A CN104263730A (en) | 2015-01-07 |
| CN104263730B true CN104263730B (en) | 2017-01-18 |
Family
ID=52155311
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410519370.6A Active CN104263730B (en) | 2014-09-30 | 2014-09-30 | miRNA of rice and precursor gene of miRNA, and applications of miRNA in breeding of cadmium sensitive transgenic rice |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104263730B (en) |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106754913B (en) * | 2016-11-24 | 2019-10-25 | 中国计量大学 | Rice miRNA-miR874 gene and precursor-gene and improve rice to the application in heavy metal stress tolerance |
| CN108192914A (en) * | 2018-01-30 | 2018-06-22 | 西安泽睿环境科技有限公司 | Turn the initiative and application of the heavy metal super-enriched transgenic engineering rape of S.plumbizincicola SpNramp5 genes |
| CN108192916A (en) * | 2018-01-30 | 2018-06-22 | 广东开源环境科技有限公司 | Turn the initiative and application of the heavy metal super-enriched transgenic engineering rice of S.plumbizincicola SpNramp5 genes |
| CN108374019A (en) * | 2018-01-30 | 2018-08-07 | 西安泽睿环境科技有限公司 | Turn the initiative and application of the heavy metal super-enriched transgenic engineering rape of Nipponbare rice Os Nramp5 genes |
| CN112501195B (en) * | 2020-11-23 | 2022-09-13 | 南京农业大学 | Application of rice miRNA gene smNRT2.3-1 |
| CN112662701A (en) * | 2020-12-31 | 2021-04-16 | 浙江大学 | Application of miRNA408 in regulation and control of cadmium accumulation of crops |
| CN114410658B (en) * | 2022-03-11 | 2023-04-25 | 四川农业大学 | Gene OsWNK9 for reducing cadmium content of rice brown rice, encoding protein and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102250901A (en) * | 2011-07-12 | 2011-11-23 | 中国计量学院 | Application of paddy rice miR192 in improving cadmium stress sensitivity of plant |
| CN102250949A (en) * | 2011-07-12 | 2011-11-23 | 中国计量学院 | Application of rice miR166 in enhancing plant cadmium stress tolerance |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7868149B2 (en) * | 1999-07-20 | 2011-01-11 | Monsanto Technology Llc | Plant genome sequence and uses thereof |
-
2014
- 2014-09-30 CN CN201410519370.6A patent/CN104263730B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102250901A (en) * | 2011-07-12 | 2011-11-23 | 中国计量学院 | Application of paddy rice miR192 in improving cadmium stress sensitivity of plant |
| CN102250949A (en) * | 2011-07-12 | 2011-11-23 | 中国计量学院 | Application of rice miR166 in enhancing plant cadmium stress tolerance |
Non-Patent Citations (2)
| Title |
|---|
| Intragenomic Matching Reveals a Huge Potential for miRNA-Mediated Regulation in Plants;Lindow M等;《PloS Computational Biology》;20071130;第3卷(第11期);参见摘要和Supporting Information Dataset S2. Predicted miRNA Candidates in Oryza * |
| 水稻镉胁迫诱导microRNA的分离与功能鉴定;丁艳菲等;《中国会议数据库中国植物生理学会第十次会员代表大会暨全国学术年会》;20090831;参见第91页第2-3段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104263730A (en) | 2015-01-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104263730B (en) | miRNA of rice and precursor gene of miRNA, and applications of miRNA in breeding of cadmium sensitive transgenic rice | |
| CN109423492B (en) | Application of SlTOE1 gene in regulation and control of flowering time and yield of tomatoes | |
| CN102250949B (en) | Application of rice miR166 in enhancing plant cadmium stress tolerance | |
| CN106701778A (en) | Method for increasing grain number per ear and reducing plant height by use of rice SNB genes | |
| CN107056911A (en) | A kind of strawberry transcription factor for promoting plant Blooming and its application | |
| CN102250902A (en) | Application of rice miR390 in enhancing plant cadmium stress sensitivity | |
| CN102250903A (en) | Application of rice miR166 in enhancing plant drought stress tolerance | |
| CN106554964B (en) | Application of cotton GbABR1 gene in verticillium wilt resistance | |
| CN105039345B (en) | The clone of miRNA for enhancing mulberry tree salt resistance ability a kind of and its application | |
| CN104388433A (en) | Plant osmotic stress inducible promoter and application thereof | |
| CN102250901B (en) | Application of paddy rice miR192 in improving cadmium stress sensitivity of plant | |
| CN102965374B (en) | Preparation method and applications of rape BnRabGDI3 promoter | |
| CN106337041A (en) | Plant stress-tolerance associated protein and coding gene and application thereof | |
| CN110904106B (en) | Application of cymbidium goeringii miR159b in enhancing plant cold sensitivity | |
| CN104628840B (en) | Plant stress tolerance correlative protein VrDREB2A and its encoding gene and application | |
| CN105452272A (en) | Calcineurin b-like protein cbl-3 from cotton, and coding gene and use thereof | |
| CN104561026B (en) | Application of the peanut AhFRDL1 genes in Genes For Plant Tolerance Al toxicity stress is improved | |
| CN104877987A (en) | Soybean regeneration-associated gene (GmESR1) and expression analysis thereof | |
| CN104611335A (en) | Specific peanut promoter AhRSP and application thereof | |
| CN106754913B (en) | Rice miRNA-miR874 gene and precursor-gene and improve rice to the application in heavy metal stress tolerance | |
| CN105254730A (en) | Protein capable of improving salt tolerance and drought tolerance of plants as well as coding gene and application of protein | |
| CN104962563A (en) | BpMyB106 gene in Betula platyphylla and amino acid sequence and application thereof | |
| CN105732785B (en) | Application of protein GhDHN1 in regulation and control of plant stress resistance | |
| CN110951771A (en) | Application of cymbidium goeringii miR390a in control of plant root system development | |
| CN104450749A (en) | Flower-specific expression vector of cucumber CsLOX1 gene and application of flower-specific expression vector |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |