CN108424910B

CN108424910B - RNA fragment for target gene interference and application thereof

Info

Publication number: CN108424910B
Application number: CN201710075627.7A
Authority: CN
Inventors: 阴祖军; 叶武威; 王晓歌; 王帅; 崔法; 王俊娟; 王德龙; 舒娜; 樊伟丽; 郭丽雪; 崔瑞峰; 郭晓宁
Original assignee: Institute of Cotton Research of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Cotton Research of Chinese Academy of Agricultural Sciences
Priority date: 2017-02-13
Filing date: 2017-02-13
Publication date: 2021-08-17
Anticipated expiration: 2037-02-13
Also published as: CN108424910A

Abstract

The invention discloses an RNA fragment for target gene interference and application thereof. The invention provides RNA for interfering a target gene, which is obtained by replacing a miR160 sequence in a miR160 precursor sequence with an RNA fragment A of the interfering target gene and replacing a reverse complementary sequence of the miR160 sequence in the miR160 precursor sequence with a reverse complementary sequence of the RNA fragment A of the interfering target gene. Experiments prove that the method replaces miR160 sequence in miR160 precursor sequence with interference fragment expressed by silent GUS gene to obtain amiRNA-GUS; the amiRNA-GUS vector is introduced into a plant, GUS staining is utilized, and the validity of the amiRNA-GUS vector is verified through visual observation.

Description

RNA fragment for target gene interference and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to an RNA fragment for target gene interference and application thereof.

Background

Gene silencing is an important mechanism for eukaryotes to regulate endogenous gene expression and defend against foreign nucleic acid invasion. Since the early 90 s of the 20 th century, gene silencing has rapidly become a hotspot for research in the field of biology. In 2001, gene silencing was rated as one of ten scientific advances by the journal "science". Artificial miRNA (amiRNA) is a high-efficiency gene silencing technology, and small RNA molecules using one or more specific genes as targets are artificially designed by utilizing the generation and action principles of natural miRNA, and are introduced into a plant body after genetic transformation after an expression vector is constructed, so that the expression of the target genes is efficiently and specifically inhibited. amiRNAs are generally fully complementary or nearly fully complementary to the target gene mRNA. The main mode of action is to cleave the target gene mRNA, causing the mRNA to be degraded. During the cleavage process, bases 2-8 of the 5' end of the amiRNA are core elements complementary to the target mRNA, and the ORF region of the target mRNA, base-paired at nucleotides 10-11, is the cleavage site. After cleavage, the amiRNA will continue to recognize and cleave other target genes.

The amiRNA technology takes a precursor of a natural plant miRNA as a basic skeleton, replaces an miRNA/miRNA sequence in a stem-loop structure with an amiRNA/amiRNA sequence, and silences a target gene. Therefore, amiRNA technology is specific and efficient in regulating gene expression.

Disclosure of Invention

It is an object of the present invention to provide an RNA for interfering with a gene of interest.

The RNA provided by the invention is obtained by replacing a miR160 sequence in a miR160 precursor sequence with an RNA fragment A interfering a target gene, and replacing a reverse complementary sequence of the miR160 sequence in the miR160 precursor sequence with a reverse complementary sequence of the RNA fragment A interfering the target gene.

In the RNA, the miR160 precursor sequence is derived from arabidopsis thaliana or cotton.

In the above RNA (amiRNA-GUS), the target gene is GUS.

In the RNA, the nucleotide sequence of the RNA fragment A of the interference target gene is 280-300 th site of the sequence 1 or 296-316 site of the sequence 3;

or the nucleotide sequence of the reverse complementary sequence of the RNA fragment A of the interference target gene is 338-358 th of the sequence 1 or 354-374 th of the sequence 3;

or the nucleotide sequence of the miR160 precursor is sequence 5 or sequence 6;

or the nucleotide sequence of the miR160 sequence is the 280-th-300 position of the sequence 5 or the 296-th-316 position of the sequence 6;

or the nucleotide sequence of the reverse complementary sequence of the miR160 sequence is 338 th-358 th position of the sequence 5 or 354 nd-374 th position of the sequence 6.

In the RNA, the nucleotide sequence of the RNA for interfering the target gene is sequence 1 or sequence 3 in a sequence table.

DNA molecules encoding the above-described RNAs are also within the scope of the present invention;

or an expression cassette, a recombinant vector, a recombinant bacterium, a transgenic cell or a recombinant virus containing the DNA are also within the scope of the present invention.

Another objective of the invention is to provide an RNA fragment A interfering with GUS gene expression.

The nucleotide sequence of the RNA fragment A for interfering the expression of the GUS gene provided by the invention is 280-300 th site of a sequence 1 or 296-316 th site of a sequence 3.

A DNA molecule A encoding the above-mentioned RNA fragment A is also within the scope of the present invention;

or an expression cassette, a recombinant vector, a recombinant bacterium, a transgenic cell or a recombinant virus containing the DNA molecule A are also within the protection scope of the invention.

The application of the RNA or the DNA molecule or the expression cassette, the recombinant vector, the recombinant bacterium, the transgenic cell or the recombinant virus in the interference of the expression of the target gene is also within the protection scope of the invention;

or the application of the above RNA or the above DNA molecule or the expression cassette containing the DNA molecule, the recombinant vector, the recombinant bacterium, the transgenic cell or the recombinant virus in interfering the expression of the target gene in plants is also within the protection scope of the invention;

or the application of the RNA fragment A or the DNA molecule A or the expression cassette, the recombinant vector, the recombinant bacterium, the transgenic cell or the recombinant virus containing the DNA molecule A in interfering the expression of the GUS gene is also within the protection scope of the invention;

or the RNA fragment A or the DNA molecule A or the expression cassette, the recombinant vector, the recombinant bacterium, the transgenic cell or the recombinant virus containing the DNA molecule A are also the protection scope of the invention.

In the above, the plant is a monocotyledon or dicotyledon; or the dicotyledonous plant is arabidopsis and cotton.

Experiments prove that the method replaces miR160 sequence in miR160 precursor sequence with interference fragment expressed by silent GUS gene to obtain amiRNA-GUS; the amiRNA-GUS vector is introduced into a plant, GUS staining is utilized, and the validity of the amiRNA-GUS vector is verified through visual observation.

Drawings

FIG. 1 shows the characteristics of the base sequence distribution of miRNA.

FIG. 2 is the amiRNA sequence amiRNA-GUS used to interfere with GUS gene expression.

FIG. 3 is a PCR product of AtmiR 160-GUS;

m: lambda-Hind III DNA Marker; 1: AtmiR160-GUS PCR product;

m2: DL2,000DNA Marker; 2: GhmiR160-GUS PCR product.

FIG. 4 is a preparation of Vector DNA;

M1：λ-Hind IIIdigest；1：pBI121-ClaI

M2：λ-Hind IIIdigest；2：GhmiR160-GUS VectorDNA

FIG. 5 shows the phenotype of transgenic plants.

FIG. 6 shows GUS staining of transgenic plants.

FIG. 7 is an AtmiR160-GUS sequencing enzymatic map.

FIG. 8 is a GhmiR160-GUS sequencing enzymatic cleavage map.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 preparation of RNA interfering with Gene of interest

First, statistics of miRNA sequence characteristics

The length of miRNA is usually 21-23nt, mature miRNA has a phosphate group at 5 'end and hydroxyl group at 3' end and is usually methylated. Statistical post-analysis of the Arabidopsis miRNA sequences that have been found and reported (miRBase database, http:// www.mirbase.org/index. shtml) found (FIG. 1): (1) the 1 st base position is conserved, the 1 st base is 56.44% of the total U sequence, while the C sequence accounts for 8.66%, the 9 th base is 33.49% of the total G sequence, (3) the 10 th base is 35.60% of the total A sequence, and (4) the 15 th base is T sequence accounts for 30.91% of the total T sequence, and the other bases almost randomly appear. Therefore, the success rate can be improved by designing the artificial miRNA (amiRNA) sequence according to the sequence characteristics.

Secondly, designing an interference fragment for silencing GUS gene expression

mirnas, as a class of negative regulators in gene expression, regulate plant gene expression primarily at the post-transcriptional level by mediating cleavage of target mrnas. In the process of cutting the target mRNA by miRNA, bases at 2-8 of the 5' end of miRNA are core elements complementary to the target mRNA, and the ORF region of the target mRNA paired with nucleotide residues at 10-11 is the cutting site of miRNA. After cleavage, mirnas will continue to recognize and cleave other target genes.

According to the characteristics of the above sequence and action mechanism of miRNA, designing DNA A (figure 2) for interfering GUS gene expression: TAAACGGTGATACGTACGCTT (position 280-300 of SEQ ID NO: 2) expressing an RNA fragment A for interfering with GUS gene expression, UAAACGGUGAUACGUACGCUU (position 280-300 of SEQ ID NO: 1)

Third, amiRNA sequence for interfering GUS gene expression is designed and synthesized

Most miRNA sequences have high conservation and are widely present in various plants. There were 145 miR160 sequences in the small RNA database miRBase (Release 21) in total, present in 39 plant species. There are 3 mirs 160 in arabidopsis and 6 mirs 160 in cotton. And (3) extracting Arabidopsis thaliana and cotton miR160 precursor sequences from NCBI by using the miR160 precursor sequence as a precursor skeleton of the artificial miRNA.

amiRNA derived from Arabidopsis for interfering with GUS gene expression:

replacing the miR160 sequence in the Arabidopsis miR160a precursor sequence (sequence 5) with the RNA fragment A for interfering GUS gene expression prepared in the second step, replacing the miR160 reverse complementary sequence in the Arabidopsis miR160a precursor sequence with the reverse complementary sequence of the RNA fragment A, and naming the obtained RNA as AtmiR160-GUS, namely the amiRNA for interfering GUS gene expression, and naming the obtained RNA as AtmiR 160-GUS; the nucleotide sequence of AtmiR160-GUS is sequence 1, wherein the 1 st-279 th position of the sequence 1 is the miR160 sequence upstream part in an Arabidopsis miR160a precursor sequence, and the 280 th-300 th position of the sequence 1 is an RNA fragment A for interfering the expression of the GUS gene; the 301-337 th site of the sequence 1 is the middle part in the precursor sequence of the Arabidopsis miR160 a; the 338 nd-358 st sequence of the sequence 1 is the reverse complementary sequence of the RNA fragment A, and the 359 nd 497 nd sequence of the sequence 1 is the downstream part of the miR160 sequence in the Arabidopsis miR160a precursor sequence.

The nucleotide sequence of the coding gene of AtmiR160-GUS is a sequence 2 in a sequence table, wherein the 1 st to 279 th positions of the sequence 2 are coding sequences of miR160 sequence upstream parts in an Arabidopsis miR160a precursor sequence, and the 280 th and 300 th positions of the sequence 2 are DNA A for interfering the expression of the GUS gene; the 301-337 th site of the sequence 2 is the middle part in the precursor sequence of the Arabidopsis miR160 a; 338 nd-358 th sequence of the sequence 2 is a reverse complementary sequence of the DNA A, and 359 nd 497 th sequence of the sequence 2 is a coding sequence of a part of miR160 sequence downstream in the Arabidopsis miR160a precursor sequence.

amiRNA derived from cotton for interfering with GUS gene expression:

replacing a miR160 sequence in a cotton miR160a precursor sequence (sequence 6) with the RNA fragment A for interfering GUS gene expression prepared in the second step, replacing a miR160 reverse complementary sequence in the cotton miR160a precursor sequence with the reverse complementary sequence of the RNA fragment A, and naming the obtained RNA as GhmiR160-GUS, namely amiRNA for interfering GUS gene expression, and naming the obtained RNA as GhmiR 160-GUS; the nucleotide sequence of GhmiR160-GUS is sequence 3, wherein the 1 st-295 th position of the sequence 3 is the miR160 sequence upstream part in the cotton miR160a precursor sequence, and the 296 nd-316 th position of the sequence 3 is an RNA fragment A for interfering the expression of the GUS gene; the 317-353 site of the sequence 3 is the middle part in the precursor sequence of the cotton miR160 a; the 354 nd-374 th sequence of the sequence 3 is a reverse complementary sequence of the RNA fragment A, and the 375 nd-557 th sequence of the sequence 3 is a miR160 sequence downstream part in a cotton miR160a precursor sequence.

The nucleotide sequence of the coding gene of GhmiR160-GUS is a sequence 4 in a sequence table, wherein the 1 st to 295 th sites of the sequence 4 are miR160 sequence upstream part coding sequences in a cotton miR160a precursor sequence, and the 296 nd and 316 th sites of the sequence 4 are DNA A for interfering the expression of the GUS gene; the 317-353 site of the sequence 4 is the middle part in the precursor sequence of the cotton miR160 a; the 354 nd-374 th sequence of the sequence 4 is a reverse complementary sequence of the RNA fragment A, and the 375 nd-557 th sequence of the sequence 4 is a coding sequence of a part of the miR160 sequence downstream in the precursor sequence of the cotton miR160 a.

Application of amiRNA sequence for interfering GUS gene expression

1. Preparation of intermediate Carrier

(1) Preparation of DNA fragment: respectively synthesizing single-chain small-fragment DNA according to the DNA fragment AtmiR160-GUS (1 st-497 bit of a sequence 2) and the DNA fragment GhmiR160-GUS sequence (1 st-557 bit of a sequence 4), and splicing the single-chain small-fragment DNA into a complete double-chain DNA fragment by a PCR (polymerase chain reaction) method.

(2) And (3) connection reaction:

the reaction solutions of the following Table 1 were prepared in Microtube tubes.

Table 1 shows the reaction solution

Component of DNA Ligation Kit (TaKaRa Code No. 6022).

(3) The temperature is kept at 16 ℃ for 30 minutes.

The whole amount of the ligation solution was transferred to E.coli component Cell JM109(TaKaRa Code No. 9052).

(4) Positive clone detection and plasmid DNA extraction

The colonies on the plate were individually subjected to PCR to determine the length of the insert in the plasmid contained. Then, plasmid DNA extraction and DNA sequencing were performed on the colonies, respectively.

The PH-AtmiR160-GUS plasmid is a vector obtained by inserting an AtmiR160-GUS coding gene shown by 1-497 th nucleotide of a sequence 2 into a PHANNIBAL vector (TaKaRa).

The T-GhmiR160-GUS plasmid is characterized in that a coding gene of GhmiR160-GUS shown by 1 st-557 th nucleotides in a sequence 4 is inserted into a T-Vector pMD^TM19(Simple) vector (TaKaRa Code No)3271) the vector obtained in (c).

FIG. 7 is an AtmiR160-GUS sequencing enzymatic map. FIG. 8 is a GhmiR160-GUS sequencing enzymatic cleavage map.

2. Preparation of interference vectors

A PH-AtmiR160-GUS plasmid is used as a template, a sequence 2644bp (AtmiR160-GUS Insert DNA) between Not I enzyme cutting sites is amplified by PCR (a primer is shown In the following table 2), In-Fusion is cloned into an expression vector of pBI121 (Mumin and the like, functional expression of a yeast salt-tolerance related gene HAL1 In cotton, preservation In a laboratory In 2016 (China agricultural science) period 14) after Cla I enzyme cutting treatment, and a positive clone plasmid is selected for sequencing to generate pBI121-AtmiR 160-GUS.

A T-GhmiR160-GUS plasmid is used as a template, a sequence 569bp (GhmiR160-GUS Insert DNA) between NotI enzyme cutting sites is amplified by PCR (a primer is shown In the following table 2), In-Fusion is cloned into a pBI121 (the same as the above) expression vector subjected to XhoI/Cla I enzyme cutting treatment, and a positive cloning plasmid is selected for sequencing to generate pBI121-GhmiR 160-GUS.

The method comprises the following specific steps:

preparation of Insert DNA

(1) Primer design and Synthesis

TABLE 2

(2) PCR amplification

Use of

HS(Premix)(Code No.R040)

Reaction system:

using Tks

DNA Polymerase (Code No. R060) amplification

Reaction system:

mu.l of the gel was subjected to 1% agarose gel electrophoresis, and the results are shown in FIG. 3:

the target fragment AtmiR160-GUS Insert DNA and the target fragment GhmiR160-GUS Insert DNA were recovered by cutting the Gel using Takara MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0(Code No. 9762).

B. Preparation of Vector DNA

(1) Enzyme digestion reaction

Reaction system:

reaction conditions 4hours at 37 DEG C

5ul of the Vector was subjected to 1% Agarose Gel electrophoresis, and the Vector fragment was recovered by cutting the Gel using Takara MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0, to obtain Vector DNA (FIG. 4).

C. Sequencing analysis

Use of

HD Cloning Kit (Clontech Code No.639633), the AtmiR160-GUS Insert DNA and GhmmiR 160-GUS Insert DNA obtained from A were ligated to the Vector DNA obtained from B, respectively, to obtain plasmid pBI121-AtmiR160-GUS and plasmid pBI 121-GhmmiR 160-GUS.

The above connection system and conditions were as follows:

1ul of the ligation product was thermally transformed into E.coli component Cell JM109(Code No.9052), plated and cultured overnight at 37 ℃. And (4) selecting positive clones and extracting plasmids.

Sequencing a plasmid pBI121-AtmiR160-GUS by using primers AtVP1, AtVP2, AtP1, AtP2 and AtP4, wherein the plasmid is a vector obtained by inserting an encoding gene of AtmiR160-GUS shown by 1-497 th nucleotide of a sequence 2 into a ClaI enzyme cutting site of pBI 121.

Sequencing a plasmid pBI121-GhmiR160-GUS by using primers GhP1 and AtP2, wherein the plasmid is a vector obtained by inserting a coding gene of the GhmiR160-GUS shown by nucleotides 1 to 557 of a sequence 4 into an XhoI/Cla enzyme cutting site of the pBI 121.

The sequencing primer sequences are shown in table 3 below:

TABLE 3

3. Preparation of recombinant Agrobacterium

Transferring the plasmid pBI121-AtmiR160-GUS into Agrobacterium tumefaciens EHA105 (Liuna and the like, construction of plant expression vectors of HSP70 genes of cotton and research on transformation of tobacco, Chinese agronomic report 2015,31(31):194 and 198) to obtain a recombinant bacterium pBI121-AtmiR 160-GUS;

the plasmid pBI121-GhmiR160-GUS is transferred into agrobacterium tumefaciens EHA105 (Liuna and the like, construction of plant expression vectors of cotton HSP70 genes and research of tobacco transformation, Chinese agricultural notice 2015,31(31):194 and 198) to obtain the recombinant strain pBI121-GhmiR 160-GUS.

4. Transformation of Arabidopsis thaliana

1) Culturing of transformed plant

(1) Seed germination and planting: sterile, sterile seeds of Arabidopsis thaliana Columbia wild type (Chenjinhua et al, AtCS82 gene T-DNA insertion mutant screening and acquisition of overexpressed transgenic plants, proceedings of Hunan university of agriculture, vol.39, No. 3) were sown on a medium for culture, and then seedlings were transplanted into a nutrition pot. After the seeds are cultured under the condition of short day, the seeds are transferred to the condition of long day for inducing flowering. Before dip dyeing, the formed siliques are cut off to obtain the arabidopsis thaliana to be transformed.

(2) Transformation procedure

And selecting a plant with a good growth state to be transformed into Arabidopsis, inverting the plant to ensure that the part of the flower bolt is completely immersed in the recombinant bacterium pBI121-AtmiR160-GUS or pBI121-GhmiR160-GUS bacterial liquid, and gently shaking the plant in the period. And (4) removing the plants, and removing the bacteria liquid flowing on the surface of the plants by inverting or turning the plants aside. The plants were transferred to a culture room and grown normally. And (4) collecting mature seeds to obtain AtmiR160-GUS and GhmiR160-GUS transgenic arabidopsis seeds.

(3) Transformed seed selection

Plates for seed selection were prepared containing carbenicillin and the appropriate antibiotic. Half of the seeds were taken for screening. Treating with ethanol, treating with sodium hypochlorite, and washing with sterile water. And (4) spreading the seeds subjected to surface disinfection on a screening culture medium for culture. The green plants which can normally grow cotyledon, true leaves and roots are positive plants. Under the antibiotic condition, only positive plants can grow true leaves. Plants that grew true leaves were transferred to fresh selection medium and continued for 1-2 weeks to confirm that they were true positive plants. Transferring the screened positive plants into a nutrition pot, and continuously culturing until the plants are harvested to obtain AtmiR160-GUS transgenic arabidopsis thaliana and GhmiR160-GUS transgenic arabidopsis thaliana (figure 5).

(4) PCR detection verification

Extracting the genome DNA of AtmiR160-GUS transgenic arabidopsis and GhmiR160-GUS transgenic arabidopsis, and detecting the NPU II by PCR to verify transgenic positive plants. The length of the amplified fragment is 500 bp.

NPUⅡF1：CGUUGUCACUGAAGCGGGAAGG

NPUⅡR1：GAGCGGCGAUACCGUAAAGCAC

Obtaining 500bp amplified positive AtmiR160-GUS transgenic arabidopsis thaliana and positive GhmiR160-GUS transgenic arabidopsis thaliana.

The empty vector pBI121 is transferred into arabidopsis thaliana by the same method to obtain the empty vector transferred arabidopsis thaliana.

5. GUS staining of transgenic plants to verify whether GUS gene is interfered to express

Taking 2ml of a centrifuge tube, pouring 1.5ml of GUS staining solution with strong stainability (Beijing Obolai, # S102), picking positive transfer AtmiR160-GUS Arabidopsis plants, positive transfer GhmiR160-GUS Arabidopsis plants and empty carrier Arabidopsis plants with consistent morphological growth by using forceps, washing impurities with sterile water, immersing in the staining solution, preserving heat at 37 ℃ for 8h, and transferring into 70% ethanol for decolorization for 2-3 times. And (5) after the water absorption paper absorbs the redundant liquid, observing the dyeing condition.

The results are shown in FIG. 6, and the Arabidopsis thaliana with the empty vector can be dyed into blue by the GUS staining solution with strong stainability; the positive AtmiR160-GUS transgenic Arabidopsis plants and the positive GhmiR160-GUS transgenic Arabidopsis plants can not be dyed, which indicates that GUS genes can not be normally expressed due to the interference of AtmiR160-GUS or GhmiR 166-GUS.

Comparative example:

1. construction of GhmiR166-GUS sequence

The GhmiR166-GUS sequence is shown as a sequence 8, the GhmiR166-GUS sequence is obtained by replacing a miR166 sequence in a miR166a precursor sequence of cotton with RNA B (UUAAUCAGGAACUGUUCGCCG) for interfering GUS gene expression, replacing a miR166 reverse complementary sequence in a miR166a precursor sequence of cotton with a RNA B reverse complementary sequence, and the obtained RNA is named as GhmiR166-GUS, namely amiRNA for interfering GUS gene expression and named as GhmiR 166-GUS; the nucleotide sequence of GhmiR166-GUS is sequence 8, wherein the 1 st to 227 th positions of the sequence 8 are the upstream part of the miR166 sequence in the cotton miR166a precursor sequence, the 228 nd and 247 th positions of the sequence 8 are the reverse complementary sequences of the RNA fragment A, and the 248 th and 337 th positions of the sequence 8 are the middle part of the cotton miR166a precursor sequence; the 338-358 th site of the sequence 8 is an RNA fragment A for interfering the expression of the GUS gene; the 359-509 position of the sequence 8 is the downstream part of the miR166 sequence in the cotton miR166a precursor sequence.

The nucleotide sequence of the coding gene of the GhmiR166-GUS is a sequence 7 in a sequence table, wherein the 1 st to 227 th site of the sequence 7 is a miR166 sequence upstream part coding sequence in a cotton miR166a precursor sequence, the 228 nd and the 247 th sites of the sequence 7 are reverse complementary sequences of an RNA fragment A, and the 248 nd and the 337 th sites of the sequence 7 are middle parts in the cotton miR166a precursor sequence; the 338-358 th site of the sequence 7 is DNA B for interfering the expression of the GUS gene; the 359-509 position of the sequence 7 is a coding sequence of a part of the downstream of the miR166 sequence in the precursor sequence of the cotton miR166 a.

2. The recombinant vector pBI121-GhmiR166-GUS plasmid is obtained by inserting a GhmiR166-GUS coding gene shown in a sequence 7 into an XhoI/Cla enzyme cutting site of pBI 121.

3. Transformation of

Obtaining positive transgenic Arabidopsis thaliana GhmiR166-GUS according to the method of 3-4 in the fourth embodiment 1;

4. GUS staining

According to the method of 5 in the fourth embodiment of example 1, the positive transgenic Arabidopsis thaliana with GhmiR166-GUS gene was stained, and the result is shown in FIG. 6, and the positive transgenic Arabidopsis thaliana with GhmiR166-GUS gene was stained blue, which indicates that the expression of GUS gene was not affected by GhmiR 166-GUS. Thus, not all mirnas and all fragments that interfere with GUS are able to achieve the amirnas required by the present invention.

Sequence listing

<110> Cotton research institute of Chinese academy of agricultural sciences

<120> RNA fragment for target gene interference and application thereof

<160> 8

<170> PatentIn version 3.5

<210> 1

<211> 497

<212> RNA

<213> Artificial sequence

<220>

<223>

<400> 1

ggcuucaaga acaguaaccc caauuccucc acaagaggga gagaaaacaa aagaucuucc 60

aauuccauuc ucguacaugc aaaucacaau ccaugccaua gauuguuucu auuccuccuu 120

auuuauugcu uguaucuguu caugcaugga ccagguggag agagcauuac uuaaaaauag 180

aauuagcuau cuguuuuagg cgaacuaguu uccuuacaua accauguaua ugucaugacg 240

cauauacaua uguagaugug uauauguauu auauauguau aaacggugau acguacgcuu 300

uaugcugagc ccaucgagua ucgaugaccu ccguggaaag cguacguauc accguuuaua 360

uccucauaca uauauaauua uguuuuggua ccaauugaau uguguugaug agcuuguuuu 420

guagaagucu cuguucauug ccucaucaug uguagaagag auuagaggua ccucacgaau 480

ccaucauaug cuuuuuu 497

<210> 2

<211> 497

<212> DNA

<213> Artificial sequence

<220>

<223>

<400> 2

ggcttcaaga acagtaaccc caattcctcc acaagaggga gagaaaacaa aagatcttcc 60

aattccattc tcgtacatgc aaatcacaat ccatgccata gattgtttct attcctcctt 120

atttattgct tgtatctgtt catgcatgga ccaggtggag agagcattac ttaaaaatag 180

aattagctat ctgttttagg cgaactagtt tccttacata accatgtata tgtcatgacg 240

catatacata tgtagatgtg tatatgtatt atatatgtat aaacggtgat acgtacgctt 300

tatgctgagc ccatcgagta tcgatgacct ccgtggaaag cgtacgtatc accgtttata 360

tcctcataca tatataatta tgttttggta ccaattgaat tgtgttgatg agcttgtttt 420

gtagaagtct ctgttcattg cctcatcatg tgtagaagag attagaggta cctcacgaat 480

ccatcatatg ctttttt 497

<210> 3

<211> 557

<212> RNA

<213> Artificial sequence

<220>

<223>

<400> 3

guuuuguuug agcugaacau ccucucgucu uugcccaaac uuucuucuuu gcuuguuuug 60

ugccaaauca aaggaaccca gcuuuuucuu uugccacuca gaucuucaca aguauacgcg 120

cuuugccugu gccuguaaau augagcuugg ccugugcaaa gggauugaag aagaugauga 180

gaugaugauc aucgucuaaa agcauugcac uucccaugca uuuccucauu cgcggcauga 240

uaccauaaca auaugcgcac gcacacauca ucaucauggc acacauauau guauauaaac 300

ggugauacgu acgcuuuuug cagaacccau cgaacaucga uggccuccgu ggaaagcgua 360

cguaucaccg uuuauauauu ccauguaugu auauacuaua ucuuccuuug caggauuuuu 420

cuuucucuuc ccggcucaac accaccuauu uaauuuucca gguuuuuuuu accucuacua 480

uauaugagaa ucucaaggua uuucaucuuc uuauuuaauc uuaauaucuc uuucuaugcc 540

ccccccccca acccacc 557

<210> 4

<211> 557

<212> DNA

<213> Artificial sequence

<220>

<223>

<400> 4

gttttgtttg agctgaacat cctctcgtct ttgcccaaac tttcttcttt gcttgttttg 60

tgccaaatca aaggaaccca gctttttctt ttgccactca gatcttcaca agtatacgcg 120

ctttgcctgt gcctgtaaat atgagcttgg cctgtgcaaa gggattgaag aagatgatga 180

gatgatgatc atcgtctaaa agcattgcac ttcccatgca tttcctcatt cgcggcatga 240

taccataaca atatgcgcac gcacacatca tcatcatggc acacatatat gtatataaac 300

ggtgatacgt acgctttttg cagaacccat cgaacatcga tggcctccgt ggaaagcgta 360

cgtatcaccg tttatatatt ccatgtatgt atatactata tcttcctttg caggattttt 420

ctttctcttc ccggctcaac accacctatt taattttcca ggtttttttt acctctacta 480

tatatgagaa tctcaaggta tttcatcttc ttatttaatc ttaatatctc tttctatgcc 540

ccccccccca acccacc 557

<210> 5

<211> 497

<212>RNA

<213> Artificial sequence

<220>

<223>

<400> 5

ggcuucaaga acaguaaccc caauuccucc acaagaggga gagaaaacaa aagaucuucc 60

aauuccauuc ucguacaugc aaaucacaau ccaugccaua gauuguuucu auuccuccuu 120

auuuauugcu uguaucuguu caugcaugga ccagguggag agagcauuac uuaaaaauag 180

aauuagcuau cuguuuuagg cgaacuaguu uccuuacaua accauguaua ugucaugacg 240

cauauacaua uguagaugug uauauguauu auauauguau gccuggcucc cuguaugcca 300

uaugcugagc ccaucgagua ucgaugaccu ccguggaugg cguaugagga gccaugcaua 360

uccucauaca uauauaauua uguuuuggua ccaauugaau uguguugaug agcuuguuuu 420

guagaagucu cuguucauug ccucaucaug uguagaagag auuagaggua ccucacgaau 480

ccaucauaug cuuuuuu 497

<210> 6

<211> 573

<212> RNA

<213> Artificial sequence

<220>

<223>

<400> 6

guuuuguuug agcugaacau ccucucgucu uugcccaaac uuucuucuuu gcuuguuuug 60

ugccaaauca aaggaaccca gcuuuuucuu uugccacuca gaucuucaca aguauacgcg 120

cuuugccugu gccuguaaau augagcuugg ccugugcaaa gggauugaag aagaugauga 180

gaugaugauc aucgucuaaa agcauugcac uucccaugca uuuccucauu cgcggcauga 240

uaccauaaca auaugcgcac gcacacauca ucaucauggc acacauauau guauaugccu 300

ggcucccugu augccauuug cagaacccau cgaacaucga uggccuccgu ggauggcgua 360

ugaggagcca agcauauauu ccauguaugu auauacuaua uauucuccau caauauucuu 420

ccuuugcagg auuuuucuuu cucuucccgg cucaacacca ccuauuuaau uuuccagguu 480

uuuuuuaccu cuacuauaua ugagaaucuc aagguauuuc aucuucuuau uuaaucuuaa 540

uaucucuuuc uaugcccccc cccccaaccc acc 573

<210> 7

<211> 509

<212> RNA

<213> Artificial sequence

<220>

<223>

<400> 7

ucuucaaagc aaguggauug augugacauc uccacugacg uaagggauga cgcacaaucc 60

cacuauccuu cgcaagaccc uuccucuaua uaaggaaguu cauuucauuu ggagaggaca 120

cgcucgaguu uuaguuccgc acuucaauuc uaucacucac cuaugccauu guuaaucuuc 180

uuugggugaa auagaugaga agauugaaag gaagccauuu cuuuugacgg cgaacgauuc 240

cugguuaagg ccaucaacua gaucuaugga uuucuuuuuc auauaucaaa auuugagaga 300

ugaugaugau uuaaucauua aucauagguu aaugacguua aucaggaacu guucgccgcc 360

aauuauuugc uuccaauuuu gauuauguuc ucucggucuu uuguugguaa aacaagaagu 420

gguggguggu ggaugauaag gaugcuggag cuauguaucg auaagcuugg auccucuaga 480

guccugcuuu aaugagauau gcgagacgc 509

<210> 8

<211> 509

<212> DNA

<213> Artificial sequence

<220>

<223>

<400> 8

tcttcaaagc aagtggattg atgtgacatc tccactgacg taagggatga cgcacaatcc 60

cactatcctt cgcaagaccc ttcctctata taaggaagtt catttcattt ggagaggaca 120

cgctcgagtt ttagttccgc acttcaattc tatcactcac ctatgccatt gttaatcttc 180

tttgggtgaa atagatgaga agattgaaag gaagccattt cttttgacgg cgaacgattc 240

ctggttaagg ccatcaacta gatctatgga tttctttttc atatatcaaa atttgagaga 300

tgatgatgat ttaatcatta atcataggtt aatgacgtta atcaggaact gttcgccgcc 360

aattatttgc ttccaatttt gattatgttc tctcggtctt ttgttggtaa aacaagaagt 420

ggtgggtggt ggatgataag gatgctggag ctatgtatcg ataagcttgg atcctctaga 480

gtcctgcttt aatgagatat gcgagacgc 509

Claims

1. The nucleotide sequence of the RNA for interfering the target gene is sequence 1 or sequence 3 in a sequence table.

2. A DNA molecule encoding the RNA of claim 1.

3. An expression cassette, recombinant vector, recombinant bacterium, transgenic cell or recombinant virus comprising the DNA of claim 2.

4. Use of the RNA of claim 1 or the DNA molecule of claim 2 or the expression cassette, recombinant vector, recombinant bacterium, transgenic cell or recombinant virus of claim 3 for interfering with the expression of a gene of interest in a plant.