CN117625778B

CN117625778B - Method, primer and kit for detecting multiple mutations of IKBKG genes of pigment incontinence disease

Info

Publication number: CN117625778B
Application number: CN202410094846.XA
Authority: CN
Inventors: 高媛; 徐佩文; 高选; 陈子江; 马金龙
Original assignee: Shandong University
Current assignee: Shandong University
Priority date: 2024-01-24
Filing date: 2024-01-24
Publication date: 2024-04-30
Anticipated expiration: 2044-01-24
Also published as: CN117625778A

Abstract

The invention discloses a method, a primer and a kit for detecting various mutations of a IKBKG gene of a pigment incontinence disease, and belongs to the technical field of biology. The invention simultaneously amplifies a plurality of fragments of IP related IKBKG pathogenic genes through long fragment-GAP PCR and prepares a single-molecule long-reading long sequencing library, thereby realizing the purpose of comprehensively, accurately and rapidly detecting a plurality of mutations of the IP related genes of a plurality of samples. The invention can detect all the point mutations on the exon IKBKG of the IP related gene which is researched and found at present, and can detect all the unknown types of point mutations on IKBKG genes; the method can detect the large fragment deletion of up to 50kb and down to 100kb on IKBKG and judge the accurate position of the breaking point of the large fragment deletion, and solves the problems of incomplete coverage of the IKBKG pathogenic gene detection at the present stage, complicated gene diagnosis detection method and clinical missed detection and false detection caused by single detection mutation types of different methods.

Description

Method, primer and kit for detecting multiple mutations of IKBKG genes of pigment incontinence disease

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a method, a primer and a kit for detecting various mutations of a IKBKG gene of a pigment incontinence disease.

Background

The disclosure of this background section is only intended to increase the understanding of the general background of the invention and is not necessarily to be construed as an admission or any form of suggestion that this information forms the prior art already known to those of ordinary skill in the art.

Pigment incontinence (Incontinentia Pigmenti, IP) or Bloch-Sulzberger syndrome is a rare X-linked dominant hereditary dermatological disorder. IP is the result of IKBKG gene mutations. IP is fatal to men, who typically die prior to birth, and women can exhibit phenotypes of varying severity. Phenotypes generally occur within the first few weeks of life, most commonly in females and rarely in males. Clinically manifested as skin, central nervous system, eyes, teeth, hair and nails. Skin involvement is the first noted, found in more than 90% of patients, who are found after birth and develop in the first two years of birth, and undergo four phases: vesicular, warty rash, pigmentation, and hypopigmentation/atrophy. Central nervous system diseases and vision loss are serious clinical phenotypes of IP, which can lead to serious disability in these patients. The prevalence of IP worldwide is estimated to be 1/50000 to 0.2/100000, with most of the worldwide individuals suffering from this disease being females (92% to 97%), with about 28 new cases each year worldwide.

IKBKG is located on the X chromosome Xq28 and is a gene of total length 23 kb consisting of 9 exons. IKBKG activate NF-KB to participate in apoptosis (cell survival), cell cycle, inflammation, immunity and other pathways; in most cases, IP is from IKBKG loss of function, resulting in inhibition of NF-KB activity. In the same X-stain, IKBKG sequences have two copies, one of which is a nonfunctional pseudogene IKBKGP, containing only exons 3-10, 22kb in size. It is about 85kb from exon 10 of the IKBKG gene at the telomere of the IKBKG gene, opposite in direction to the IKBKG gene, and the pseudogene is not expressed. The deletion of exon 4-10 of IKBKG gene in 80% of IP cases, the deletion of this fragment common to the pseudogene IKBKGP gene and IKBKG gene, does not lead to morbidity. Furthermore, unusual mutations exist in IP cases and no genetic cause of the disease can be found.

In the traditional method, detection of the IKBKG deletion of exons 4-10 using PCR technology is the first technique for IKBKG variant screening, since exons 4-10 deletion accounts for 79% of female IP cases, or 70% of total IP cases. If PCR technology screening does not find the corresponding IKBKG exons 4-10 deleted, sanger sequencing is used to screen for point mutations and indels within the IKBKG coding region, and diagnostic sensitivity is expected to increase by about 9%. Besides the above method, qPCR technology can be used for screening non-classical deletions, which accounts for about 4% of IP cases. In addition, the analytical method of the IP molecular diagnosis needs to consider the sex of the case. In IP female patients, the variation is in a constitutive heterozygous state, indicating that it can be found in all cells of the body. Mutations often exist in chimeric fashion in individuals in IP male patients, and furthermore, cells expressing IKBKG variants may be gradually eliminated and eventually cleared, making diagnosis in male patients extremely difficult.

Although NGS sequencing is more extensive and cheaper, it is considered not useful for IP diagnostics due to the presence of pseudogene IKBKGP 1. IKBKG and IKBKGP1 are both located within the Xq28 region and share partial homology up to 99%. The presence of such a false gene makes conventional analysis of the capture probe data difficult because it reduces the depth of reading, reduces the quality of localization, and results in poor alignment reads, thus resulting in false positive results. In the Whole Exome Sequencing (WES) of NGS, IKBKGP detection masks were performed using signaling software, making NGS possible in IKBKG mutation detection. In addition, the probability of false negatives can be reduced by detecting tissues selected directly in the suspicious phenotype (i.e., skin) and analyzing multiple tissues, i.e., blood, fresh skin, saliva, and sperm samples, because of the presence of low levels of chimeras.

At present, the detection of IKBKG part of structural variation and point mutation can be realized based on qPCR, sanger sequencing or second generation sequencing methods, but the detection mainly has the following limitations:

1. the simultaneous detection of all the point mutation types and the structural mutation types of IKBKG genes in the same system cannot be realized;

2. Due to the high degree of homology between IKBKG and IKBKGP1, the binding of qPCR probes and the design of Sanger sequencing primers may be affected, resulting in a degree of false-negatives or false-positives;

3. when two or more mutations exist at the same gene locus at the same time, the existing method cannot distinguish cis-form mutation from trans-form mutation and whether the mutation has linkage effect;

4. The traditional method needs a plurality of technologies to be combined, so that labor intensity is high, the requirement on sample quality is higher, the gene diagnosis time is too long, and the detection cost is high.

Disclosure of Invention

In order to solve the defects of the prior art, the invention aims to solve the problems of incomplete coverage of the pathogenic gene detection at the current stage IKBKG, complicated gene diagnosis detection method and clinical missed detection and false detection caused by single detection variation types of different methods. In this regard, the invention provides a method, a primer and a kit for detecting multiple mutations of the gene IKBKG of the pigment incontinence disease, and the method can be used for simultaneously amplifying multiple fragments of the pathogenic gene IKBKG related to IP through long fragment-GAP PCR and preparing a single-molecule long-reading long sequencing library so as to realize the purpose of comprehensively, accurately and rapidly detecting multiple mutations of the gene IKBKG related to IP of multiple samples.

In order to achieve the above purpose, the technical scheme of the invention is as follows:

In a first aspect of the present invention, there is provided a primer for detecting a plurality of mutations of the IKBKG gene for pigmentary incontinence, the primer comprising a first primer set, a second primer set and a third primer set, wherein the first primer set consists of primers IKBKG _full-F, IKBKG _full-R;

The nucleotide sequence of the primer IKBKG _full-F is selected from SEQ ID NO:1-4, wherein the nucleotide sequence of IKBKG _full-R is shown as SEQ ID NO: 5 is shown in the figure;

The second primer group consists of primers IKBKGP-F, IKBKG _full-R;

The nucleotide sequence of the primer IKBKGP-F is selected from SEQ ID NO: 6-8;

The third primer group consists of IKBKG_Gap1-F、IKBKG_Gap2-F、IKBKG_Gap3-F、IKBKG_Gap4-F、IKBKG_Gap5-F、IKBKG_Gap1-R、IKBKG_Gap2-R、IKBKG_Gap3-R and IKBKG _Gap4-R;

The nucleotide sequence of IKBKG _Gap1-F is selected from SEQ ID NO: 9. 17, and any one of the following;

The nucleotide sequence of IKBKG _Gap2-F is selected from SEQ ID NO: 10. 15, 18, 35;

the nucleotide sequence of IKBKG _gap3-F is selected from SEQ ID NO: 11. 19, and any one of the following;

The nucleotide sequence of IKBKG _gap4-F is selected from SEQ ID NO: 12. 20, and any one of the following;

The nucleotide sequence of IKBKG _Gap5-F is selected from SEQ ID NO: 13. 14, 21, 34;

the nucleotide sequence of IKBKG _Gap1-R is selected from SEQ ID NO: 16. 22, 28;

The nucleotide sequence of IKBKG _Gap2-R is selected from SEQ ID NO: 27. 23, 24, 29;

The nucleotide sequence of IKBKG _Gap3-R is selected from SEQ ID NO: 25. 30, 32, 33;

The nucleotide sequence of IKBKG _Gap4-R is selected from SEQ ID NO: 26. 31.

Among the above primers for detecting various mutations in the gene IKBKG for pigmentary incontinence, the first primer set was used to amplify all exons within the IKBKG gene, the second primer set was used to amplify IKBKGP, and the third primer set was used to amplify the upstream and downstream deletions of IKBKG.

The above primers for detecting various mutations in the gene IKBKG for pigmentary incontinence can amplify the entire sequence within the primer range, including any type of mutated sequence within the primer range. The amplification product is between about 10K and about 18K. If there is a SNP at the primer position, degenerate base primers are used.

The primer for detecting various mutations of the IKBKG gene of the pigment incontinence can at least detect simultaneously when a system amplifies IKBKG gene target fragments and a pseudogene IKBKGP1 fragment thereof: SNVs and indels on the IKBKG gene exons, large fragment deletion variants within 50 kb upstream and 100 kb downstream of the IKBKG gene. Wherein the point mutations comprise at least more than 180 point mutations in the IKBKG genes as shown in Table 2. Wherein, the point mutation and the structural variation on the gene locus can be inquired in LOVD, clinVar and references; see table 2 for detailed mutation information.

Among the above primers for detecting various mutations of the gene IKBKG for pigmentary incontinence, each primer is provided with a tag sequence at the end. DNA of 5-50 nt different sequences, namely DNA bar code (Barcode), can be added at the 5' end of the primer for distinguishing different samples; preferably, the 5' end Barcode of the F and R primers may be the same or different, and may be selected as desired by one skilled in the art.

Among the above primers for detecting various mutations of the gene IKBKG for pigmentary incontinence, the molar ratio of each primer in the first primer set is equal; the molar ratio of each primer in the second primer group is equal; the molar ratio of each primer in the third primer set is equal.

In a second aspect of the present invention, there is provided an agent for detecting a plurality of mutations in the gene IKBKG for pigmentary incontinence, the agent comprising a first agent, a second agent;

the first reagent comprises DNA polymerase, reaction buffer solution and the primer for detecting various mutations of the IKBKG genes of the pigment incontinence disease in the first aspect;

the second reagent comprises end repair enzyme, a joint, ligase, DNA purification magnetic beads, reaction buffer solution and exonuclease;

Or, the second reagent comprises a terminal repair enzyme, a linker, a ligase, a DNA purification magnetic bead, 80% ethanol, and a reaction buffer.

Among the above reagents for detecting various mutations in the gene IKBKG of the incontinence disease, the amplification product of the first reagent may be purified or not before the next reaction, and may be selected as desired by those skilled in the art.

In the reagent for detecting multiple mutations of the gene IKBKG for pigmentary incontinence, the concentration of each of the primers for detecting multiple mutations of the gene IKBKG for pigmentary incontinence in the first reagent is 0.3 to 0.5. Mu.M. And the PCR amplification is performed in one reaction tube using the first reagent.

Among the above reagents for detecting multiple mutations of the gene IKBKG for dye incontinence, the second reagent is used for constructing a single-molecule long-reading long-sequencing library, and the single-molecule long-reading long-sequencing is selected from real-time single-molecule sequencing or nanopore sequencing platforms, but is not limited to the two platforms;

When single-molecule long-read long sequencing is PacBio sequencing (real-time single-molecule sequencing), the second reagent comprises a terminal repair enzyme, a linker, a ligase, a DNA purification magnetic bead, a reaction buffer, and an exonuclease. PacBIO library adaptors are blunt-ended adaptors or TA adaptors.

The universal blunt-ended adaptor for PacBIO has a nucleotide sequence of 5'-PATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT-3' (SEQ ID NO: 36) and is annealed to form a blunt-ended stem-loop adaptor aptamer. DNA (Barcode) with different sequences of 5-50nt can be added to the stem to form different adaptor aptamers with Barcode. PacBIO libraries with different Barcode can be pooled together for sequencing.

The nucleotide sequence of the PacBIO universal TA-linked linker was 5'-PATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGATT-3' (SEQ ID NO: 37), which was annealed to form a blunt-ended stem-loop linker aptamer. DNA (Barcode) with different sequences of 5-50nt can be added to the stem to form different adaptor aptamers with Barcode. PacBIO libraries with different Barcode can be pooled together for sequencing.

Wherein the PacBio linker may or may not be Barcode. Preferably, the PacBio adapter is a PacBio corporation designed Barcode or a self-designed Barcode, which one skilled in the art can choose as desired.

Wherein PacBIO sequencing is matched to Pacific Biosciences company sequencing platform.

When single molecule long read long sequencing is Nanopore sequencing, the second PCR reagents include end repair enzymes, adaptors, ligases, DNA purification magnetic beads, 80% ethanol, and reaction buffer. The Nanopore library adaptors are blunt-ended or TA-ligated.

Wherein the Nanopore linker may or may not be Barcode. Preferably, the Nanopore connector is a Barcode designed by ONT company or a Barcode designed by itself, and can be selected by those skilled in the art as required.

Wherein the Nanopore library matches the ONT company sequencing platform.

In a third aspect, the invention provides a kit for detecting multiple mutations of a gene IKBKG for treating pigmentary incontinence, which comprises the primer for detecting multiple mutations of a gene IKBKG for treating pigmentary incontinence according to the first aspect or the reagent for detecting multiple mutations of a gene IKBKG for treating pigmentary incontinence according to the second aspect.

Application of the primer for detecting the multiple mutations of the gene IKBKG of the pigmentary incontinence or the reagent for detecting the multiple mutations of the gene IKBKG of the pigmentary incontinence or the kit for detecting the multiple mutations of the gene IKBKG of the pigmentary incontinence in the production of interlocking products for simultaneously detecting the multiple mutations of the gene IKBKG of the pigmentary incontinence and different mutations; the various mutations include point mutations of IKBKG gene exons and large fragment deletions of IKBKG gene, which are also within the scope of the present invention.

In a fourth aspect of the present invention, there is provided a method for detecting a plurality of mutations in the gene IKBKG for pigmentary incontinence, comprising the steps of:

1) Obtaining/preparing a subject sample;

2) Performing PCR amplification on the subject sample by using the primer for detecting the multiple mutations of the IKBKG genes of the pigment incontinence according to the first aspect to obtain a PCR amplification product;

3) Constructing a single-molecule long-reading long sequencing library;

4) Sequencing and analyzing the mutation type of the gene.

The invention provides a method for detecting various mutations of an IP related IKBKG gene based on long fragment-GAP PCR amplification and single-molecule long-reading long sequencing. The long fragment-GAP PCR amplification is realized in a reaction tube, 1 fragment of the IP related IKBKG gene for detecting exons SNVs and indexes, 1 fragment of IKBKGP pseudogene fragment and GAP fragment for detecting large fragment deletion amplification are respectively amplified, and the characteristics of single-molecule long reading and long sequencing platform reading and long and the like are combined, so that IKBKG gene mutation can be accurately, quickly and high-flux detected. The method has simple and convenient operation, reliable quality and strong repeatability of the long fragment PCR and single-molecule long-reading long-sequencing library, and is favorable for the application of the single-molecule long-reading long-sequencing technology in clinical detection.

In the method for detecting the multiple mutations of the IKBKG genes of the pigment incontinence disease, the PCR amplified template is the genome DNA of a sample of a subject;

The PCR amplification procedure was: 94 ℃ 2 min;98 ℃ 10s, 68 ℃ 20min, 32 cycles; 10 min at 68 ℃.

In the above method for detecting multiple mutations of the gene IKBKG for pigmentary incontinence, the single-molecule long-reading long-sequencing is selected from real-time single-molecule sequencing or nanopore sequencing platforms, but is not limited to the two platforms; the gene mutation comprises a point mutation of IKBKG gene exons and a large fragment deletion of IKBKG gene.

In the above method for detecting various mutations in the gene IKBKG for pigmentary incontinence, the sample from the subject is selected from a biological sample or a gDNA extracted from the sample. Wherein the biological sample is selected from cultured cell lines, blood, amniotic fluid, villus, gametes, blasts, joint fluid, urine, sweat, saliva, feces, cerebrospinal fluid, ascites fluid, hydrothorax, bile, pancreatic fluid, or the like.

The beneficial effects of the invention are as follows:

the method based on the specific combination of long fragment PCR amplification and single-molecule long-reading long sequencing can realize high-specificity, accurate and rapid detection of multiple mutations of the multiple sample IP related IKBKG pathogenic genes. In particular, the method has the following advantages:

(1) The detection range is wide. The invention can detect all the point mutations on the exons of the IP related genes IKBKG which are researched and found at present, and 183 or more kinds of point mutations can be included in total, and all unknown types of point mutations on IKBKG genes can be detected; large fragment deletions within IKBKG upstream 50 kb and downstream 100 kb can be detected and the exact breakpoint location of the large fragment deletion can be determined.

(2) Multiple mutation types are detected by a single kit. The conventional method needs to set a detection system for each mutation type: detection of SNVs and Indels requires detection using pcr+sanger or NGS methods; the large fragment deletion associated with IKBKG gene needs to be detected using qPCR; the invention detects a plurality of mutations including SNVs, indels and structural variation in one reaction primer system.

(3) The detection false detection and omission rate is low. The most common method for detecting the IKBKG point mutation of the pathogenic gene of IP currently used is PCR+Sanger. Because IKBKG genes are huge, the interference of the pseudogene IKBKGP1 exists, the detection range of Sanger is limited, the detection experiment is complicated, and the missed diagnosis of pathogenic mutation is easy to cause to be judged as false negative. The method directly amplifies all exon regions of IKBKG genes and all GAP fragments with IKBKG related large fragment deletion, thereby greatly reducing the risks of false detection and omission of patients, greatly improving the simplicity of IP gene diagnosis and greatly reducing the time cost and labor cost of IP gene diagnosis.

(4) Samples are diversified. Templates for PCR may be peripheral blood, dried blood spots or extracted genomic DNA, but also cell lines of human origin or other specific tissues.

(5) High throughput detection. The single-molecule long-reading long-sequencing can realize 384 Barcode joints, and more Barcode joints can be designed according to the requirement. Or a dual-Barcode system with a primer and an adapter for the Barcode is utilized to realize more than one Barcode combination. The high-flux characteristic of the single-molecule long-reading long-sequencing platform determines that high-flux sample detection can be realized.

(6) The accuracy is high. The dumbbell library of PacBio can be read for a plurality of rounds during sequencing, and the base accuracy of the sequencing result after correction is more than 99%. Furthermore, pacBIO sequencing errors were random, and the base accuracy was corrected by sequencing depth to greater than 99.9%. Thus, the mutation of the gene within the detection range of the primer can be precisely interpreted.

(7) The detection time is flexible. The Nanopore platform can generate data in minutes and can initiate data analysis in minutes or hours depending on the actual data volume requirements. The Nanopore platform has time advantages when the requirements for detection aging are high.

Drawings

The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the invention.

FIG. 1 is a schematic diagram of the design of a primer for detecting an IP related IKBKG gene fragment;

FIG. 2 is a DNA gel electrophoresis of long fragment PCR amplification IKBKG/IKBKGP 1;

FIG. 3 is a DNA gel electrophoresis chart of comparative example 1, wherein 1-5 are the results of the primer protection method, 6 IKBKG_full-F & IKBKG _full-R;

FIG. 4 is a graph of the PacBio sequencing results for a healthy human sample; wherein A is IKBKG-haplotype 1, and B is IKBKG-haplotype 2;

FIG. 5 is a diagram of the result of PacBio sequencing of IKBKG large fragment deletion samples; wherein A is IKBKG-haplotype 1, B is IKBKG-haplotype 2 Del exon4-exon10;

FIG. 6 is a graph of the result of PacBio sequencing of a IKBKG point mutation deletion sample; wherein A is IKBKG-haplotype 1, B is IKBKG-haplotype c.1102_1109dup.

Detailed Description

In order to enable those skilled in the art to more clearly understand the technical scheme of the present invention, the technical scheme of the present invention will be described in detail with reference to specific embodiments.

Example 1: the long fragment-GAP PCR method of the invention is utilized to amplify the mutation of the IP related genes

The reaction system was prepared as follows in table 3, and peripheral blood, dried blood spots and genomic DNA samples were amplified:

TABLE 3 Table 3

Note that: primer set MIX includes 12 primers, respectively:

IKBKG _full-F with the nucleotide sequence of SEQ ID NO. 1;

IKBKG _full-R with the nucleotide sequence of SEQ ID NO. 5;

IKBKGP-F with the nucleotide sequence of SEQ ID NO. 6;

IKBKG _Gap1-F with the nucleotide sequence of SEQ ID NO 9;

IKBKG _Gap2-F with the nucleotide sequence of SEQ ID NO. 10;

IKBKG _Gap3-F with the nucleotide sequence of SEQ ID NO. 11;

IKBKG _Gap4-F with the nucleotide sequence of SEQ ID NO. 12;

IKBKG _Gap5-F with the nucleotide sequence of SEQ ID NO. 13;

IKBKG _Gap1-R with the nucleotide sequence of SEQ ID NO. 16;

IKBKG _Gap2-R with the nucleotide sequence of SEQ ID NO 27;

IKBKG _Gap3-R with the nucleotide sequence of SEQ ID NO. 25;

The nucleotide sequence is IKBKG _Gap4-R of SEQ ID NO. 26.

On a PCR apparatus, pre-amplification was performed under the conditions shown in Table 4 below:

TABLE 4 Table 4

After the amplification is completed, 5 mu L of each sample is taken and detected on 1% DNA gel, and the result is shown in figure 2, and by taking different samples as templates, the IKBKG genes related to IP can be effectively amplified.

Example 2: construction of PacBio sequencing library Using the Long fragment PCR method of the present invention

Step 1: long fragment PCR amplification

The reaction system was prepared as in table 5 below, and samples of peripheral blood samples of different types of IP-related IKBKG gene mutations were amplified:

TABLE 5

Note that: primer set MIX includes 12 primers, respectively:

IKBKG _full-F with the nucleotide sequence of SEQ ID NO. 2;

IKBKG _full-R with the nucleotide sequence of SEQ ID NO. 5;

IKBKGP-F with the nucleotide sequence of SEQ ID NO. 7;

IKBKG _Gap1-F with the nucleotide sequence of SEQ ID NO. 17;

IKBKG _Gap2-F with the nucleotide sequence of SEQ ID NO. 15;

IKBKG _Gap3-F with the nucleotide sequence of SEQ ID NO. 19;

IKBKG _Gap4-F with the nucleotide sequence of SEQ ID NO. 20;

IKBKG _Gap5-F with the nucleotide sequence of SEQ ID NO. 14;

IKBKG _Gap1-R with the nucleotide sequence of SEQ ID NO. 22;

IKBKG _Gap2-R with the nucleotide sequence of SEQ ID NO. 23;

IKBKG _Gap3-R with the nucleotide sequence of SEQ ID NO. 30;

the nucleotide sequence is IKBKG _Gap4-R of SEQ ID NO. 31.

On a PCR instrument, pre-amplification was performed under the conditions shown in Table 6 below:

TABLE 6

After amplification, the amplified product was put into a centrifuge, 10000 rpm, and centrifuged 20: 20 min. After centrifugation, the mixture was left to stand horizontally, and 4. Mu.L of the supernatant was added to a fresh tube.

Step 2: construction of PacBIO sequencing library

The reaction system was prepared according to the following table 7:

TABLE 7

On a PCR instrument, the reaction was performed under the following conditions: 37℃20 min, 25℃15 min, 65℃10 min. After completion of the reaction, 0.5 μ L Exonuclease III (NEB, cat#M0206L) and 0.5 μ L Exonuclease VII (NEB, cat#M0379L) were added and the reaction was continued at 37℃for 1 hour. The DNA was purified twice with 0.6x AMpure PB magnetic beads (PacBIO, cat# 100-265-900) according to the manufacturer's instructions and finally eluted with 10. Mu.L of an Elutation Buffer. The resulting DNA eluate was the target DNAPacBio sequencing library. The DNA concentration was determined on Qubit 3 Fluoromter (ThermoFisher, cat#Q 33216) using the Qubit dsDNA HS reagent (ThermoFisher, cat#Q 32851). When there are multiple sample PacBio sequencing libraries, equal amounts of the libraries can be mixed together to prepare a mixed library.

Step 3: pacBio on-machine sequencing and analysis

Based on the total and molar concentration of the library, the appropriate volume of library was reacted with binding reagents (PacBIO, cat# 101-820-200) and primers (PacBIO, cat# 100-970-100) to prepare the final on-machine library. Representative sequencing results are shown in FIGS. 4-6, where FIG. 4 is a schematic representation of a healthy human IGV, FIG. 5 is a schematic representation of a large fragment deletion variant IGV, and FIG. 6 is a schematic representation of a point mutant IGV.

Example 3: detection and verification of IKBKG Gene mutation detection

Peripheral blood genomic DNA from 5 subjects was collected as a validated sample for 5 cases, and referring to example 2, IP-related IKBKG gene locus multiple mutations were simultaneously detected using the methods (and kits) of the present invention. Meanwhile, the method of qPCR is used for detecting IKBKG structural variations, and the method of PCR+Sanger sequencing is used for detecting IKBKG gene point mutation. The results obtained by the invention are compared with the control results, and the results are shown in Table 8, and the results of 5 samples are completely consistent.

TABLE 8

Therefore, the specificity and sensitivity of the detection result by the method reach 100% by comparison with qPCR or PCR+Sanger sequencing methods. Moreover, of the 5 samples, the 2 samples define specific fracture point positions.

Comparative example 1: the primer in the long fragment-GAP PCR method of the invention is utilized to simultaneously amplify the IKBKG genes related to IP and the primer protected in the method

The reaction system was prepared as follows in table 9, amplifying peripheral blood, dried blood spots and genomic DNA samples:

TABLE 9

Note that: the primer protected in the non-present method is selected from any one of the following 5 primer sets:

1、IKBKG-N-F1/IKBKG-N-R；2、IKBKG-N-F2/IKBKG-N-R；

3、IKBKG-N-F3/IKBKG-N-R；4、IKBKG-N-F4/IKBKG-N-R；

5、IKBKG-N-F5/IKBKG-N-R。

wherein the nucleotide sequences of the respective primers in the 5 primer sets are as follows:

IKBKG-N-F1:CAGCCCTTGCCCTGTTGGATGAATA（SEQ ID NO:38）；

IKBKG-N-R: GGCCGGCCCTACTCAATGCACTCCA（SEQ ID NO:39）；

IKBKG-N-F2:CTCCCCTGCTGCCTTTCTCTTTCAGCC（SEQ ID NO:40）；

IKBKG-N-F3:GCTGCCTTTCTCTTTCAGCCCTTGC（SEQ ID NO:41）；

IKBKG-N-F4:TGGGTCTCCTGTGACTCCCCTGCTG（SEQ ID NO:42）；

IKBKG-N-F5:GTGCAGGGACCCTGGCACAGCGTAT（SEQ ID NO:43）。

on a PCR apparatus, pre-amplification was performed under the conditions shown in Table 10 below:

Table 10

After the amplification is completed, 5 mu L of each sample is taken and detected on 1% DNA gel, the result is shown in figure 3, the same sample is taken as a template, only the primer of the invention can amplify the gene IKBKG related to IP, and no other primer can form effective fragments.

Table 1 amplification primers for the target Gene sequences

/>

TABLE 2IKBKG Point mutation types of genes

TABLE 2-1IKBKG Point mutation types of Gene

It is to be noted that: while the above embodiments have demonstrated a series of features of the present invention, it will be apparent to those skilled in the art from this disclosure that the reagents, reaction conditions, etc. involved in the long fragment-GAP PCR reaction and single-molecule long read long sequencing library construction can be adapted and varied according to specific needs. It will thus be appreciated that those skilled in the art will be able to devise numerous alternative arrangements which, although not explicitly described herein, embody the principles of the invention and are included within its spirit and scope.

The above description is only of the preferred embodiments of the present invention and is not intended to limit the present invention, but various modifications and variations can be made to the present invention by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A primer for detecting a plurality of mutations in a gene for dye incontinence IKBKG, wherein the primer comprises a first primer set, a second primer set and a third primer set;

wherein the first primer group consists of a primer IKBKG _full-F, IKBKG _full-R;

the nucleotide sequence of the primer IKBKG _full-F is selected from SEQ ID NO: 2. the nucleotide sequence of IKBKG _full-R is shown in SEQ ID NO:5 is shown in the figure;

The second primer group consists of primers IKBKGP-F, IKBKG _full-R;

The nucleotide sequence of the primer IKBKGP-F is selected from SEQ ID NO:7, preparing a base material;

the nucleotide sequence of IKBKG _Gap1-F is selected from SEQ ID NO:17;

the nucleotide sequence of IKBKG _Gap2-F is selected from SEQ ID NO:15;

the nucleotide sequence of IKBKG _gap3-F is selected from SEQ ID NO:19;

the nucleotide sequence of IKBKG _gap4-F is selected from SEQ ID NO:20, a step of;

the nucleotide sequence of IKBKG _Gap5-F is selected from SEQ ID NO:14;

the nucleotide sequence of IKBKG _Gap1-R is selected from SEQ ID NO:22;

the nucleotide sequence of IKBKG _Gap2-R is selected from SEQ ID NO:23;

the nucleotide sequence of IKBKG _Gap3-R is selected from SEQ ID NO:30;

the nucleotide sequence of IKBKG _Gap4-R is selected from SEQ ID NO:31.

2. The primer for detecting multiple mutations in the gene for urinary incontinence IKBKG as claimed in claim 1, wherein each primer is provided with a tag sequence at the end;

the molar ratio of each primer in the first primer group is equal; the molar ratio of each primer in the second primer group is equal; the molar ratio of each primer in the third primer set is equal.

3. An agent for detecting a plurality of mutations in the gene IKBKG for pigmentary incontinence, said agent comprising a first agent, a second agent;

the first reagent comprises a DNA polymerase, a reaction buffer and the primer for detecting a plurality of mutations of the gene IKBKG for the pigmentary incontinence according to claim 1 or 2;

4. The reagent for detecting multiple mutations in the gene for urinary incontinence IKBKG as claimed in claim 3, wherein the concentration of each of the primers for detecting multiple mutations in the gene for urinary incontinence IKBKG as claimed in claim 1 or 2 in the first reagent is 0.3 to 0.5. Mu.M.

5. The reagent for detecting multiple mutations in the dye incontinence IKBKG gene as claimed in claim 3, wherein the second reagent is used to construct a single molecule long read long sequencing library, the single molecule long read long sequencing comprising a real time single molecule sequencing or nanopore sequencing platform.

6. A kit for detecting multiple mutations in the gene for urinary incontinence IKBKG, comprising the primer for detecting multiple mutations in the gene for urinary incontinence IKBKG according to claim 1 or 2 or the reagent for detecting multiple mutations in the gene for urinary incontinence IKBKG according to any one of claims 3 to 5.