CN117511954B

CN117511954B - HCFC1 gene mutant, mutant protein, reagent, kit and application

Info

Publication number: CN117511954B
Application number: CN202311850080.5A
Authority: CN
Inventors: 曾桥; 刘亚宁; 徐霞
Original assignee: Hunan Jiahui Biotechnology Co Ltd
Current assignee: Hunan Jiahui Biotechnology Co Ltd
Priority date: 2023-12-29
Filing date: 2023-12-29
Publication date: 2024-04-26
Anticipated expiration: 2043-12-29
Also published as: CN117511954A

Abstract

The invention provides a HCFC1 gene mutant, mutant protein, a reagent, a kit and application. Compared with the wild type HCFC1 gene, the HCFC1 gene mutant is mutated from a base C to a base G at 2318 th base of the 13 th exon of the wild type HCFC1 gene. The HCFC1 gene mutant enriches the pathogenic mutation spectrum of the cb 1X-type methylmalonic acid blood disease, can screen or diagnose a carrier or a patient of the pathogenic gene mutation of the cb 1X-type methylmalonic acid blood disease by detecting whether a subject carries the mutation, provides instruction of eugenic prepotency and therapeutic intervention, provides brand-new theoretical basis for the treatment of the cb 1X-type methylmalonic acid blood disease patient, and can provide possible drug targets for the treatment of the cb 1X-type methylmalonic acid blood disease.

Description

HCFC1 gene mutant, mutant protein, reagent, kit and application

Technical Field

The invention relates to the field of detection reagents, in particular to a HCFC1 gene mutant, mutant protein, a reagent, a kit and application.

Background

Methylmalonic acid (methylmalonic academia, MMA) is an autosomal recessive genetic disease, mainly due to the defects of methylmalonyl-CoA mutase (methymalonyl-CoA mutase, MCM) or the metabolic disorder of its coenzyme cobalamin (coblamin, cb1; namely vitamin B ₁₂), which leads to abnormal storage of methylmalonic acid and related metabolites, and causes damage to multiple organs such as brain, liver, kidney, bone marrow and heart. The enzyme defect types are classified into two major types, MCM-deficient (Mut type) [ MIM 251000 ] and vitamin B ₁₂ metabolic disorder (cb 1 type). Mut types can be further classified into Mut ⁰ and Mut ^- subtypes according to complete or partial lack of MCM enzyme activity; type cb1 includes cb1A [ MIM 251100 ], cb1B [ MIM 251110 ], cb1C [ MIM 277400 ], cb1D [ MIM 277410 ], cb1F [ MIM277380 ], and cb1D-2 [ MIM 277410 ]. Methylmalonic acid urine is the most common organic acid urine, has complex clinical phenotype and genotype, and has common biochemical characteristics of increasing the concentration of blood propionyl carnitine and urine methylmalonic acid and increasing the total homocysteine with or without blood. MMA prevalence varies greatly, about 1.2-3/10 ten thousand, with 95% of the cb1C subtype. The mutation of the autosomal genes related to the methylmalonic acid urine disease is multiple, the MUT gene defect is the main type of the methylmalonic acid urine disease, the MMACHC gene defect is the main type of the methylmalonic acid urine disease combined with homocysteinemia, and the genetic mode is autosomal recessive inheritance; x-linked genetic methylmalonic acid is rare and is mainly related to the pathogenicity of HCFC1 gene mutation of an X chromosome transcription auxiliary regulator.

Disclosure of Invention

The invention mainly aims to provide HCFC1 gene mutants, mutant proteins, reagents, kits and applications thereof, which are used for accurately judging cb 1X-type methylmalonic acid blood diseases, are used for genetic diagnosis of cb 1X-type methylmalonic acid blood diseases to guide treatment, and are used for genetic diagnosis before embryo implantation and technical problems in prenatal and postnatal care.

In order to achieve the above object, the present invention provides a mutant of HCFC1 gene, wherein the mutant of HCFC1 gene is obtained by mutating the 2318 th base of the 13 th exon of the wild type HCFC1 gene from the base C to the base G, compared with the wild type HCFC1 gene.

The invention also provides a HCFC1 mutant protein, wherein compared with a protein encoded by a wild HCFC1 gene, the 773 rd amino acid is mutated from proline to arginine.

The invention also provides application of the HCFC1 gene mutant as a detection target in preparation of a cb1X type methylmalonic acidemia detection reagent and/or a detection kit.

Further, the detection reagent and/or the detection kit comprises amplification primers of HCFC1 gene mutants, wherein the amplification primers comprise an upstream primer HCFC1-1F and a downstream primer HCFC1-1R; the upstream primer HCFC1-1F comprises a nucleotide sequence shown as SEQ ID NO.1, and the downstream primer HCFC1-1R comprises a nucleotide sequence shown as SEQ ID NO. 2.

Further, the detection reagent and/or the detection kit comprises sequencing primers of HCFC1 gene mutants, wherein the sequencing primers comprise an upstream primer HCFC1-Seq1F and a downstream primer HCFC1-Seq1R; the upstream primer HCFC1-Seq1F comprises a nucleotide sequence shown as SEQ ID NO. 3; the downstream primer HCFC1-Seq1R comprises a nucleotide sequence shown as SEQ ID NO. 4.

The invention also provides application of the HCFC1 mutant protein as a detection target in preparation of a cb1X type methylmalonic acidemia detection reagent and/or a detection kit.

The invention also provides a cb1X type methylmalonic acidemia detection reagent and/or a detection kit, wherein the detection reagent and/or the detection target of the detection kit comprises the HCFC1 gene mutant or the HCFC1 mutant protein.

The invention has the beneficial effects that:

the invention discovers that mutation of 2318 th base of 13 th exon of wild HCFC1 gene from base C to base G can cause cb1X type methylmalonic acid blood disease for the first time. The HCFC1 gene mutant enriches the pathogenic mutation spectrum of the cb 1X-type methylmalonic acid blood disease, can screen or diagnose a pathogenic gene mutation carrier or a patient of the cb 1X-type methylmalonic acid blood disease by detecting whether a subject carries the mutation, so as to provide instruction of prepotency and therapeutic intervention, provide brand-new theoretical basis for the treatment of the cb 1X-type methylmalonic acid blood disease patient, and provide possible drug targets for the treatment of the cb 1X-type methylmalonic acid blood disease.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are required in the embodiments or the description of the prior art will be briefly described, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and other drawings may be obtained according to the structures shown in these drawings without inventive effort for a person skilled in the art.

FIG. 1 shows a genetic map of the cb1X family of methylmalonic acid blood No. 1; wherein,Represents a dead male individual and,Represents a dead female individual, +.o represents a normal male individual, +.o represents a normal female individual, +.a female carrier, ■ represents a male patient, < - > represents a fetus, ↗ represents a forerunner;

FIG. 2 shows a graph of the results of detection of genotypes of the HCFC1 family NM-005334.3: exon13: c.2318C > G: p.P773R locus by Sanger sequencing; wherein, layer A: hemizygous mutation in family 1; B. c, F and H layers: genotype 1 family is heterozygous mutant; D. e and G layers: genotype in line 1 is wild type (position of mutation indicated by arrow in sequencing diagram);

FIG. 3 shows a genetic map of the cb 1X-type family 2 of methylmalonic acid; wherein O represents a normal female individual, by which is meant a female carrier, ■ a male patient, ↗ a forerunner, o a fetus;

FIG. 4 shows a graph of the results of the detection of genotypes of the HCFC 1:NM-005334.3:exon 13:c.2318C > G:p.P773R locus of family 2 using the kit; wherein, B: genotype in family 2 is hemizygous mutant patient; and C layer: genotype in family 2 is heterozygous mutant patient; layers a and D: genotype in line No. 2 is wild type (position of mutation indicated by arrow in sequencing).

The achievement of the object, functional features and advantages of the present invention will be further described with reference to the drawings in connection with the embodiments.

Detailed Description

The following description of the embodiments of the present invention will be made clearly and fully with reference to the accompanying drawings, in which it is evident that the embodiments described are only some, but not all embodiments of the invention. All other embodiments, which can be made by those skilled in the art based on the embodiments of the present invention without making any inventive effort, are intended to fall within the scope of the present invention.

Moreover, the technical solutions of the embodiments of the present invention may be combined with each other, but it is necessary to be based on the fact that those skilled in the art can implement the embodiments, and when the technical solutions are contradictory or cannot be implemented, it should be considered that the combination of the technical solutions does not exist, and is not within the scope of protection claimed by the present invention.

In the present invention, the term "X-linked recessive inheritance" means that the pathogenic recessive mutant gene is on the X chromosome, the heterozygote is ill-resistant, and the carrier is ill-resistant only when the female is homozygous, and the hemizygous male is ill-resistant. Namely: when inherited in a recessive manner, since females have two X chromosomes, the trait or genetic disease controlled by the recessive gene is not revealed when the recessive pathogenic gene is in a heterozygous state (XAXa), such female phenotypically normal pathogenic gene carriers; it is only shown when both alleles on the X-chromosome are homozygous for the recessive pathogenic gene (XaXa). In male cells, there is only one X chromosome and the Y chromosome lacks a homologous segment, so that it occurs as long as there is a recessive pathogenic gene (XaY) on the X chromosome. Thus, only one gene of the paired alleles is present in the male cell, and is called a hemizygous.

The term "mutation" as used herein refers to an alteration of a wild-type polynucleotide sequence, meaning the addition, deletion and/or substitution of one or more (e.g., several) bases in a gene sequence or DNA sequence, into a variant, which may be naturally occurring or non-naturally occurring. The term "mutation" when used to describe a gene-encoded product or protein, refers to the addition, deletion and/or substitution of one or several (e.g., several) amino acid residues in the protein or encoded product.

The term "hemizygous mutation" as used herein refers to a gene which is monovalent, exists on only one chromosome, has no corresponding allele, and is called hemizygous, and is mutated, i.e., hemizygous.

The term "heterozygous mutation" herein means that the mutation is present in only one gene of a pair of alleles; the term "homozygotic mutation" is a mutation present in two genes of a pair of alleles, i.e., a double allelic mutation, each chromosome being mutated.

The term "homozygous mutation" as used herein refers to the occurrence of identical mutations in all alleles, i.e., double allelic mutations, each chromosome being mutated.

The term "missense mutation" as used herein refers to a change in the amino acid type and sequence of a polypeptide chain by changing the codon encoding an amino acid to one encoding another after base substitution.

The term "diagnosis" herein includes prediction of disease risk, diagnosis of the onset or absence of a disease, and also the assessment of disease prognosis.

The term "prenatal diagnosis" herein refers to definitive diagnosis of a high-risk fetus based on genetic counseling, mainly through genetic detection and imaging examination, and achieves the purpose of fetal selection through selective abortion of a diseased fetus, thereby reducing birth defect rate and improving prenatal quality and population quality.

In the present invention, a "primer" refers to a polynucleotide fragment, typically an oligonucleotide, containing at least 5 bases, such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more bases, for amplifying a target nucleic acid in a PCR reaction. The primer need not be completely complementary to the target gene to be amplified or its complementary strand, as long as it can specifically amplify the target gene. As used herein,

The term "specifically amplify" refers to a primer that is capable of amplifying a gene of interest by a PCR reaction, but not other genes. For example, specifically amplifying the HCFC1 gene means that the primer amplifies only the HCFC1 gene and not the other genes in the PCR reaction.

In order to accurately judge the cb 1X-type methylmalonic acid blood disease, the invention is used for the genetic diagnosis of the cb 1X-type methylmalonic acid blood disease to guide treatment, genetic diagnosis before embryo implantation and prenatal and postnatal care, and provides an HCFC1 gene mutant which leads to the cb 1X-type methylmalonic acid blood disease, wherein compared with a wild type HCFC1 gene, the HCFC1 gene mutant is mutated from a base C to a base G at a 2318 th base of a 13 th exon of the wild type HCFC1 gene.

The HCFC1 gene (MIM 300019) is a causative gene of cb 1X-type methylmalonic acid blood disease, the gene is located on chromosome Xq28, the whole length of the gene is 25.1kb, the gene comprises 26 exons and 25 introns, the gene codes 2035 amino acid host cell factor C1 protein (host cell factor C, HCFC 1) and belongs to host cell factor families. HCFC1 is a transcriptional regulator, which, unlike other genes associated with cobalamin metabolic disorders, does not encode enzymes or coenzymes associated with cobalamin metabolism, but rather encodes a nuclear coactivator protein comprising 5 Kelch repeat domains, a fibronectin-like motif domain, 6 HCF repeat domains. The Kelch repeat region is a repeating antiparallel β sheet that mediates protein-protein interactions, catalytic activity, and transport. The Kelch region of the HCFC1 protein is considered to be a highly conserved binding motif structure, playing an important role in the protein-protein interaction of HCFC1 protein with its transcriptional regulatory partners. HCFC1 proteins interact with different proteins to regulate many physiological processes including cell cycle, proliferation and transcription. The HCFC1 mutation enables the HCFC1 protein to interact with a transcription regulation object thereof so as to influence the expression of a downstream effector; HCFC1 proteins interact with many transcription factors through the Kelch region, thereby affecting transcriptional activity. Such as affecting MMACHC protein expression, resulting in cobalamin metabolic disorders, leading to clinical and biochemical phenotype characteristics similar to CblC.

Thus, gene mutation is an important genetic basis for the development of type cb1X methylmalonic acid, and gene diagnosis is a gold standard for diagnosing type cb1X methylmalonic acid. The clinical needs to establish corresponding detection technology aiming at different mutations and be used for clear etiology and disease diagnosis, finds out the gene mutation sites related to cb1X type methylmalonic acid blood disease, and helps screening and diagnosing cb1X type methylmalonic acid blood disease gene mutation, and has important significance for drug screening, drug effect evaluation and targeted treatment.

Specifically, the variant HCFC1 gene is G at base 2318 of exon 13 as compared to the wild type HCFC1 gene. The HCFC1 gene mutant is SEQ ID NO.5 (5' -CCATCC)CATGTC-3'), the nucleotide sequence shown (the letters in the box are bases after mutation). The accession number of the wild HCFC1 gene is NM_005334.3, the mutant of the HCFC1 gene leads to missense mutation, and compared with the protein encoded by the wild HCFC1 gene, the 773 rd amino acid is mutated from proline (P) to arginine (R), wherein the sequence of the core amino acid generated by mutation is shown as SEQ ID NO.6 (IKTI/>MSAI) (the letters in the box are mutated amino acids) influence normal HCFC1 functions, cause cb 1X-type methylmalonic acid blood disease, have pathogenicity and are specifically expressed as HCFC1: NM_005334.3: exon13: c.2318C > G: p.P773R.

Wherein, the transcript (mRNA) ID number of the wild type HCFC1 gene is NM_005334.3; the sequence of the transcript (mRNA) of the wild HCFC1 gene is specifically shown as SEQ ID NO.46 in the nucleotide or amino acid sequence table of ST.26 standard sequence;

The mutated nucleic acid sequence (c.2318C > G) is specifically shown as SEQ ID NO.47 in the sequence Listing of ST.26 standard sequence nucleotides or amino acids;

The protein ID number of the protein coded by the wild HCFC1 gene is NP-005325.2; the protein sequence of the protein coded by the wild HCFC1 gene is specifically shown as SEQ ID NO.48 in the sequence table of ST.26 standard sequence nucleotide or amino acid;

The mutated protein sequence (p.P773R) is specifically shown in SEQ ID NO.49 of the sequence Listing of nucleotides or amino acids of ST.26.

In order to avoid false positive results, the invention uses exon sequencing to screen pathogenic gene mutation highly related to cb1X type methylmalonic acid blood disease, and verifies through Sanger sequencing that the HCFC1 gene is related to cb1X type methylmalonic acid blood disease when c.2318C > G exists for the first time, so that the cb1X type methylmalonic acid blood disease can be detected by detecting whether the HCFC1 gene exists or not. The HCFC1 gene mutant provided by the invention can distinguish a cb1X type methylmalonic acid blood disease patient from a normal human group, is a biomarker for diagnosing cb1X type methylmalonic acid blood disease, is beneficial to screening and diagnosing cb1X type methylmalonic acid blood disease gene mutation, and provides a new technical support for drug screening, drug effect evaluation and targeted treatment.

The invention also provides application of the HCFC1 gene mutant as the detection target in preparation of a reagent or a preparation kit, wherein the reagent comprises a reagent for detecting cb1X type methylmalonic acid blood.

The kit comprises one or more of a cb 1X-type methylmalonic acid blood disease prevention kit, a cb 1X-type methylmalonic acid blood disease diagnosis kit, a cb 1X-type methylmalonic acid blood disease auxiliary diagnosis kit, a pre-pregnancy genetic disease screening kit, a pre-pregnancy genetic disease diagnosis kit and a cb 1X-type methylmalonic acid blood disease auxiliary treatment kit.

The invention also provides an amplification primer for detecting cb 1X-type methylmalonic acid blood disease, wherein the amplification primer comprises an upstream primer HCFC1-1F and a downstream primer HCFC1-1R; the upstream primer HCFC1-1F comprises a nucleotide sequence shown as SEQ ID NO.1, and the downstream primer HCFC1-1R comprises a nucleotide sequence shown as SEQ ID NO. 2.

Specifically, the preferred upstream primer HCFC1-1F (SEQ ID NO. 1) and downstream primer HCFC1-1R (SEQ ID NO. 2) of the amplification primer are:

HCFC1-1F：5'-ATGCCCTTGTTTGGTTTCC-3'

HCFC1-1R：5'- GTAGATGCCACCGATGCTG-3'

The amplification primer can specifically amplify wild HCFC1 genes and HCFC1 genes containing c.2318C > G mutation sites. Wherein, the HCFC1 gene containing c.2318C > G mutation site is the HCFC1 gene mutant.

The invention also provides a sequencing primer for detecting cb 1X-type methylmalonic acid blood, wherein the sequencing primer comprises an upstream primer HCFC1-Seq1F and a downstream primer HCFC1-Seq1R; the upstream primer HCFC1-Seq1F comprises a nucleotide sequence shown as SEQ ID NO. 3; the downstream primer HCFC1-Seq1R comprises the nucleotide sequence shown as SEQ ID NO. 4.

Specifically, the preferred upstream primer HCFC1-Seq1F (SEQ ID NO. 3) and downstream primer HCFC1-Seq1R (SEQ ID NO. 4) are respectively:

HCFC1-Seq1F：5'-CCCACAGCCTCCAGAACA-3'

HCFC1-Seq1R：5'-GGAGAAGATAGAAAAGGGTAAA-3'

The invention also provides a primer combination for detecting cb 1X-type methylmalonic acid blood, which comprises the amplification primer and/or the sequencing primer.

Specifically, the primer combination can detect whether a mutation site of c.2318C > G exists on the HCFC1 gene, and distinguish HCFC1 gene mutants from wild type HCFC1 genes. The amplification product of the preferred amplification primer can be sequenced by the preferred sequencing primer to determine whether the c.2318C > G mutation is present in the HCFC1 gene. The primer combination can be used for distinguishing a cb1X type methylmalonic acid blood disease patient from a normal human group, and can be used for rapidly and accurately diagnosing the cb1X type methylmalonic acid blood disease.

The invention also provides application of the primer combination in preparation of a reagent for detecting cb 1X-type methylmalonic acid blood.

Further, the detection target of cb 1X-type methylmalonic acid blood disease comprises HCFC1 gene mutant, wherein the HCFC1 gene mutant is mutated from base C to base G at 2318 th base of 13 th exon of wild type HCFC1 gene compared with wild type HCFC1 gene.

The invention also provides a reagent for detecting cb 1X-type methylmalonic acid blood, which comprises the primer combination.

Further, the reagent further comprises one or more of dNTPs, PCR buffer, magnesium ions and Tap polymerase. Specifically, the PCR buffer preferably comprises KCl 50mmol/L, tris-HCl 10mmol/L and MgCl ₂ 1.5.5 mmol/L, and the pH value of Tris-HCl is preferably 8.3.

The invention also provides an application of the reagent in a kit and preparation thereof, wherein the kit comprises one or more of a cb 1X-type methylmalonic acid blood disease prevention kit, a cb 1X-type methylmalonic acid blood disease diagnosis kit, a cb 1X-type methylmalonic acid blood disease auxiliary diagnosis kit, a pre-pregnancy genetic disease screening kit, a pre-pregnancy genetic disease diagnosis kit and a cb 1X-type methylmalonic acid blood auxiliary treatment kit.

In the diagnosis of cb1X methylmalonic acid blood kit, preferred reagents include c.2318c > G site positive mutation reference DNA; the single-stranded nucleotide sequence of the DNA1 is preferably shown in SEQ ID NO. 7.

Specifically, the kit diagnoses whether an individual suffers from cb 1X-type methylmalonic acid by detecting the genotype of HCFC1 gene mutant in a sample of male individual and/or female individual. Wherein the test sample preferably comprises blood or amniotic fluid.

The criteria for genotyping individuals with cb1 type X methylmalonic acid are specifically:

when the genotype of the male individual c.2318C > G is "c.2318C > G hemizygous mutation", the male individual c.2318C > G is the patient;

When the genotype of female individual c.2318C > G is "c.2318C > G heterozygote mutation", then the female individual c.2318C > G is a carrier;

when the genotype of female individual c.2318C > G is "c.2318C > G homozygotic mutation", the female individual c.2318C > G is the patient;

when the genotype of an individual is "wild type", the individual is a normal person.

Wherein the method for identifying the genotype of HCFC1 gene mutant comprises the following steps:

Taking the DNA of the sample to be detected as a template, and carrying out PCR amplification by using the amplification primer to obtain an amplification product;

sequencing the amplified product by using the sequencing primer to determine the genotype of the HCFC1 gene mutant.

In the present invention, the reaction system for PCR amplification preferably comprises, in 20. Mu.L, 10 XPCR buffer 2. Mu. L, dNTPs 0.4. Mu. L, HCFC1-1F or HCFC1-2F 0.5. Mu. L, HCFC1-1R or HCFC1-2R 0.5. Mu.L, 100 ng/. Mu.L of template 1. Mu. L, taq enzyme 0.2. Mu.L and the balance ddH ₂ O.

In the present invention, when the primer pairs in the reaction system for PCR amplification are HCFC1-1F and HCFC1-1R, the reaction progress of the PCR amplification preferably comprises: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 57℃for 30s, elongation at 72℃for 60s,30 cycles; the reaction was carried out at 72℃for 7min.

The invention can preferably determine the correlation between an individual providing a sample to be tested and cb1X type methylmalonic acidemia according to the genotype of HCFC1 gene c.2318C > G, and specifically comprises the following steps: the sequencing result and the positive reference DNA in the scheme indicate that c.2318C > G mutation occurs if the sequence base of the positive reference DNA is the same, and specific genotype diagnosis standards are as above and are not repeated herein.

In the specific implementation process, 434 individuals in 93 growth and development language development retardation families are screened and detected altogether, wherein 23 cb1X methylmalonic acidemia families comprise 26 patients and 31 carriers; the individuals in 26 cb 1X-type methylmalonic acid blood family are HCFC1 gene c.2318C > G mutations.

For further explanation of the present invention, the primer combinations, reagents and kits for detecting cb 1X-type methylmalonic acid hematoma, HCFC1 gene mutants and applications provided by the present invention are described in detail below with reference to the drawings and examples, but they should not be construed as limiting the scope of the present invention.

The experimental procedure, which does not address the specific conditions in the examples below, is generally followed by routine conditions such as Sambrook et al, molecular cloning: conditions described in the laboratory Manual (New York: cold Spring Harbor LaboratoryPress, 2014), or as recommended by the manufacturer.

Example 1

1. Diagnostic criteria:

reference is made to the 2010 edition of human monogenic genetic diseases and the 2019 edition of the diagnosis and treatment guidelines for rare diseases.

The HCFC1 gene mutation is related to cb 1X-type methylmalonic acidemia, which is X-linked recessive inheritance. CblC the cause of methylmalonic acid urine disease is MMACHC mutation, which causes CblC structural and functional abnormality, and methylcobalamin and adenosylcobalamin are metabolic disorder, which causes methylmalonic acid urine disease to be combined with homocysteinemia. Type CblX methylmalonic acid urea is due to the fact that HCFC1 mutation affects MMACHC transcription and translation. CblX patients have similar phenotype and biochemical characteristics to CblC type, but are more serious than CblC type, and have complex and diverse clinical manifestations. The main clinical manifestations of CblX's methylmalonic acid urine disease are: early onset, severe intellectual motor impairment, refractory epilepsy, with varying degrees of malformation, extrapyramidal symptoms and biochemical abnormalities. Patients with increased urinary methylmalonate, with or without increased homocysteinemia, have HCFC1 mutation as a diagnostic gold standard.

Genetic counseling and prenatal diagnosis: as the X chromosome linked recessive genetic disease, the pathogenic genes are determined through gene detection, so that the risk of the patient for producing inhibitors can be judged, and the treatment is guided; the method can also identify the carrier in the family of the patient and provide basis for prenatal diagnosis. The probability of a female carrier transmitting a pathogenic mutation site to its male offspring is 50% except that some new mutations occur. When pathogenic mutation of a precursor is known, prenatal diagnosis of a male fetus can be performed, and wool membrane, amniotic fluid cell DNA sequencing, umbilical cord blood detection and the like can be performed. Prenatal diagnosis is mainly performed by using technologies such as amniocentesis and chorionic villus sampling, and genetic analysis is performed on amniotic fluid, amniotic fluid cells and chorionic villus to judge whether chromosomes or genes of fetuses and the like are normal. Different sampling methods are adopted in different pregnancy stages, and generally, fluff is taken in early pregnancy (7-9 weeks of pregnancy), amniotic fluid is taken through amniocentesis in the middle pregnancy (16-20 weeks of pregnancy), fetal specimens are taken through a fetal mirror (18-20 weeks of pregnancy), umbilical vein blood is taken directly through the abdominal wall (18 weeks of pregnancy), and the like.

2. Object of detection

The method uses 1 cb 1X-type methylmalonic acidemia family (called 1 family for short) as a test object, clinical information of part members of the 1 family is shown in table 1, and a family map is shown in figure 1.

TABLE 1 clinical information of cb1X family members of methylmalonic acid blood 1

Note that: i, II and III sequentially represent the first generation, the second generation and the third generation, and the family personnel II 1 are 2,3,4, 1,2,3,4 and 5 peripheral blood DNA are used for sequencing.

Example 2

Exon sequencing

1. The instrument is shown in table 2.

Table 2 instrumentation

2. Reagent consumable

Human whole exon sequencing kit (Agilent), DNA 1000 kit (Agilent), 96 well plate (Axygen), different model tips (Axygen), 200 μl centrifuge tube (Eppendorf), 1.5mL centrifuge tube (Eppendorf), capillary electrophoresis buffer (Thermo), sequencing standard (Thermo), absolute ethanol (Thermo), bigDye Terminator V3.1.1 (Thermo), peripheral blood gDNA extraction kit (TIANGEN), agarose (TIANGEN) and EB dye (amerco).

3. Reagent formulation

1) A5 XTBE stock solution of electrophoresis liquid was prepared in accordance with Table 3.

Table 35 XTBE electrophoresis liquid formula

2) The working solution of 5 XTBE was diluted 10 times with ddH ₂ O to the stock solution of 5 XTBE in Table 3.

3) 10 Xerythrocyte lysate was prepared according to Table 4.

TABLE 410 Xerythrocyte lysate formula

4) The 1 x nuclear lysate formulation was formulated according to table 5.

Table 51 XNuclear lysate formula

4. Experimental procedure

After signing the informed consent, collecting 3-5 mL of peripheral blood of the members II:2, II:3, II:4, III:1, III:2, III:3, III:4 and 10-20mL of amniotic fluid of the member III:5 in the family 1 as research samples.

4.1 Sample DNA extraction

1) Filling 3-5 mL of a sample into a 15mL centrifuge tube, adding 2-3 times of 1 Xerythrocyte lysate, uniformly mixing, and standing on ice for 30 minutes until the solution becomes transparent; if the villus tissue is adopted, the step 2) is directly carried out.

2) Centrifuge at 3000rpm for 10min at 4℃and carefully remove the supernatant. 1mL of 1 Xcell nucleus lysate was added to the pellet, mixed well, and 2mL of 1 Xcell nucleus lysate and 150. Mu.L of 20% SDS were added thereto, and shaken well until a viscous transparent state appeared. Add 10. Mu.L of 20mg/mL proteinase K and shake well. Digestion is performed at 37℃for more than 6 hours or overnight.

3) Adding saturated phenol with equal volume, mixing by light shaking, and centrifuging at 3000rpm for 10 minutes at room temperature.

4) The supernatant was carefully transferred to another centrifuge tube, and an equal volume of a phenol/chloroform mixture (phenol/chloroform volume ratio 1:1) was added and mixed well and centrifuged at 3000rpm for 10 minutes at room temperature.

5) The supernatant was carefully removed and if not clear, extracted once more with an equal volume of chloroform.

6) Transferring the supernatant into another centrifuge tube, adding diploid absolute ethanol, shaking, and obtaining white flocculent DNA. The DNA was hooked with a flame sterilized glass crochet, washed twice with 70% ethanol, dried at room temperature for 5 minutes, and then dissolved in 200. Mu.L of 1 XTE and drum-dissolved overnight. OD was measured by uv.

7) The TE-dissolved DNA can be preserved for one year at 4deg.C, and if long-term preservation is required, 2 times volume of absolute ethanol is added for preservation at-70deg.C.

4.2 Exon sequencing

1) Taking 2 mug DNA, mechanically breaking to ensure that the fragment size is about 200bp, cutting glue, and recovering 150-250 bp fragments;

2) DNA fragment is used for terminal repair and A is added to the 3' -terminal;

3) Connecting sequencing joints, purifying the connection products, performing PCR amplification, and purifying the amplified products;

4) Adding the purified amplification product into an Agilent kit probe for hybridization capture, eluting and recovering the hybridization product, performing PCR amplification, recovering the final product, and performing quality control analysis by agarose gel electrophoresis on a small sample;

5) NextSeq500 sequencer sequencing and data analysis.

4.3 Results

Finally, the gene mutation HCFC1 with pathogenic significance is obtained, wherein the gene mutation HCFC1 is NM_005334.3 is exon13, c.2318C > G, p.P773R; wherein the mutation of c.2318C > G to the 2318 th base C of the 13 th exon of HCFC1 gene to G may result in missense mutation.

The genotype of HCFC1: NM-005334.3: exo13: c.2318C > G: p.P773R locus in male individuals of family 1 is "c.2318C > G hemizygous mutation", the genotype of this locus in female carrier individuals of family 1 is "c.2318C > G heterozygous mutation", and the genotype of this locus in normal individuals is "wild type".

Example 3

Sanger sequencing validation

The results of the family 1 exome sequencing were further verified for HCFC1: NM-005334.3: exo13: c.2318C > G: p.P773R sites using Sanger sequencing. The genotype test of HCFC1: NM-005334.3: exon13: c.2318C > G: p.P773R site was performed on 8 persons (forerunner, forerunner's mother, forerunner's aunt (wife of mother's brother), forerunner's mother's brother, forerunner's 3 rd cousin, fetus) and 100 normal persons outside the family in example 1, respectively.

The specific method comprises the following steps:

DNA extraction

Genomic DNA was extracted according to the method of example 2.

2. Candidate primer design, verification and preference

2.1 Candidate primer design references the human genome sequence database hg19/build36.3 (https:// www.ncbi.nlm.nih.gov/genome, or http:// genome. Ucsc. Edu/cgi-bin/HGGATEWAYREDIRECT = manual & source = genome. Ucsc. Edu).

2.2 Designing 20 pairs of candidate primers for mutation site c.2318C > G (see Table 6), and verifying and evaluating the merits of each pair of candidate primers by PCR experiment

TABLE 6 basic conditions and verification of experimental results for c.2318C > G site candidate primers

/>

Note that: after electrophoresis, the normal PCR amplification result has only one specific band, and if the primer dimer band and the non-specific product band are all the results of abnormal reaction of the primer; the target primers avoid such primers as much as possible.

2.3 Candidate primer PCR verification reaction

PCR was performed according to the reaction system in Table 7 and the reaction system was kept on ice; each pair of primers was provided with 8 reaction test tubes (SEQ ID NOS 1 to 8 in Table 7).

TABLE 7 primer detection PCR reaction System

/>

Reaction conditions: the test reaction tube was placed in a PCR instrument and the following reaction procedure was performed:

the first step: pre-denaturation at 95 ℃ for 5min;

and a second step of: 30 cycles (denaturation at 95℃for 30 sec. Fwdarw. Tm annealing for 30 sec. Fwdarw. 72℃for 60 sec); (PCR amplification parameters were set according to the Tm values of the primers in Table 6).

And a third step of: extending at 72 ℃ for 7min;

fourth step: 4℃until sampling.

2.4 Candidate primer PCR results agarose gel electrophoresis detection was performed to evaluate the effectiveness, specificity of the primer reactions:

1) Sealing the two ends of the gel sampler with adhesive tape, placing on a horizontal table, and placing a comb at about 1cm position at one end of the sampler.

2) Weighing 2g of agar powder in a conical flask, adding 100mL of 0.5 XTBE electrophoresis buffer, shaking uniformly, heating on a microwave oven or an electric furnace (adding asbestos gauze), taking out after boiling, shaking uniformly, reheating until the gel is completely melted, taking out and cooling at room temperature.

3) After the gel is cooled to about 50 ℃, pouring the gel into a sealed gel sampler to enable the thickness to be about 5 mm.

4) Gel is solidified and the adhesive tape is removed, and the gel and the sampler are put into an electrophoresis tank together.

5) Adding an electrophoresis buffer solution to enable the liquid level to be 1-2 mm higher than the glue surface, and pulling out the comb upwards; and (3) uniformly mixing the sample and the DNA size standard substance with the sample loading liquid by using a micropipette, and adding the mixture into each sample loading hole, wherein the DNA is sunk into the hole bottom due to the fact that the sucrose in the sample loading liquid has a larger specific gravity.

6) And (5) covering an electrophoresis tank, switching on a power supply, adjusting to a proper voltage, and starting electrophoresis. And judging the approximate position of the sample according to the indication of bromophenol blue in the sample carrying liquid, and determining whether to terminate electrophoresis.

7) Cutting off the power supply, taking out the gel, and putting the gel into an EB water solution with the concentration of 0.5g/mL for dyeing for 10-15 minutes.

8) The gel was observed under a transmissive ultraviolet irradiator at 254nm and the electrophoresis results were recorded either with a camera with a red filter or with a gel scanning system.

2.5 Evaluation of results:

1) If the tube No. 7 only has a bright band and no band, judging that the pair of primers and the reaction system are good in effectiveness and strong in specificity;

2) If no target band appears in the tube 7, judging that the pair of primers and the reaction system are invalid;

3) If the No. 7 tube has a primer dimer band outside the target band and also has a primer dimer band in the partial tubes of 2,3, 4, 5 and 6, judging that the effectiveness of the pair of primers and the reaction system is poor;

4) If the No. 7 tube has a nonspecific band outside the target band and also has a nonspecific band in the No. 5 and 6 partial tubes, judging that the specificity of the pair of primers and the reaction system is poor;

5) If primer dimer and non-specific band outside the target band appear in the tube No. 7, and primer dimer and non-specific band also appear in the tube No.2, 3, 4, 5, 6, the effectiveness and specificity of the pair of primers and the reaction system are judged to be poor.

2.6 Based on the results of the statistics after the validation test of Table 7, SEQ ID NO.1 and SEQ ID NO.2 of Table 6 were selected as amplification primers for the HCFC1: NM-005334.3: exon13: c.2318C > G: p.P773R site.

HCFC1-Seq1F：5’-ATGCCCTTGTTTGGTTTCC-3’（SEQ ID NO.1）

HCFC1-Seq1R：5’-GTAGATGCCACCGATGCTG-3’（SEQ ID NO.2）

3. PCR amplification of mutation sites by primers screened in step 2.6 for family 1 personnel and 100 off-family personnel

PCR was performed according to the reaction system in Table 8 and the reaction system was kept on ice.

TABLE 8 mutation point PCR reaction system

Reaction conditions: the reaction system was put into a PCR instrument, and the following reaction procedure was performed:

The PCR amplification procedure for HCFC1: NM-005334.3: exon13: c.2318C > G: p.P773R site was as follows: the first step: 95 ℃ for 5 minutes; and a second step of: 30 cycles (95 ℃,30 seconds- > 57 ℃,30 seconds- > 72 ℃,60 seconds); and a third step of: 72 ℃,7 minutes; fourth step: 4℃until sampling.

4. Agarose gel electrophoresis detection

Refer to step 2.4 above.

5. Purifying a PCR product by an enzymolysis method: to 5. Mu.L of the PCR product, 0.5. Mu.L of exonuclease I (Exo I), 1. Mu.L of alkaline phosphatase (AIP) was added, and the mixture was digested at 37℃for 15min and inactivated at 85℃for 15min.

6. BigDye reaction

The BigDye reaction system is shown in Table 9.

Table 9 BigDye reaction System

Sequencing PCR cycling conditions:

the first step: pre-denaturation at 96℃for 1min;

and a second step of: 33 cycles (denaturation at 96℃for 30 sec. Fwdarw. Annealing at 55℃for 15 sec. Fwdarw. 60℃for 4 min);

And a third step of: 4℃until sampling.

7. And (3) purifying a BigDye reaction product:

1) mu.L of 125mM EDTA (pH 8.0) was added to each tube, and 1. Mu.L of 3mol/L NaAc (pH 5.2) was added to the bottom of the tube;

2) Adding 70 μL 70% alcohol, shaking and mixing for 4 times, and standing at room temperature for 15min;

3) 3000g, centrifuging at 4 ℃ for 30min; immediately inverting the 96-well plate, and centrifuging 185g for 1min;

4) Standing at room temperature for 5min, volatilizing residual alcohol at room temperature, adding 10 μl Hi-Di formamide to dissolve DNA, denaturing at 96 deg.C for 4min, rapidly placing on ice for 4min, and sequencing on machine.

8. Sequencing

And (3) carrying out DNA sequencing on the purified BigDye reaction product, wherein sequencing primers are designed on the basis of SEQ ID NO.1 and SEQ ID NO.2, and nest primers (the second set of primers are designed within the range of the product sequence obtained by amplifying the first set of primers) are used as sequencing primers, and the primer sequences are shown as follows.

Sequencing primer sequences for HCFC1: NM-005334.3: exon13: c.2318C > G: p.P773R sites were as follows:

HCFC1-Seq1F：5’-CCCACAGCCTCCAGAACA -3’（SEQ ID NO.3）

HCFC1-Seq1R：5’-GGAGAAGATAGAAAAGGGTAAA-3’（SEQ ID NO.4）

9. Analysis of results

The sequencing results for HCFC1: NM-005334.3: exon13: c.2318C > G: p.P773R sites are shown in FIG. 2. From FIG. 2, it can be seen that the genotype of the c.2318C > G locus of 1 male patient in line 1 is a "c.2318C > G" hemizygous mutation; the genotype of this site in 4 female patients in family 1 is a heterozygous mutation of "c.2318c > G"; the c.2318c > G locus genotype of 3 normal individuals in line 1 and 100 normal controls without blood relationship was "wild-type".

Example 4

Cb1X type methylmalonic acid blood disease diagnosis kit and application thereof

1. The kit comprises the following components:

The kit comprises: 1) Amplification primers: SEQ ID NO. 1-2 as in example 3; 2) PCR buffer (10 XPCR buffer, composed of 500mmol/L KCl,100mmol/L Tris-HCl (pH 8.3), 15mmol/L MgCl ₂ and the balance water); 3) Taq enzyme (20U); 4) dNTPs (4 mM each of the four dNTPs); 5) c.2318C > G positive reference DNA, the reference is a double-stranded DNA, the specific sequence of the c.2318C > G mutation site positive reference is shown as SEQ ID NO.7, the specific sequence is shown as SEQ ID NO.7 ：5'-ATGCCCTTGTTTGGTTTCCAGATCACTCCTTGCTCCATCCCTTCCTTTTTAGATTTCCAATCTGGGCAAAGTGATGTCGGTGGTCCAGACCAAACCAGTTCAGACTTCAGCAGTCACAGGCCAGGCGTCCACGGGTCCTGTGACTCAGATCATCCAGGTGAGCTCTCAGTCTTTGCACATACGCAAGAGTGGGGGCCTGGGTGCCAGGCCACAGGAAGAACTCATGTCCCTGCCCATGGAAGATCCCATGAGCACACATGGCTCAGCAAGTTCTGCTGCTCACTCCCCTCGCCCACAGCCTCCAGAACATTCCCTGAGCCGCCAAGGCTGCCGGCGGAGAGTAGCCAGACCACACTTCCCTTCCTGGCAGTGATGCCGGCTCATGCACCTGCTTCCCCCTTTCAGACCAAAGGGCCCCTGCCAGCGGGAACAATCCTGAAGCTGGTGACCTCAGCAGATGGCAAGCCCACCACCATCATCACTACCACGCAGGCCAGTGGGGCGGGGACCAAGCCCACCATCCTGGGCATCAGCAGCGTCTCCCCCAGTACCACCAAGCCCGGCACGACCACCATCATCAAAACCATCC CATGTCGGCCATCATCACCCAGGCGGGCGCCACGGGTAGGGGCCTCCCCCGACATATGAGTGTCTGCAAGTCCTCACTGGAGGGGAAATGGAGTCCGGGTTATAAGGCGTGCTGTGTTTCTGTTTAGTTTACCCTTTTCTATCTTCTCCTTGCTGCCTTTTGTGTCTAAGGGTAGTGAGGAGATGGGCAGGGCTATGGCTGTGACTTGTGGATGTTCATTATAGTCTAGGGGCAGCAGGGGCAGCCCTCACAGAGCCTGTCTCCCCTGGGCCCCACTCTCCCATCCAGGTGTGACCAGCAGTCCTGGCATCAAGTCCCCCATCACCATCATCACCACCAAGGTGATGACTTCAGGAACTGGAGCACCTGCGAAAATCATCACTGCTGTCCCCAAAATTGCCACTGGCCACGGGCAGCAGGGAGTGACCCAGGTGAGGCACTCCCAGCCGTCTCTCAGCCCAGTGTCCTAGTGCAGTCCACCCCAGCACGCCACGCAGGTCCTCCCGACAGGCCTGGGAGGGGCAGCATCGGTGGCATCTAC-3';

Single underlined bases are positions of upstream and downstream primers for PCR amplification, bases in a square frame are point mutation sites, and single underlined bolded italic bases are positions of upstream and downstream sequencing primers; 6) Sequencing primer: the sequence is shown as SEQ ID NO. 3-4.

2. The using method comprises the following steps:

425 individuals in 92 families with growth and development language and development retardation are screened and detected, 25 patients and 27 carriers in 22 families which are consistent with the invention are found again, and the application of the gene mutation detection kit is illustrated by taking the No.2 family as an example. The clinical information of family 2 is shown in table 11, and the family 2 map is shown in fig. 3.

Table 10 Table 1X-list of screening conditions for methylmalonic acid

: The second embryo was identified as a patient by amniotic fluid puncture and genetic diagnosis during birth, and pregnancy was terminated.

TABLE 11 clinical information of cb1X family members of methylmalonic acid blood No. 2

Note that: i and II sequentially represent a first generation and a second generation.

The detection of the kit by using the DNA of the peripheral blood and the amniotic fluid of II:2 of family personnel I:1, I:2 and II:1 comprises the following steps:

1) Genomic DNA extraction: sample genomic DNA was extracted according to the procedure of example 2.

2) Firstly, adopting PCR amplification primers, taq enzyme, buffer solution, dNTPs, sample genome DNA and the like in a kit to carry out PCR amplification reaction;

3) Purifying the PCR amplification product;

4) Performing BigDye reaction on the purified PCR product by using the sequencing primer in the kit;

5) Purifying BiyDye reaction products;

6) BiyDye reaction products were sequenced and the sequenced sequence was compared to the normal sequence.

The detection result of the kit for the family member No. 2 is shown in FIG. 4, wherein the arrow indicates the mutation occurrence position. As can be seen from fig. 4, the genotype of the c.2318c > G locus of the ancestor in line No. 2 is the "c.2318c > G" hemizygous mutation (layer B), and the mother of the ancestor is the heterozygous mutation (layer C); the detection result confirms that the first-evidence patient is a cb1X type methylmalonic acidemia patient, and the mother genotype of the first-evidence patient is heterozygous and is a carrier; the male parent genotype (layer A) and the fetus (layer D) of the first person are wild type and normal individuals. The probability of male child born after parents of the prior art is 25% of cb1X methylmalonic acidemia patient, the probability of female child born is 25% of carrier, the probability of normal individual born is 50%, and if the male child born is required to continue to bear, the male child must go to the hospital for embryo implantation genetic diagnosis or prenatal diagnosis.

Example 5

Gene mutation ranking and interpretation (pathogenicity of mutation)

Mutation interpretation is based on our current understanding of cb 1X-type methylmalonic acidemia and pathogenic gene HCFC1 (https:// www.omim.org/entry/604579), and the clinical phenotypic association of the test subjects. Mutations follow the HGVS guidelines for mutation nomenclature (http:// www.hgvs.org /) and are named according to GenBank accession numbers (https:// www.ncbi.nlm.nih.gov/GenBank /). The rules for interpretation of genetic variation data refer to guidelines ：Richards,S,et al.,Standards and guidelines for the interpretation of sequence variants:a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med, advance online publication 5 March 2015. doi:10.1038/gim.2015.30; associated with the american society for genetics and Genomics (ACMG), chinese classification standards and guidelines for genetic variation: wang Qiuju, shen Yiping, ling KV, et al, classification standards and guidelines for genetic variation: life sciences, 2017, 47:668-688.

The genetic variation classification in the "genetic variation classification criteria and guidelines" is to perform five-level classification on variations based on typical data types (such as crowd data, calculation data, functional data, co-segregation data), which are respectively: "pathogenic (P)", "potentially pathogenic (likely pathogenic, LP)", "ambiguous (variant of uncertain significance, VUS)", "potentially benign (likely benign, LB)", and "benign (benign, B)"; the five-level classification was determined based on the composite score after interpretation analysis of each side/sub-item of variation (table 12).

TABLE 12 determination criteria for pathogenicity of variation

Before a five-level assessment, the sides/sub-items of the mutation/variation need to be analyzed/interpreted. Among these, the pathogenic mutation criteria can be classified as: for a given mutation/mutation, first, the criteria in Table 13 need to be selected based on observed evidence, it is determined which side/sub-items of the mutation/mutation can meet in Table 13, each is evaluated as being PVS1/PS 1-4/PM 1-6/PM 1-5/BA 1/BS 1-4/BP 1-6, and finally, the sub-items of the mutation/mutation can be combined according to the scoring rules of Table 12, and then a classification is selected from the five-level system according to the combined criteria of Table 12, e.g., if the side/sub-items of the mutation/mutation meet in Table 13 after analysis of the side/sub-items of the mutation/mutation by the criteria [ i.e., P1 ] "(i.e., the comprehensive criteria of the" comprehensive "P1, P1" is satisfied by the comprehensive criteria of "in Table 12)".

TABLE 13 variant interpretation criteria and variant pathogenicity criterion

/>

Analysis/interpretation of the sides/sub-items of mutations/variations is based on the corresponding bioinformatic analysis tools (see table 15) and a number of available data (libraries) (see table 16), including data obtained from existing cases, as well as data obtained from existing publications, such as public databases (e.g., clinVar or site-specific databases) and laboratory owned databases. The degree judgment evaluation criteria used in the analysis of mutation/mutation using various data (libraries) are shown in table 14.

Table 14 degree judgment evaluation criteria

/>

Table 15 biological information analysis tool

/>

Table 16 crowd database, disease-specific database and sequence database

/>

According to the above criteria or guidelines, the HCFC1 gene c.2318C > G mutation of the present invention was assessed as "pathogenic", and the criteria and specific evidence are shown in Table 17 below:

TABLE 17 pathogenic interpretation of HCFC1 gene c.2318C > G mutation

XLR: refers to X chromosome stealth inheritance.

The evidence of variation ratings for HCFC1: NM-005334.3: exon13: c.2318C > G: p.P773R is as follows:

1. PS 2: detected by family personnel such as parents of foreigners, the variation is new variation verified by 5 family analysis (see table 10);

2. PS4: combining literature and this case, this variation was detected in multiple patients (26) (see table 10);

3. PM1: the mutation is located in the hot spot mutation region, in the critical functional domain of the HCFC1 protein (the region that interacts with the ZBTB17 protein);

4. PM2: the HCFC1 gene c.2318c > G variation was not found in the reference human thousand genome (1000G), human exon database (ExAC) and human genome mutation frequency database (gnomAD);

5. PP3: various computer software predicts that this variation will have deleterious effects on the gene or gene product;

thus, the comprehensive evidence of this mutation/variation (ps2+ps4+pm1+pm2+pp3) meets the "pathogenicity (P)" criterion (ii) in table 12, where the HCFC1 gene c.2318c > G variation is comprehensively judged to be "pathogenicity".

Example 6

Follow-up and diagnostic kit detection performance analysis

All family members were followed and all individuals were verified by resequencing analysis using the HCFC1 gene targeted capture chip method (see Table 18).

TABLE 18c 2318C > G site detection Performance analysis results

Note that: the table contains follow-up data for family 1; the detected variation was positive in both the patient and the carrier.

As can be seen from a combination of table 1 and table 10, positive patients (26 cases) and carriers (31 cases) were found when 23 families were examined. The positive site detection results are verified by a HCFC1 gene targeting capture chip method. Based on the follow-up and verification results, 57 true positive cases, 37 true negative cases, 0 false negative and 0 false positive cases were found at this time. The sensitivity of detection of the 2318C > G mutation site marker is 100.00%, 95% CI is 99.03% -100%, the specificity is 100%, and 95% CI is 99.03% -100%. The results show that the kit has good detection performance in clinical application.

According to the above examples, the HCFC1 mutant protein and the HCFC1 gene mutant can be used as biomarkers for diagnosing cb 1X-type methylmalonic acid blood disease, and provide possible drug targets for treating cb 1X-type methylmalonic acid blood disease.

In the above technical solution of the present invention, the above is only a preferred embodiment of the present invention, and therefore, the patent scope of the present invention is not limited thereto, and all the equivalent structural changes made by the description of the present invention and the content of the accompanying drawings or the direct/indirect application in other related technical fields are included in the patent protection scope of the present invention.

Claims

1. A mutant HCFC1 gene, wherein said mutant HCFC1 gene is mutated from base C to base G at base 2318 of exon 13 of said wild-type HCFC1 gene as compared to the wild-type HCFC1 gene.

2. An HCFC1 mutant protein, wherein the HCFC1 mutant protein has a mutation from proline to arginine at amino acid 773, as compared to the protein encoded by the wild-type HCFC1 gene.

3. Use of the HCFC1 gene mutant according to claim 1 as a detection target in the preparation of cb1X type methylmalonic acidemia detection reagent and/or detection kit.

4. The use according to claim 3, wherein said detection reagent and/or said detection kit comprises amplification primers for HCFC1 gene mutants, said amplification primers comprising an upstream primer HCFC1-1F and a downstream primer HCFC1-1R; the upstream primer HCFC1-1F comprises a nucleotide sequence shown as SEQ ID NO.1, and the downstream primer HCFC1-1R comprises a nucleotide sequence shown as SEQ ID NO. 2.

5. Use according to claim 3, characterized in that the detection reagent and/or the detection kit comprises sequencing primers of HCFC1 gene mutants, comprising an upstream primer HCFC1-Seq1F and a downstream primer HCFC1-Seq1R; the upstream primer HCFC1-Seq1F comprises a nucleotide sequence shown as SEQ ID NO. 3; the downstream primer HCFC1-Seq1R comprises a nucleotide sequence shown as SEQ ID NO. 4.

6. Use of the HCFC1 mutant protein of claim 2 as a detection target in the preparation of cb1X type methylmalonic acidemia detection reagent and/or detection kit.