CN117487923B

CN117487923B - Application of HABP2 gene mutant as detection target, detection reagent and/or detection kit with HABP2 gene mutant

Info

Publication number: CN117487923B
Application number: CN202311823134.9A
Authority: CN
Inventors: 曾桥; 刘亚宁; 徐霞
Original assignee: Hunan Jiahui Biotechnology Co Ltd
Current assignee: Hunan Jiahui Biotechnology Co Ltd
Priority date: 2023-12-27
Filing date: 2023-12-27
Publication date: 2024-05-31
Anticipated expiration: 2043-12-27
Also published as: CN117487923A

Abstract

The invention provides application of an HABP2 gene mutant as a detection target, a detection reagent and/or a detection kit with the same. The HABP2 gene mutant is mutated from base G to base a at the 803 th base of the 8 th exon of the wild-type HABP2 gene as compared to the wild-type HABP2 gene. The HABP2 gene mutant enriches pathogenic mutation spectrums of familial non-medullary thyroid cancer type 5, can screen or diagnose pathogenic gene mutation carriers or patients of familial non-medullary thyroid cancer type 5 by detecting whether a subject carries the mutations, so as to provide instruction of prepotency and therapeutic intervention, provide brand-new theoretical basis for treating familial non-medullary thyroid cancer type 5 patients, and provide possible drug targets for treating familial non-medullary thyroid cancer type 5.

Description

Application of HABP2 gene mutant as detection target, detection reagent and/or detection kit with HABP2 gene mutant

Technical Field

The invention relates to the field of detection reagents, in particular to application of an HABP2 gene mutant as a detection target, a detection reagent with the HABP2 gene mutant and/or a detection kit.

Background

Familial non-medullary thyroid cancer type 5 (MIM 616535) is an autosomal dominant inherited disease. Thyroid cancer is the most common malignancy of the endocrine system, with papillary thyroid cancer being its most common pathological type, with non-medullary thyroid cancer accounting for over 95% of thyroid cancers, with 5% -10% of patients having a family history. The pathogenesis of the disease is related to genetic mutation, and the related genes and the site mutation thereof, such as SRGAP1 gene, TITG-1/NKX2.1 gene, FOX1 gene, HABP2 gene and the like. The disease-free survival of familial patients is significantly shorter than sporadic patients; familial non-medullary thyroid cancer affects patient survival as follows: early onset of disease, higher recurrence rate, lower survival rate compared to sporadic cases, etc. Bilateral lesions, multifocal, high central lymph node metastasis are clinical features of familial non-medullary thyroid carcinoma, and the disease diagnosis of patients at generation 1 is older than generation 1. Familial non-medullary thyroid cancer is more aggressive and more prone to poor prognosis than common patients with sporadic thyroid cancer.

Disclosure of Invention

The invention mainly aims to provide application of an HABP2 gene mutant as a detection target, a detection reagent and/or a detection kit with the HABP2 gene mutant, so as to solve the technical problems of screening and detecting familial non-medullary thyroid cancer type 5.

In order to achieve the above purpose, the present invention provides an application of an HABP2 gene mutant as a detection target in preparing a detection reagent and/or a detection kit for familial non-medullary thyroid cancer type 5, wherein the HABP2 gene mutant is mutated from a base G to a base a at 803 th base of an 8 th exon of the wild type HABP2 gene compared with the wild type HABP2 gene.

Further, the detection reagent and/or the detection kit includes amplification primers for a mutant of the HABP2 gene, the amplification primers including an upstream primer HABP2-1F and a downstream primer HABP2-1R; the upstream primer HABP2-1F comprises a nucleotide sequence shown as SEQ ID NO.1, and the downstream primer HABP2-1R comprises a nucleotide sequence shown as SEQ ID NO. 2.

Further, the detection reagent and/or the detection kit includes sequencing primers for the HABP2 gene mutant, the sequencing primers including an upstream primer HABP2-Seq1F and a downstream primer HABP2-Seq1R; the upstream primer HABP2-Seq1F comprises a nucleotide sequence shown as SEQ ID NO. 3; the downstream primer HABP2-Seq1R comprises a nucleotide sequence shown as SEQ ID NO. 4.

The invention also provides a detection reagent and/or a detection kit for familial non-medullary thyroid cancer type 5, wherein the detection reagent and/or the detection kit comprises the HABP2 gene mutant.

The invention has the beneficial effects that:

the invention discovers that mutation of 803 th base of 8 th exon of wild HABP2 gene from base G to base A can lead to familial non-medullary thyroid cancer type 5 for the first time, and the mutation result is negative when no disease member detects the mutation result in family.

The HABP2 gene mutant enriches pathogenic mutation spectrums of familial non-medullary thyroid cancer type 5, can screen or diagnose pathogenic gene mutation carriers or patients of familial non-medullary thyroid cancer type 5 by detecting whether a subject carries the mutations, so as to provide instruction of prepotency and therapeutic intervention, provide brand-new theoretical basis for treating familial non-medullary thyroid cancer type 5 patients, and provide possible drug targets for treating familial non-medullary thyroid cancer type 5.

The invention can amplify wild type HABP2 gene and familial non-medullary thyroid cancer type 5 patient HABP2 gene by amplifying the primer, and then uses the sequencing primer to sequence, so as to distinguish the wild type HABP2 gene and familial non-medullary thyroid cancer type 5 patient HABP2 gene and diagnose familial non-medullary thyroid cancer type 5.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are required in the embodiments or the description of the prior art will be briefly described, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and other drawings may be obtained according to the structures shown in these drawings without inventive effort for a person skilled in the art.

FIG. 1 is a family genetic map of familial non-medullary thyroid cancer type 5, family number 1; wherein ∈Σ represents a normal male individual, ∈o represents a normal female individual, ∈ ■ represents a male patient, +.represents a female patient, +. ↗ represents a first-pass person;

FIG. 2 shows detection of the family 1 HABP2: NM-004132.5: exon8: c.803G > A: p.W268 using Sanger sequencing Results for locus genotype, wherein B, C and D layers: heterozygote mutation in family 1; a and E layers: genotype in line 1 is wild type (position of mutation indicated by arrow in sequencing diagram);

FIG. 3 is a family genetic map of familial non-medullary thyroid cancer type 5, family number 2; wherein ∈Σ represents a normal male individual, ∈o represents a normal female individual, ∈ ■ represents a male patient, +.represents a female patient, +. ↗ represents a first-pass person;

FIG. 4 is a schematic illustration of the detection of line 2 ancestor HABP2: NM-004132.5: exon8: c.803G > A: p.W268 using a kit A result map of locus genotype; wherein A, C and E layers: heterozygote mutation in family 2; b and D layers: genotype in line No. 2 is wild type (position of mutation indicated by arrow in sequencing).

The achievement of the object, functional features and advantages of the present invention will be further described with reference to the drawings in connection with the embodiments.

Detailed Description

The following description of the embodiments of the present invention will be made clearly and fully with reference to the accompanying drawings, in which it is evident that the embodiments described are only some, but not all embodiments of the invention. All other embodiments, which can be made by those skilled in the art based on the embodiments of the present invention without making any inventive effort, are intended to fall within the scope of the present invention.

Moreover, the technical solutions of the embodiments of the present invention may be combined with each other, but it is necessary to be based on the fact that those skilled in the art can implement the embodiments, and when the technical solutions are contradictory or cannot be implemented, it should be considered that the combination of the technical solutions does not exist, and is not within the scope of protection claimed by the present invention.

In the present invention, the term "autosomal dominant inheritance" means that whenever a pathogenic gene is present on one of parents' autosomes and transmitted to children, whether or not another gene of children is normal, it may cause a disease regardless of sex. The patients with family history of genetic diseases need to be checked before pregnancy to avoid the influence of the genetic diseases on the next generation.

The term "mutation" as used herein refers to an alteration of a wild-type polynucleotide sequence, meaning the addition, deletion and/or substitution of one or more (e.g., several) bases in a gene sequence or DNA sequence, into a variant, which may be naturally occurring or non-naturally occurring. The term "mutation" when used to describe a gene-encoded product or protein, refers to the addition, deletion and/or substitution of one or several (e.g., several) amino acid residues in the protein or encoded product.

The term "heterozygous mutation" herein means that the mutation is present in only one gene of a pair of alleles; the term "homozygotic mutation" is a mutation present in two genes of a pair of alleles, i.e., a double allelic mutation, each chromosome being mutated.

The term "homozygous mutation" as used herein refers to the occurrence of identical mutations in all alleles, i.e., double allelic mutations, each chromosome being mutated.

The term "nonsense mutation" herein means that a codon representing a certain amino acid is mutated to a stop codon due to a change of a certain base, thereby terminating the synthesis of a peptide chain in advance. Namely: the triplet code encoding an amino acid is base substituted and then becomes the termination code UAA, UAG or UGA which does not encode any amino acid. Although nonsense mutations do not cause errors in amino acid coding, the termination of the polypeptide chain upon translation is terminated by the presence of a termination code in the middle of an mRNA, resulting in an incomplete polypeptide chain.

The term "diagnosis" herein includes prediction of disease risk, diagnosis of the onset or absence of a disease, and also the assessment of disease prognosis.

The term "prenatal diagnosis" herein refers to definitive diagnosis of a high-risk fetus based on genetic counseling, mainly through genetic detection and imaging examination, and achieves the purpose of fetal selection through selective abortion of a diseased fetus, thereby reducing birth defect rate and improving prenatal quality and population quality.

In the present invention, a "primer" refers to a polynucleotide fragment, typically an oligonucleotide, containing at least 5 bases, such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more bases, for amplifying a target nucleic acid in a PCR reaction. The primer need not be completely complementary to the target gene to be amplified or its complementary strand, as long as it can specifically amplify the target gene. As used herein,

The term "specifically amplify" refers to a primer that is capable of amplifying a gene of interest by a PCR reaction, but not other genes. For example, specifically amplifying the HABP2 gene means that the primer amplifies only the HABP2 gene and not the other genes in the PCR reaction.

In order to solve the technical problems of screening and detecting familial non-medullary thyroid cancer type 5, the invention provides an HABP2 gene mutant, wherein the HABP2 gene mutant is mutated from a base G to a base A at 803 th base of an 8 th exon of a wild type HABP2 gene compared with a wild type HABP2 gene.

It should be noted that, the familial non-medullary thyroid cancer type 5 pathogenic gene HABP2 (MIM 603924) is located on chromosome 10q25.3, the total length of the gene is 38.8kb, and the gene comprises 13 exons and 12 introns, and encodes 560 amino acid-containing hyaluronic acid binding protein 2 (HABP 2), HABP2 is a tumor suppressor gene, mutation may cause loss of tumor suppression function, resulting in autosomal dominant inherited non-medullary thyroid cancer type 5, and HABP2 is highly expressed in tumor tissues and adjacent tissues; in addition, mutations in the HABP2 gene can also lead to venous thromboembolic susceptibility.

Thus, gene mutation is an important genetic basis for the development and progression of familial non-medullary thyroid cancer type 5, and gene diagnosis is a gold standard for determining familial non-medullary thyroid cancer type 5. The method has the advantages that corresponding detection technologies are established for different mutations in clinic, the detection methods are developed and used for defining causes and disease diagnosis, mutation sites are determined, and screening and diagnosis of the assisted familial non-medullary thyroid cancer type 5 gene mutation are realized, so that the method has important significance for drug screening, drug effect evaluation and targeted treatment.

Specifically, the 803 th base G of exon 8 of the HABP2 gene having accession No. NM-004132.5 was mutated to A, resulting in a nucleotide sequence comprising SEQ ID NO.5 (5' -TGAAATGGAATA-3'), the nucleotide fragment shown (the letter in the box is where the mutation occurred); the c.803G > A results in mutation of the 268 th amino acid from tryptophan (W) to a stop codon (/ >) compared with the protein encoded by the wild type HABP2 gene) I.e., nonsense mutation, is noted as HABP2: NM-004132.5: exon8: c.803G > A: p.W268/>Wherein the sequence of the mutated core amino acid is shown in SEQ ID NO.6 (TNDKVK/>) (In-frame/>)Is a stop codon after mutation), causes truncated protein, influences normal HABP2 function, causes familial non-medullary thyroid cancer type 5 and has pathogenicity.

Wherein, the transcript (mRNA) ID number of the wild-type HABP2 gene is NM-004132.5; the sequence of the transcript (mRNA) of the wild HABP2 gene is specifically shown as SEQ ID NO.46 in the sequence table of ST.26 standard sequence nucleotide or amino acid;

The mutated nucleic acid sequence (c.803G > A) is specifically shown as SEQ ID NO.47 in the sequence Listing of ST.26 standard sequence nucleotides or amino acids;

The protein ID number of the protein coded by the wild type HABP2 gene is NP-004123.1; the protein sequence of the protein coded by the wild HABP2 gene is specifically shown as SEQ ID NO.48 in the sequence table of ST.26 standard sequence nucleotide or amino acid;

Mutated protein sequence (p.W268) ) Specifically, the nucleotide sequence is shown as SEQ ID NO.49 in the sequence Listing of ST.26 standard sequence nucleotide or amino acid.

The invention utilizes exon sequencing to screen pathogenic gene mutation highly related to familial non-medullary thyroid cancer type 5, and in order to avoid false positive results, verification is carried out through Sanger sequencing, when the HABP2 gene is found to exist c.803G > A for the first time, the mutation is related to familial non-medullary thyroid cancer type 5, so that the familial non-medullary thyroid cancer type 5 can be detected by detecting whether the HABP2 gene exists c.803G > A.

The invention also provides application of the HABP2 gene mutant as described above as a detection target in preparation of a reagent or a preparation kit, wherein the reagent comprises a reagent for detecting familial non-medullary thyroid cancer type 5.

The kit comprises one or more of a kit for preventing familial non-medullary thyroid cancer type 5, a kit for diagnosing familial non-medullary thyroid cancer type 5, a kit for screening prenatal genetic diseases, a kit for diagnosing prenatal genetic diseases, and a kit for assisting in treating familial non-medullary thyroid cancer type 5.

The invention also provides an amplification primer for detecting familial non-medullary thyroid cancer type 5, wherein the amplification primer comprises an upstream primer HABP2-1F and a downstream primer HABP2-1R; the upstream primer HABP2-1F comprises a nucleotide sequence shown as SEQ ID NO.1, and the downstream primer HABP2-1R comprises a nucleotide sequence shown as SEQ ID NO. 2.

Specifically, the preferred upstream primer HABP2-1F (SEQ ID NO. 1) and downstream primer HABP2-1R (SEQ ID NO. 2) are respectively:

HABP2-1F：5’- ATGAGACTTGGGACCGC -3’

HABP2-1R：5’- GAAGACTGTGAGGCTGGAA -3’

The amplification primer can detect whether a c.803G > A mutation site exists on the HABP2 gene, specifically, the amplification primer 1 specifically amplifies an HABP2 gene mutant fragment or a wild type HABP2 gene fragment containing the c.803G > A mutation site, and the HABP2 gene mutant and the wild type HABP2 gene can be distinguished after sequencing by a sequencing primer; the HABP2 gene mutant and the wild HABP2 gene can be distinguished after sequencing by sequencing primers.

The invention also provides a sequencing primer for detecting familial non-medullary thyroid cancer type 5, wherein the sequencing primer comprises an upstream primer HABP2-Seq1F and a downstream primer HABP2-Seq1R; the upstream primer HABP2-Seq1F comprises a nucleotide sequence shown as SEQ ID NO. 3; the downstream primer HABP2-Seq1R comprises the nucleotide sequence shown as SEQ ID NO. 4.

Specifically, the preferred upstream primer HABP2-Seq1F (SEQ ID NO. 3) and downstream primer HABP2-Seq1R (SEQ ID NO. 4) are respectively:

HABP2-Seq1F：5’-GTCTAGCACCTTCTTATCCAA-3’

HABP2-Seq1R：5’-AGTTGGACTACCTGACCTAAA-3’

The invention also provides a primer combination for detecting familial non-medullary thyroid cancer type 5, comprising an amplification primer as above and/or a sequencing primer as above.

Specifically, the sequencing primer is used for sequencing the amplification products of the amplification primer, so that the HABP2 gene mutant and the wild HABP2 gene can be distinguished; the invention uses the sequencing primer to sequence the fragment amplified by the amplification primer, and can rapidly and accurately diagnose familial non-medullary thyroid cancer type 5.

The invention also provides application of the primer combination in preparation of a reagent for detecting familial non-medullary thyroid cancer type 5.

Further, the detection targets of familial non-medullary thyroid cancer type 5 include HABP2 gene mutants, wherein the HABP2 gene mutants are mutated from base G to base a at 803 th base of exon 8 of the wild type HABP2 gene as compared with the wild type HABP2 gene. The HABP2 gene mutant enriches pathogenic mutation spectrums of familial non-medullary thyroid cancer type 5, can screen or diagnose pathogenic gene mutation carriers or patients of familial non-medullary thyroid cancer type 5 by detecting whether a subject carries the mutations, so as to provide instruction of prepotency and therapeutic intervention, provide brand-new theoretical basis for treating familial non-medullary thyroid cancer type 5 patients, and provide possible drug targets for treating familial non-medullary thyroid cancer type 5.

The invention also provides a reagent for detecting familial non-medullary thyroid cancer type 5, wherein the reagent comprises the primer combination.

Further, the reagent further comprises one or more of dNTPs, PCR buffer, magnesium ions and Tap polymerase.

The invention also provides an application of the reagent in a kit and preparation thereof, wherein the kit comprises one or more of a kit for preventing familial non-medullary thyroid cancer type 5, a kit for diagnosing familial non-medullary thyroid cancer type 5, a kit for screening genetic diseases before pregnancy, a kit for diagnosing genetic diseases before pregnancy and a kit for assisting in treating familial non-medullary thyroid cancer type 5.

Specifically, the kit diagnoses whether an individual has familial non-medullary thyroid cancer type 5 through genotype of the HABP2 gene mutant in a test sample of a male individual and/or a female individual; the test sample preferably comprises blood and amniotic fluid. The criteria for genotyping individuals with familial non-medullary thyroid cancer type 5 are specifically:

when the genotype of the c.803G > A locus of the individual is "c.803G > A heterozygote mutation", the individual is the patient;

When the genotype of the c.803G > A locus of the individual is "c.803G > A homozygous mutation", the individual is a patient;

When the genotype of the c.803G > A locus of the individual is "wild type", the individual is a normal person.

For further explanation of the present invention, the primer combinations, reagents and kits for detecting familial non-medullary thyroid cancer type 5, HABP2 gene mutants and applications provided in the present invention are described in detail below with reference to the accompanying drawings and examples, but they should not be construed as limiting the scope of the invention.

The experimental procedure, which does not address the specific conditions in the examples below, is generally followed by routine conditions such as Sambrook et al, molecular cloning: conditions described in the laboratory Manual (New York: cold Spring Harbor LaboratoryPress, 2014), or as recommended by the manufacturer.

Example 1

1. Diagnostic criteria:

reference can be made to "human monogenic genetic disease" 2010 edition, china's familial hereditary tumor clinical diagnosis and treatment expert consensus (2021 edition) (5) -familial hereditary thyroid cancer.

Thyroid cancer is classified into medullary thyroid cancer and non-medullary thyroid cancer according to the cell source. The non-medullary carcinoma of thyroid follicular epithelial cell origin accounts for about 90% of all thyroid carcinomas, with about 5% -15% of non-medullary carcinoma cases being familial non-medullary carcinomas. A recognized familial non-medullary thyroid cancer is defined as having two or more primary relatives with a thyroid non-medullary cancer. Familial non-medullary thyroid cancer is inherited autosomally dominant. Diagnosing a large number of patients with low age, a high proportion of bilateral cancers and thyroid cancer extraglandular invasion, and a poor prognosis; compared with sporadic cases, familial non-medullary thyroid cancer is more aggressive, has older onset, higher lymph node metastasis rate, and multifocal and recurrent.

2. Object of detection

The detection is carried out by taking 1 familial non-medullary thyroid cancer type 5 family (called family 1 for short) as a test object, wherein the clinical information of part members of the family 1 is shown in table 1, and the family map is shown in figure 1.

TABLE 1 clinical information of family members of family 5, non-medullary thyroid cancer, family 1

Note that: i and II represent the first generation and the second generation in sequence, and the peripheral blood DNA of family 1 personnel I: 1, I: 2, II: 1, II: 2, II: 3 are used for sequencing.

Example 2

Exon sequencing

1. The instrument is shown in table 2.

Table 2 instrumentation

2. Reagent consumable

Human whole exon sequencing kit (Agilent), DNA 1000 kit (Agilent), 96 well plate (Axygen), different model tips (Axygen), 200 μl centrifuge tube (Eppendorf), 1.5mL centrifuge tube (Eppendorf), capillary electrophoresis buffer (Thermo), sequencing standard (Thermo), absolute ethanol (Thermo), bigDye Terminator V3.1.1 (Thermo), peripheral blood gDNA extraction kit (TIANGEN), agarose (TIANGEN) and EB dye (amerco).

3. Reagent formulation

1) A5 XTBE stock solution of electrophoresis liquid was prepared in accordance with Table 3.

Table 35 XTBE electrophoresis liquid formula

2) The working solution of 5 XTBE was diluted 10 times with ddH ₂ O to the stock solution of 5 XTBE in Table 3.

3) 10 Xerythrocyte lysate was prepared according to Table 4.

TABLE 410 Xerythrocyte lysate formula

4) The 1 x nuclear lysate formulation was formulated according to table 5.

Table 51 XNuclear lysate formula

4. Experimental procedure

After signing the informed consent, collecting 3-5 mL of peripheral blood of members I1, I2, II 1, II 2 and II 3 in the family 1 as a study sample.

4.1 Sample DNA extraction

1) 3-5 ML of sample is put into a 15mL centrifuge tube, 1 Xerythrocyte lysate with the volume of 2-3 times is added, the mixture is uniformly mixed, and the mixture is kept stand on ice for 30 minutes until the solution becomes transparent; if the fluid is amniotic fluid, the step 2) is directly carried out.

2) Centrifuge at 3000rpm for 10 min at 4℃and carefully remove the supernatant. 1mL of 1 Xcell nucleus lysate was added to the pellet, mixed well, and 2mL of 1 Xcell nucleus lysate and 150. Mu.L of 20% SDS were added thereto, and shaken well until a viscous transparent state appeared. Add 10. Mu.L of 20mg/mL proteinase K and shake well. Digestion is performed at 37℃for more than 6 hours or overnight.

3) Adding saturated phenol with equal volume, mixing by light shaking, and centrifuging at 3000rpm for 10 minutes at room temperature.

4) The supernatant was carefully transferred to another centrifuge tube, and an equal volume of a phenol/chloroform mixture (phenol/chloroform volume ratio 1:1) was added and mixed well and centrifuged at 3000rpm for 10 minutes at room temperature.

5) The supernatant was carefully removed and if not clear, extracted once more with an equal volume of chloroform.

6) Transferring the supernatant into another centrifuge tube, adding diploid absolute ethanol, shaking, and obtaining white flocculent DNA. The DNA was hooked with a flame sterilized glass crochet, washed twice with 70% ethanol, dried at room temperature for 5 minutes, and then dissolved in 200. Mu.L of 1 XTE and drum-dissolved overnight. OD was measured by uv.

7) The TE-dissolved DNA can be preserved for one year at 4deg.C, and if long-term preservation is required, 2 times volume of absolute ethanol is added for preservation at-70deg.C.

4.2 Exon sequencing

1) Taking 2 mug DNA, mechanically breaking to ensure that the fragment size is about 200bp, cutting glue, and recovering 150-250 bp fragments;

2) DNA fragment is used for terminal repair and A is added to the 3' -terminal;

3) Connecting sequencing joints, purifying the connection products, performing PCR amplification, and purifying the amplified products;

4) Adding the purified amplification product into an Agilent kit probe for hybridization capture, eluting and recovering the hybridization product, performing PCR amplification, recovering the final product, and performing quality control analysis by agarose gel electrophoresis on a small sample;

5) NextSeq500 sequencer sequencing and data analysis.

4.3 Results

Finally, the pathogenic gene mutation HABP 2:NM_004132.5:exo8:c.803G > A:p.W268 is obtained; The mutation is that the 803 th base G of the 8 th exon is mutated into A, resulting in the mutation of 268 th amino acid from tryptophan (W) into a stop codon (/ >) I.e., nonsense mutations.

HABP 2:nm_004132.5:exo8:c.803 g > a:p.w268 in patient # 1 family individualsThe genotype of the locus is "c.803g > a heterozygous mutation", which is "wild-type" in normal individuals of family 1.

Example 3

Sanger sequencing validation

Further using Sanger sequencing for the family exome sequencing results, for HABP2: NM-004132.5: exo8: c.803G > A: p.W268The site was verified. For 5 persons (first person, first father, first mother, first person mother) forerunner brother, forerunner husband) and 100 normal people outside the family: NM-004132.5:exon 8:c.803G > A:p.W268/>And (5) detecting the locus genotype.

The specific method comprises the following steps:

DNA extraction

Genomic DNA was extracted according to the method of example 2.

2. Candidate primer design, verification and preference

2.1 Candidate primer design references the human genome sequence database hg19/build36.3 (https:// www.ncbi.nlm.nih.gov/genome, or http:// genome. Ucsc. Edu/cgi-bin/HGGATEWAYREDIRECT = manual & source = genome. Ucsc. Edu).

2.2 20 Pairs of candidate primers were designed for mutation site c.803G > A (see Table 6), and the merits of each pair of candidate primers were verified and evaluated by PCR experiments.

TABLE 6 basic conditions and verification experiment results for c.803G > A site candidate primers

/>

Note that: after electrophoresis, the normal PCR amplification result has only one specific band, and if the primer dimer band and the non-specific product band are all the results of abnormal reaction of the primer; the target primers avoid such primers as much as possible.

2.3 Candidate primer PCR verification reaction

PCR was performed according to the reaction system in Table 7 and the reaction system was kept on ice; each pair of primers was provided with 8 reaction test tubes (SEQ ID NOS 1 to 8 in Table 7).

TABLE 7 primer detection PCR reaction System

Reaction conditions: the test reaction tube was placed in a PCR instrument and the following reaction procedure was performed:

The first step: pre-denaturation at 95 ℃ for 5min;

And a second step of: 30 cycles (denaturation at 95℃for 30 sec. Fwdarw. Tm annealing for 30 sec. Fwdarw. 72℃for 60 sec); (PCR amplification parameters were set according to the Tm values of the primers in Table 6).

And a third step of: extending at 72 ℃ for 7min;

fourth step: 4℃until sampling.

2.4 Candidate primer PCR results agarose gel electrophoresis detection was performed to evaluate the effectiveness, specificity of the primer reactions:

1) Sealing the two ends of the gel sampler with adhesive tape, placing on a horizontal table, and placing a comb at about 1cm position at one end of the sampler.

2) Weighing 2g of agar powder in a conical flask, adding 100mL of 0.5 XTBE electrophoresis buffer, shaking uniformly, heating on a microwave oven or an electric furnace (adding asbestos gauze), taking out after boiling, shaking uniformly, reheating until the gel is completely melted, taking out and cooling at room temperature.

3) After the gel is cooled to about 50 ℃, pouring the gel into a sealed gel sampler to enable the thickness to be about 5 mm.

4) Gel is solidified and the adhesive tape is removed, and the gel and the sampler are put into an electrophoresis tank together.

5) Adding an electrophoresis buffer solution to enable the liquid level to be 1-2 mm higher than the glue surface, and pulling out the comb upwards; and (3) uniformly mixing the sample and the DNA size standard substance with the sample loading liquid by using a micropipette, and adding the mixture into each sample loading hole, wherein the DNA is sunk into the hole bottom due to the fact that the sucrose in the sample loading liquid has a larger specific gravity.

6) And (5) covering an electrophoresis tank, switching on a power supply, adjusting to a proper voltage, and starting electrophoresis. And judging the approximate position of the sample according to the indication of bromophenol blue in the sample carrying liquid, and determining whether to terminate electrophoresis.

7) Cutting off the power supply, taking out the gel, and putting the gel into an EB water solution with the concentration of 0.5g/mL for dyeing for 10-15 minutes.

8) The gel was observed under a transmissive ultraviolet irradiator at 254nm and the electrophoresis results were recorded either with a camera with a red filter or with a gel scanning system.

2.5 Evaluation of results:

1) If the tube No. 7 only has a bright band and no band, judging that the pair of primers and the reaction system are good in effectiveness and strong in specificity;

2) If no target band appears in the tube 7, judging that the pair of primers and the reaction system are invalid;

3) If the No. 7 tube has a primer dimer band outside the target band and also has a primer dimer band in the partial tubes of 2,3,4,5 and 6, judging that the effectiveness of the pair of primers and the reaction system is poor;

4) If the No. 7 tube has a nonspecific band outside the target band and also has a nonspecific band in the No. 5 and 6 partial tubes, judging that the specificity of the pair of primers and the reaction system is poor;

5) If primer dimer and non-specific band outside the target band appear in the tube No. 7, and primer dimer and non-specific band also appear in the tube No. 2, 3, 4, 5, 6, the effectiveness and specificity of the pair of primers and the reaction system are judged to be poor.

2.6 Based on the results of the statistics after the validation test of Table 7, SEQ ID NO.1 and SEQ ID NO.2 of Table 6 were selected as the results for HABP2: NM-004132.5: exo8: c.803G > A: p.W268Amplification primers for the sites.

HABP2-1F：5’- ATGAGACTTGGGACCGC-3’（SEQ ID NO.1）

HABP2-1R：5’- GAAGACTGTGAGGCTGGAA-3’（SEQ ID NO.2）

3. PCR amplification of mutation sites in family 1 personnel and 100 off-family personnel

PCR was performed according to the reaction system in Table 8 and the reaction system was kept on ice.

TABLE 8 mutation point PCR reaction system

Reaction conditions: the reaction system was placed in a PCR instrument and the following reaction procedure was performed for the c.803g > a site:

The first step: pre-denaturation at 95 ℃ for 5min;

And a second step of: 30 cycles (denaturation at 95℃for 30 sec. Fwdarw. Annealing at 53℃for 30 sec. Fwdarw. 72℃for 60 sec);

And a third step of: extending at 72 ℃ for 7min;

fourth step: 4℃until sampling.

4. Agarose gel electrophoresis detection

Refer to step 2.4 above.

5. Purifying a PCR product by an enzymolysis method: to 5. Mu.L of the PCR product, 0.5. Mu.L of exonuclease I (Exo I), 1. Mu.L of alkaline phosphatase (AIP) was added, and the mixture was digested at 37℃for 15min and inactivated at 85℃for 15min.

6. BigDye reaction

The BigDye reaction system is shown in Table 9.

Table 9 BigDye reaction System

Sequencing PCR cycling conditions:

The first step: pre-denaturation at 96℃for 1min;

and a second step of: 33 cycles (denaturation at 96℃for 30 sec. Fwdarw. Annealing at 55℃for 15 sec. Fwdarw. 60℃for 4 min);

And a third step of: 4℃until sampling.

7. And (3) purifying a BigDye reaction product:

1) mu.L of 125mM EDTA (pH 8.0) was added to each tube, and 1. Mu.L of 3mol/L NaAc (pH 5.2) was added to the bottom of the tube;

2) Adding 70 μL 70% alcohol, shaking and mixing for 4 times, and standing at room temperature for 15min;

3) 3000g, centrifuging at 4 ℃ for 30min; immediately inverting the 96-well plate, and centrifuging 185g for 1min;

4) Standing at room temperature for 5min, volatilizing residual alcohol at room temperature, adding 10 μl Hi-Di formamide to dissolve DNA, denaturing at 96 deg.C for 4min, rapidly placing on ice for 4min, and sequencing on machine.

8. Sequencing

And (3) carrying out DNA sequencing on the purified BigDye reaction product, wherein sequencing primers are designed on the basis of SEQ ID NO.1 and SEQ ID NO.2 (a second set of primers are designed within the range of the product sequence obtained by amplifying the first set of primers) as sequencing primers.

For HABP2: NM-004132.5: exon8: c.803G > A: p.W268The sequencing primer sequences of the sites are as follows:

HABP2-Seq1F：5’-GTCTAGCACCTTCTTATCCAA-3’（SEQ ID NO.3）；

HABP2-Seq1R：5’-AGTTGGACTACCTGACCTAAA-3’（SEQ ID NO.4）。

9. Analysis of results

For HABP2: NM-004132.5: exon8: c.803G > A: p.W268The sequencing results of the sites are shown in FIG. 2. From FIG. 2, it can be seen that 3 patients in family 1 have HABP2: NM-004132.5: exon8: c.803G > A: p.W268/>The locus genotype is the "c.803g > a" heterozygous mutation; 2 normal individuals in family 1 and 100 normal controls without blood relationship HABP2: NM-004132.5: exo8: c.803G > A: p.W268/>The locus genotype is "wild-type".

Example 4

Familial non-medullary thyroid cancer 5-type diagnostic kit and application thereof

1. The kit comprises the following components:

Kit 1: 1) Amplification primers: SEQ ID NO.1 and SEQ ID NO.2 as in example 3; 2) PCR buffer (10 XPCR buffer, consisting of KCl 500mmol/L, tris-HCl (pH 8.3) 100mmol/L and MgCl ₂ mmol/L); 3) Taq enzyme (20U); 4) dNTPs (4 mM each of the four dNTPs); 5) c.803G > A positive reference DNA, the reference is a double-stranded DNA, the specific sequence of the c.803G > A mutation site positive reference is shown as SEQ ID NO.7, the specific sequence is shown in the specification ：5'-ATGAGACTTGGGACCGCTTTCTTGTCCTTGAGATTTTCCTCTAGAAGAAAAGATTTTGCCAGAAAAAATACTATAAACACCCTTCTGTTCTAAGGTTTTGTAACCTGATGGAGGATTCAAAGAAATGTGGTCCCAGGGGGAGCACAAGAGTCTAGCACCTTCTTATCCAAAGGTTCTTTAATAAGATCCAGTGTGTTCATCAAGCCTTGACTCTGAGTTGTTTTGTTTTGTATTTTAGAAACCCAGATGCGGACGAAAAGCCCTGGTGCTTTATTAAAGTTACCAATGACAAGGTGAAAT GGAATACTGTGATGTCTCAGCCTGCTCAGCCCAGGGTAAAGGCCATGGCTGTTCAGAAGCCCAGGGGGTGGGGGGGATGGAGATTTGTAGGGAGATGTCCCTGGCACCTGGTCCCTCCCTCACCCTGTTCTTCCTCCACACCTGCTTTACCAATTCCCATCCCAGTGCCAGCCCAACTGCCCAACTGTCTGCACCCACCAGGATGCCAAGCAGGTCTGGATACCTTTGTGGGTTTAGGTCAGGTAGTCCAACTCTAAACTCATGGTTTCTGACTCCAAATCAGTGCCCTCAACAGATATTTACCCATCTCTTGCTGTTTGCCAGCCACTATGCTGGGCACTGGGTGTGCAATGGTGATCAAACTGGCTGGGCTCCCATAGCCTCTTAGGATGCAAAGCATTCAAATTCCAGCCTCACAGTCTTC-3',

Single underlined bases are positions of upstream and downstream primers for PCR amplification, boxes are mutation sites, and single underlined bolded italic bases are positions of upstream and downstream sequencing primers; 6) Sequencing primer: as shown in SEQ ID NO.3 and SEQ ID NO. 4.

2. The using method comprises the following steps:

75 individuals in 15 familial thyroid dysfunction and familial thyroid tumor families are screened and detected altogether, and 12 families 34 patients conforming to the invention are found again, and the application of the gene mutation detection kit is now described by taking the family number 2 as an example. The clinical information of family 2 is shown in table 11, and the family 2 map is shown in fig. 3.

Table 10 family non-medullary thyroid cancer type 5 screening cases List

: The third embryo is identified as a normal individual through amniotic fluid puncture and prenatal genetic diagnosis; the postnatal follow-up genotype of the infant is wild type.

#: The fourth embryo is identified as a normal individual through amniotic fluid puncture and prenatal genetic diagnosis; the postnatal follow-up genotype of the infant is wild type.

TABLE 11 clinical information of familial non-medullary thyroid cancer type 5 family member No. 2

Note that: i, II and III sequentially represent the first generation, the second generation and the third generation.

The peripheral blood DNA of members I, 2, II, 1, II, 2 and III of family personnel No.2 is used for detection of the kit 1; the method comprises the following steps:

1) Genomic DNA extraction: extracting a sample genomic DNA according to the procedure of example 2;

2) Firstly, carrying out PCR amplification reaction by adopting PCR amplification primers, taq enzyme, buffer solution, dNTPs, sample genome DNA and the like in a kit, and specifically carrying out the step 3 as in the example 3;

3) Purifying the PCR amplified product, specifically as in step 5 of example 3;

4) Performing a BigDye reaction on the purified PCR product by using the sequencing primer in the kit, wherein the specific method is as in step 6 of example 3;

5) Purifying BiyDye reaction products, and specifically performing the step 7 as in the example 3;

6) The BiyDye reaction product was sequenced and the sequenced sequence compared to the normal sequence, as specified in example 3, step 8.

The detection result of the kit on the family member No. 2 is shown in FIG. 4, wherein the position indicated by the arrow of the layer A shows that the first-evidence person HABP2 in the family is NM_004132.5:exo8:c.803G > A:p.W268The locus genotype is the "c.803g > a" heterozygous mutation; mutations exist in son and grandmother of the first-evidence person of the layers C and E; the detection result confirms that the first-person, the son of the first-person and the grandson of the first-person are familial non-medullary thyroid cancer type 5 patients, the genotype of the first-person wife daughter-in-law is wild type, and the normal individual. The mutation is possible to be a new mutation, the probability of the offspring of the first-person son and the grandmother to produce the offspring of the familial non-medullary thyroid cancer type 5 patients is 1/2, and the later birth is recommended to carry out genetic diagnosis before embryo implantation in hospitals if the need arises.

Example 5

Gene mutation ranking and interpretation (pathogenicity of mutation)

Mutation interpretation is based on our current understanding of familial non-medullary thyroid cancer type 5 and pathogenic gene HABP2 (https:// www.omim.org/entry/616535), and the clinical phenotypic association of the subject with the test results. Mutations follow the HGVS guidelines for mutation nomenclature (http:// www.hgvs.org /) and are named according to GenBank accession numbers (https:// www.ncbi.nlm.nih.gov/GenBank /). The rules for interpretation of genetic variation data refer to guidelines ：Richards,S,et al., Standards and guidelines for the interpretation of sequence variants:a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med, advance online publication 5 March 2015. doi:10.1038/gim.2015.30; associated with the american society for genetics and Genomics (ACMG), chinese classification standards and guidelines for genetic variation: wang Qiuju, shen Yiping, ling KV, et al, classification standards and guidelines for genetic variation: life sciences, 2017, 47:668-688.

The genetic variation classification in the "genetic variation classification criteria and guidelines" is to perform five-level classification on variations based on typical data types (such as crowd data, calculation data, functional data, co-segregation data), which are respectively: "pathogenic (P)", "potentially pathogenic (likely pathogenic, LP)", "ambiguous (variant of uncertain significance, VUS)", "potentially benign (likely benign, LB)", and "benign (benign, B)"; the five-level classification was determined based on the composite score after interpretation analysis of each side/sub-item of variation (table 12).

TABLE 12 determination criteria for pathogenicity of variation

Before a five-level assessment, the sides/sub-items of the mutation/variation need to be analyzed/interpreted. Among these, the pathogenic mutation criteria can be classified as: for a given mutation/mutation, first, the criteria in Table 13 need to be selected based on observed evidence, it is determined which side/sub-items of the mutation/mutation can meet in Table 13, each is evaluated as being PVS1/PS 1-4/PM 1-6/PM 1-5/BA 1/BS 1-4/BP 1-6, and finally, the sub-items of the mutation/mutation can be combined according to the scoring rules of Table 12, and then a classification is selected from the five-level system according to the combined criteria of Table 12, e.g., if the side/sub-items of the mutation/mutation meet in Table 13 after analysis of the side/sub-items of the mutation/mutation by the criteria [ i.e., P1 ] "(i.e., the comprehensive criteria of the" comprehensive "P1, P1" is satisfied by the comprehensive criteria of "in Table 12)".

TABLE 13 variant interpretation criteria and variant pathogenicity criterion

/>

Analysis/interpretation of the sides/sub-items of mutations/variations is based on the corresponding bioinformatic analysis tools (see table 15) and a number of available data (libraries) (see table 16), including data obtained from existing cases, as well as data obtained from existing publications, such as public databases (e.g., clinVar or site-specific databases) and laboratory owned databases. The degree judgment evaluation criteria used in the analysis of mutation/mutation using various data (libraries) are shown in table 14.

Table 14 degree judgment evaluation criteria

/>

Table 15 biological information analysis tool

/>

Table 16 crowd database, disease-specific database and sequence database

/>

According to the above criteria or guidelines, the c.803G > A mutation of the HABP2 gene of the present invention is evaluated as "pathogenic", and the judgment criteria and specific evidence are shown in Table 17 below:

TABLE 17 pathogenic interpretation of the c.803G > A mutation of the HABP2 gene

AD: refers to autosomal dominant inheritance.

HABP2:NM_004132.5:exon8:c.803G>A:p.W268The variation rating evidence is as follows:

1. PVS1: the HABP2 gene c.803g > a variant, which occurs at the 8 th exon of the gene (the HABP2 gene shares 13 exons), is nonsense mutated, with much more than 10% of the protein region affected;

2. PS4: combining literature and this case, this variation was detected in multiple patients (37);

3. PM2: the HABP2 gene c.803G > a variation was not found in the reference human thousand genome (1000G), with a frequency of 8.247e-06 in the human exon database (ExAC) and 1.625e-05 in the human genome mutation frequency database (gnomAD);

4. PP3: various computer software predicts that this variation will have deleterious effects on the gene or gene product;

thus, the comprehensive evidence of this mutation/variation (pvs1+ps4+pm2+pp3) meets the criteria (a) and (c) in table 12 for "pathogenicity (P)" where the HABP2 gene c.803g > a variation is comprehensively determined to be "pathogenicity".

Example 6

Follow-up and diagnostic kit detection performance analysis

All family members were followed and re-sequencing analysis verified by HABP2 gene targeted capture chip method for all individuals (see table 18).

TABLE 18 c.803G > A site detection Performance analysis results

Note that: the table contains follow-up data for family 1.

As can be seen from a combination of table 1 and table 10, positive patients (37 cases) were found when 13 families were examined. The positive site detection results are verified by an HABP2 gene targeting capture chip method. According to follow-up and verification results, 39 true positive cases, 45 true negative cases, 0 false negative cases and 0 false positive cases are found in total. The sensitivity of detection of the 803G & gt A mutation site marker is 100.00%, 95% CI (95% confidence interval) is 99.03% -100%, the specificity is 100%, and 95% CI is 99.03% -100%. The results show that the kit has good detection performance in clinical application.

According to the above embodiment, it can be seen that the HABP2 gene mutant of the present invention can be used as a biomarker for diagnosing familial non-medullary thyroid cancer type 5, and provides a possible drug target for treating familial non-medullary thyroid cancer type 5.

In the above technical solution of the present invention, the above is only a preferred embodiment of the present invention, and therefore, the patent scope of the present invention is not limited thereto, and all the equivalent structural changes made by the description of the present invention and the content of the accompanying drawings or the direct/indirect application in other related technical fields are included in the patent protection scope of the present invention.

Claims

1. The application of the HABP2 gene mutant as a detection target in preparing a detection reagent and/or a detection kit for familial non-medullary thyroid cancer type 5 is characterized in that the HABP2 gene mutant is mutated from a base G to a base A at 803 th base of an 8 th exon of a wild type HABP2 gene compared with the wild type HABP2 gene; the detection reagent and the detection kit both comprise a positive reference, and the specific sequence of the positive reference is shown as SEQ ID NO. 7;

The detection reagent and/or the detection kit comprises an amplification primer of an HABP2 gene mutant, wherein the amplification primer comprises an upstream primer HABP2-1F and a downstream primer HABP2-1R; the upstream primer HABP2-1F is a nucleotide sequence shown as SEQ ID NO.1, and the downstream primer HABP2-1R is a nucleotide sequence shown as SEQ ID NO. 2;

The detection reagent and/or the detection kit comprises a sequencing primer of an HABP2 gene mutant, wherein the sequencing primer comprises an upstream primer HABP2-Seq1F and a downstream primer HABP2-Seq1R; the upstream primer HABP2-Seq1F is a nucleotide sequence shown as SEQ ID NO. 3; the downstream primer HABP2-Seq1R is a nucleotide sequence shown as SEQ ID NO. 4.