CN116445603A - Primer group, kit and system for detecting various mutations in hemophilia a - Google Patents

Primer group, kit and system for detecting various mutations in hemophilia a Download PDF

Info

Publication number
CN116445603A
CN116445603A CN202310224086.5A CN202310224086A CN116445603A CN 116445603 A CN116445603 A CN 116445603A CN 202310224086 A CN202310224086 A CN 202310224086A CN 116445603 A CN116445603 A CN 116445603A
Authority
CN
China
Prior art keywords
gene
mutations
hemophilia
sequencing
mutation
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202310224086.5A
Other languages
Chinese (zh)
Other versions
CN116445603B (en
Inventor
谢田田
梁德生
武乐
李佳琪
卢玉林
毛爱平
任志林
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Fujian Beirui Inspection Institute Co ltd
Original Assignee
Fujian Beirui Inspection Institute Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fujian Beirui Inspection Institute Co ltd filed Critical Fujian Beirui Inspection Institute Co ltd
Priority to CN202310224086.5A priority Critical patent/CN116445603B/en
Publication of CN116445603A publication Critical patent/CN116445603A/en
Application granted granted Critical
Publication of CN116445603B publication Critical patent/CN116445603B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a primer group, a kit and a system for detecting various mutations in hemophilia A. Wherein the system comprises the following modules: 1) And the acquisition module is used for: obtaining and preparing a subject sample; 2) Amplification module: multiplex long fragment PCR amplification is carried out on the sample; 3) Library construction module: constructing a long fragment sequencing library; 4) Sequencing module: sequencing and analyzing the mutation type of the gene.

Description

Primer group, kit and system for detecting various mutations in hemophilia a
Technical Field
The invention relates to a primer and a method for detecting various mutations in hemophilia A by using a long-fragment long-reading long-sequencing platform, and a kit suitable for the method.
Background
Hemophilia a (also known as Hemophilia a, HA) is an X-chromosome-linked recessive hematological disease caused by coagulation Factor VIII (FVIII) deficiency due to FVIII genetic variation located on the X-chromosome 1 . Because of the lack of the coagulation factor FVIII, the platelet surface is unable to activate thrombin, hemophilia can clinically manifest itself as spontaneous bleeding of tissues such as muscle, viscera, etc., or failure to form a blood clot after trauma, and bleeding is difficult to stop. Hemophilia is generally a more severe phenotype with an earlier onset time, and severe hemophilia infants need life-long treatment, so early judgment and treatment is very important 2,3 . HA occurs regardless of region or race, with a prevalence of 1/5000 in men and most women being asymptomatic carriers based on statistics of the international hemophilia alliance (WFH). About one third of newly diagnosed infants have no family history of hemophilia, probably due to spontaneous mutation of FVIII gene 4,5 . The population of China is numerous, so that HA patients with a large absolute number are registered, and 23000 HA patients are currently registered since hemophilia patient information registration work is carried out in China 6 。
The phenotypic severity of hemophilia A is related to the level of FVIII activity in the plasma (FVIII: C), severe hemophilia A is defined as plasma FVIII levels below 1% normal (normal plasma levels 50-100U/dL), moderate hemophilia A1-5%, mild hemophilia 5% -30%. About two-thirds of patients suffer from severe hemophilia a, 15% from moderate hemophilia a, 20% from mild hemophilia a 7 。
The full-length 186kb F8 gene at Xq28, consisting of 26 exons and 25 introns, encodes a polypeptide chain of 2351 amino acids, is one of the largest genes known to humans at present 8 . F8 gene is structurally bulky, resulting in a wide variety of mutations in its gene, the most common of which is the gene rearrangement of intron 1 (int 1) and intron 22 (int 22) due to non-allelic homologous recombination (NAHRs) mechanisms. F8 GeneInt22h-1 in part will recombine with two exogenous fragments (Int 22h-2 and Int22 h-3) to form an inversion, including Inv22 Type I (recombination between Int22h-1 and Int22 h-3) and Inv22 Type II (recombination between Int22h-1 and Int22 h-2), and also deletions, including Del22Type I and Del22Type II and duplications (Dup 22) 9 . Int22 inversion and Int1 inversion caused 40-50% and 2-5% of severe HA cases worldwide, respectively 10,11 . The remaining structural variations (major deletions of non-recurrent family specificity and complex rearranged structural variations) resulted in 8-15% of severe HA cases 1 . At the same time, more than 3000 SNVs and indels have also been reported 12,13 。
Due to the abundance of F8 gene mutation types, traditional HA diagnosis often requires multiple technical combinations. The LR-PCR is utilized to screen the structural variation of Int1 and Int22, and whether inversion, deletion and repetition occur in the detection area can be judged 14 . Meanwhile, reverse PCR (IS-PCR) can also detect the gene rearrangement variation related to Int22 through system design 9 . However, these two methods only detect the amplicon length by gel electrophoresis to determine the mutation type, and cannot accurately determine the recombination position, and the mutation type is limited. Detection of a Point mutation in the critical region of the F8 Gene by PCR+Sanger sequencing, but failure to detect structural variation 15 . The SNVs and indexes detection depth in the F8 region can be greatly improved by utilizing second generation sequencing (NGS), but the structural variation type of the F8 gene cannot be detected due to the limitation of short reading length 16 The method comprises the steps of carrying out a first treatment on the surface of the In addition, MLPA can be used for detecting deletion of large fragments which cannot be detected by NGS and PCR+Sanger 17 。
At present, F8 structural variation detection and SNVs and indexes detection can be realized based on methods such as IS-PCR, LR-PCR, MLPA, sanger sequencing or second generation sequencing and the like by combining screening, but the detection mainly has the following limitations:
1. the SNVs & indexes and SV detection of the F8 gene cannot be realized in the same system at the same time;
2. the accurate breaking point of the large fragment deletion cannot be determined by only one detection method;
3. only one detection method cannot be used for determining the specific subtype of the Int22 structural variation;
4. the traditional method needs a plurality of technologies to be combined, so that the requirement on the quality of a sample is high, the gene diagnosis time is long, and the detection cost is high.
Disclosure of Invention
In view of this, the present invention provides a method for detecting a variety of mutations in the HA-related F8 gene based on multiplex-long fragment PCR amplification and long fragment sequencing. The long fragment PCR amplification is realized in a reaction tube, and the 11 fragments (F8 Exon1, F8Exon 2-4, F8Exon 5-6, F8Exon7-10, F8Exon 11-12, F8Exon 13, F8Exon 14, F8Exon 15-20, F8Exon 21-22, F8Exon 23-25, F8Exon 26) for detecting inversion, deletion and repetition of the F8 gene Int1 and Int22 are amplified respectively (Int 1h-1, int1 h-2, int22h-3, int22h1-23, int22h1-2, int22h 1-3) and the Gap fragment for detecting the deletion amplification of the large fragment are combined with the characteristics of long fragment sequencing of read length measurement, and the like, and the rapid and accurate F8 mutation can be realized. The method is simple and convenient to operate, the long fragment PCR and the long fragment library are reliable in quality and high in repeatability, and the method is favorable for the application of the long fragment sequencing technology in clinical detection.
The invention aims to solve the problems of clinical missed detection and false detection caused by incomplete coverage of HA pathogenic genes at the present stage and complicated gene diagnosis detection methods and single mutation type detection by different methods. The targets of comprehensively, accurately and rapidly detecting multiple mutations of the HA genes of multiple samples are realized by simultaneously amplifying multiple fragments of the HA related pathogenic gene F8 through long fragment PCR and preparing a long fragment sequencing library.
In a first aspect of the invention, the invention provides a primer set for simultaneous amplification of multiple mutations in hemophilia a comprising one or more primers selected from the group consisting of:
1) The 22 primers used to amplify the exon of the F8 gene were as follows: E1F, E1R, E2F, E4R, E5F, E6F, E10R, E F, E R, E F, E13R, E14 4815R, E F, E R, E21F, E R, E F, E R, E26F, E R having the sequence set forth in SEQ ID NO:1-22;
2) The 5 primers used to amplify Int22 and its related variants were as follows: H1-F, H1-R, H2-F, H3-F, H2/3-R, the sequences of which are shown in SEQ ID NO:23-27;
3) The 3 primers used to amplify Int1 and its related variants were as follows: the sequences of int1F1 and int1R, inv F are respectively shown in SEQ ID NO:28-30
4) The 51 primers used to amplify the 200kb deletion within and upstream of the F8 gene were as follows: int1F2, int6F, int F1, int13F2, int14F1, int14F2, int14F3, int22F1, int22F2, int25F1, int25F2, GF1, GF2, GF3, GF4, GF5, GF6, GF7, GF8, GF9, GF10, GF11, GF12, GF13, GF14, GF15, GF16, GF17, GF18, GF19, GF20, GR1, GR2, GR3, GR4, GR5, GR6, GR7, GR8, GR9, GR10, GR11, GR12, GR13, GR14, GR15, GR16, GR17, GR18, GR19, GR20, having the sequence set forth in SEQ ID NO:31-81;
wherein the plurality of mutations in hemophilia a comprises one or more of:
1) SNVs and indels on the exon of the F8 gene;
2) Int22 and related inversion, deletion, and repeat variations thereof;
3) Inversion variation associated with Int 1;
4) F8 large fragment within 200kb upstream and downstream was deleted;
5) Point mutation within the primer range on F8 gene.
In one embodiment, the primer set comprises the following primers:
1) The 22 primers used to amplify the exon of the F8 gene were as follows: E1F, E1R, E2F, E4R, E5F, E6F, E10R, E F, E R, E F, E13R, E14 4815R, E F, E R, E21F, E R, E F, E R, E26F, E R having the sequence set forth in SEQ ID NO:1-22;
2) The 5 primers used to amplify Int22 and its related variants were as follows: H1-F, H1-R, H2-F, H3-F, H2/3-R, the sequences of which are shown in SEQ ID NO:23-27;
3) The 3 primers used to amplify Int1 and its related variants were as follows: the sequences of int1F1 and int1R, inv F are respectively shown in SEQ ID NO: 28-30;
4) The 51 primers used to amplify the 200kb deletion within and upstream of the F8 gene were as follows: int1F2, int6F, int F1, int13F2, int14F1, int14F2, int14F3, int22F1, int22F2, int25F1, int25F2, GF1, GF2, GF3, GF4, GF5, GF6, GF7, GF8, GF9, GF10, GF11, GF12, GF13, GF14, GF15, GF16, GF17, GF18, GF19, GF20, GR1, GR2, GR3, GR4, GR5, GR6, GR7, GR8, GR9, GR10, GR11, GR12, GR13, GR14, GR15, GR16, GR17, GR18, GR19, GR20, having the sequence set forth in SEQ ID NO: 31-81.
Wherein, the positions of the 81 primers are shown in FIG. 1. The primers can amplify the entire sequence of the F8 gene within the primer range, including any type of mutant sequence within the primer range. Preferably, the amplification product is between about 2Kb and about 13 Kb. Preferably, degenerate base primers are used if there are SNPs at the primer positions.
In a preferred embodiment, wherein the primer set amplifies more than 15 target fragments in one system, at least one of which can be detected simultaneously: point mutation of the exon of F8 gene, inversion of Int1 and inversion, deletion and repetition of Int22, and deletion of large fragment within 200kb of F8 gene and upstream and downstream. Wherein the point mutations comprise more than 3000 point mutations on the F8 gene from five databases (CHAMP, EAHAD, LOVD, clivar and Hemobase) listing.
Among them, point mutations and structural variations at the gene loci described herein can be found in CHAMP (https:// www.cdc.gov/ncbddd/hectilla/camps. Html), EAHAD (https:// F8-db. EAHAD. Org), LOVD (https:// databases. LOVD. Nl/shared/genes/F8), clinVar (https:// www.ncbi.nlm.nih.gov/ClinVar) and Hemobase (http:// www.hemobase.com/EN/Index. Htm).
In a preferred embodiment, the primer set of the present invention can detect 26 exon point mutations in the F8 gene, int22 and its related inversion, deletion and recombination variants and subtypes thereof (Inv 22Type I, inv22 Type II, del22Type I, del22Type II, dup 22), int1 related inversion variants, and large fragment deletions within the F8 gene and within 200kb upstream and downstream simultaneously.
In one embodiment, 5-50nt of DNA of different sequences, namely DNA bar code (Barcode), can be added at the 5' end of the primer for distinguishing between different samples; preferably, the 5' end Barcode of the F and R primers may be the same or different, and may be selected as desired by one skilled in the art.
In a preferred embodiment, wherein the primer set is used for multiplex-long fragment PCR amplification of more than 15 target fragments of F8 gene for 1 system.
In a preferred embodiment, the primers can be used to detect whether different mutations within the amplified product fragment are linked, if the mutations are located on the same chromosome, then the mutations are linked; if the mutation is located on both stained alleles, the mutation is not linked.
The primer set of the invention can be used for multiplex-long fragment PCR amplification of 1 system, including HA-related pathogenic gene fragments of mutation type within the range of all primers. And then combining with a subsequent long fragment sequencing platform, the mutation types of all the gene fragments in the primer range can be detected.
According to a second aspect of the present invention there is provided the use of a primer set as described above in the manufacture of a kit for detecting a plurality of mutations in hemophilia a, wherein the plurality of mutations in hemophilia a comprises one or more of:
1) SNVs and indels on the exon of the F8 gene;
2) Int22 and related inversion, deletion, and repeat variations thereof;
3) Inversion variation associated with Int 1;
4) F8 large fragment within 200kb upstream and downstream was deleted;
5) Point mutation within the primer range on F8 gene.
According to a third aspect of the present invention there is provided a kit of primers for detecting a plurality of mutations in hemophilia a comprising the following reagents:
1) Reagents for multiplex long fragment PCR amplification;
2) Reagents for constructing a long fragment sequencing library;
wherein the reagent for PCR amplification comprises the above primer set;
wherein the plurality of mutations in hemophilia a comprises one or more of:
1) SNVs and indels on the exon of the F8 gene;
2) Int22 and related inversion, deletion, and repeat variations thereof;
3) Inversion variation associated with Int 1;
4) F8 large fragment within 200kb upstream and downstream was deleted;
5) Point mutation within the primer range on F8 gene.
In one embodiment, the kit can be used to detect whether different mutations within the same amplified fragment are linked, if they are located on the same chromosome, then the mutations are linked; if the mutation is located on both stained alleles, the mutation is not linked.
In one embodiment, for the kit, the long fragment PCR amplification products may or may not be purified prior to the next reaction, and may be selected as desired by one of skill in the art.
In one embodiment, the reagents for long fragment PCR amplification include DNA polymerase, reaction buffers, and primers.
In another embodiment, wherein the kit, reagents for constructing a long fragment sequencing library include end repair enzymes, linkers, ligases, DNA purification magnetic beads, reaction buffers, and exonucleases.
In a preferred embodiment, wherein said kit is capable of at least simultaneous detection of: point mutation of exon of F8 gene, inversion, deletion and repetition mutation of Int1 and Int22, and deletion of large fragment within 200kb upstream and downstream of F8. Wherein the point mutations comprise more than 3000 point mutations on the F8 gene from five databases (CHAMP, EAHAD, LOVD, clivar and Hemobase) listing.
Among them, point mutations and structural variations at the gene loci described herein can be found in CHAMP (https:// www.cdc.gov/ncbddd/hectilla/camps. Html), EAHAD (https:// F8-db. EAHAD. Org), LOVD (https:// databases. LOVD. Nl/shared/genes/F8), clinVar (https:// www.ncbi.nlm.nih.gov/ClinVar) and Hemobase (http:// www.hemobase.com/EN/Index. Htm).
In a preferred embodiment, the kit can detect 26 exon point mutations in the F8 gene, int22 and its associated inversion, deletion and recombination variants and subtypes thereof (Inv 22Type I, inv22 Type II, del22Type I, del22Type II, dup 22), int 1-associated inversion variants, and large fragment deletions within 200kb upstream and downstream of F8.
In a preferred embodiment, wherein the primer set is used for long fragment PCR amplification of more than 15 gene fragments.
In a specific embodiment, wherein multiplex-long fragment PCR amplification is accomplished in one reaction tube for the kit.
In a preferred embodiment, the long fragment sequencing is selected from the group consisting of SMRT-based sequencing from Pacific Biosciences (PacBio detected) or the Nanopore sequencing platform from ONT.
In a specific embodiment, SMRT library linker ligation may be performed using blunt end ligation or TA ligation.
In a specific embodiment, the SMRT universal blunt end linker sequence is 5'-pATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGA GAGAT-3' (SEQ ID NO: 82) that is annealed to form a blunt end stem loop adaptor aptamer. DNA (Barcode) with different sequences of 5-50nt can be added to the stem to form different adaptor aptamers with Barcode. SMRT libraries with different Barcode can be pooled together for sequencing.
In a specific embodiment, the SMRT universal TA linker sequence is 5'-pATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGA GAGATT-3' (SEQ ID NO: 83), which is annealed to form a blunt-ended stem-loop linker aptamer. DNA (Barcode) with different sequences of 5-50nt can be added to the stem to form different adaptor aptamers with Barcode. SMRT libraries with different Barcode can be pooled together for sequencing.
In one embodiment, the SMRT joint may or may not be Barcode. Preferably, the SMRT connector is either a PacBio-designed Barcode or a self-designed Barcode, which can be selected by those skilled in the art as desired.
In a preferred embodiment, the SMRT library is matched to a PacBio corporation sequencing platform.
In a preferred embodiment, wherein the reagents for constructing a long fragment Nanopore library include end repair enzymes, linkers, ligases, DNA purification magnetic beads, 80% ethanol, and reaction buffers.
In one embodiment, the Nanopore library linker ligation may use blunt end ligation or TA ligation.
In one embodiment, the Nanopore linker may or may not be Barcode. Preferably, the Nanopore connector is a Barcode designed by ONT company or a Barcode designed by itself, and can be selected by those skilled in the art as required.
In a preferred embodiment, the Nanopore library is matched to an ONT company sequencing platform.
According to a third aspect of the present invention there is provided a system for detecting a plurality of mutations in hemophilia a comprising the following modules:
1) And the acquisition module is used for: obtaining and preparing a subject sample;
2) Amplification module: multiplex long fragment PCR amplification is carried out on the sample;
3) Library construction module: constructing a long fragment sequencing library;
4) Sequencing module: sequencing and analyzing the mutation type of the genes;
wherein the PCR amplification in the module (2) adopts the primer group;
wherein the plurality of mutations in hemophilia a comprises one or more of:
1) SNVs and indels on the exon of the F8 gene;
2) Int22 and related inversion, deletion, and repeat variations thereof;
3) Inversion variation associated with Int 1;
4) F8 large fragment within 200kb upstream and downstream was deleted;
5) Point mutation within the primer range on F8 gene.
In one embodiment, the system can be used to detect whether different mutations within the same amplified fragment are linked, if they are located on the same chromosome; if the mutation is located on both stained alleles, the mutation is not linked.
In a preferred embodiment, wherein the system can at least simultaneously detect: point mutation of exon of F8 gene, inversion, deletion and repetition mutation of Int1 and Int22, and deletion of large fragment within 200kb upstream and downstream of F8. Wherein the point mutations comprise more than 3000 point mutations on the F8 gene from five databases (CHAMP, EAHAD, LOVD, clivar and Hemobase) listing.
Among them, point mutations and structural variations at the gene loci described herein can be found in CHAMP (https:// www.cdc.gov/ncbddd/hectilla/camps. Html), EAHAD (https:// F8-db. EAHAD. Org), LOVD (https:// databases. LOVD. Nl/shared/genes/F8), clinVar (https:// www.ncbi.nlm.nih.gov/ClinVar) and Hemobase (http:// www.hemobase.com/EN/Index. Htm).
In a preferred embodiment, wherein the system can detect 26 exon point mutations in the F8 gene, int22 and its associated inversion, deletion and recombination variants and subtypes thereof (Inv 22Type I, inv22 Type II, del22Type I, del22Type II, dup 22), int 1-associated inversion variants, and large fragment deletions within 200kb upstream and downstream of F8.
In a preferred embodiment, the primer set is used for multiplex-long fragment PCR amplification of more than 15 fragments of the F8 gene.
In a preferred embodiment, wherein the system, multiplex-long fragment PCR amplification is accomplished in one reaction tube.
In one embodiment, wherein the sample is selected from a biological sample or a sample-extracted gDNA. Wherein the biological sample is selected from cultured cell lines, blood, amniotic fluid, villus, gametes, blasts, joint fluid, urine, sweat, saliva, feces, cerebrospinal fluid, ascites fluid, hydrothorax, bile, pancreatic fluid, or the like.
In a specific embodiment, wherein the long fragment sequencing of the system is selected from SMRT sequencing by pacbrio corporation or Nanopore sequencing by ONT corporation.
In one embodiment, SMRT library linker ligation may use blunt end ligation or TA ligation.
In one embodiment, the universal blunt end linker sequence for the SMRT library is 5'-pATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGA GAGAT-3' (SEQ ID NO: 82) that is annealed to form a blunt end stem loop adaptor aptamer. DNA (Barcode) with different sequences of 5-50nt can be added to the stem to form different adaptor aptamers with Barcode. PacBIO libraries with different Barcode can be pooled together for sequencing.
In one embodiment, the SMRT library universal TA linker sequence is 5'-pATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGA GAGATT-3' (SEQ ID NO: 83) that is annealed to form a blunt-ended stem-loop linker aptamer. DNA (Barcode) of 5-50nt different sequences can be added to the stem to form different adaptor aptamers with Barcode, and PacBIO libraries with different Barcode can be mixed together for sequencing.
In one embodiment, the SMRT library linker may or may not be Barcode. In a preferred embodiment, the SMRT library is designed with Barcode by PacBio corporation or self-designed Barcode. Those skilled in the art can choose this as desired.
In a preferred embodiment, the SMRT library is matched to a PacBio corporation sequencing platform.
In a preferred embodiment, wherein the reagents for constructing a long fragment Nanopore library include end repair enzymes, linkers, ligases, DNA purification magnetic beads, 80% ethanol, and reaction buffers.
In one embodiment, the Nanopore library linker ligation may use blunt end ligation or TA ligation.
In one embodiment, the Nanopore linker may or may not be Barcode, and may be selected as desired by those skilled in the art. Preferably, the Nanopore connector is a Barcode designed by ONT company or a Barcode designed by itself, and can be selected by those skilled in the art as required.
In a preferred embodiment, the Nanopore library is matched to an ONT company sequencing platform.
The system based on the specific combination of the long fragment PCR amplification and the high-throughput sequencing of the long fragment can realize the simultaneous detection of multiple mutations of the F8 pathogenic genes related to a plurality of samples HA with high specificity, accuracy and rapidness.
The excellent technical effects of the primer group, the kit and the system are mainly as follows:
(1) The detection range is wide. The invention can detect all the point mutations on the F8exon of the HA related gene which is researched and found at present, and comprises more than 3000 in total, and can detect all the unknown types of point mutations on the F8 gene; the method can detect the deletion of the large fragment within 200kb at the upstream and downstream of F8, and accurately judge the position of the breaking point of the deletion of the large fragment; specific subtypes of structural variation (Inv 22Type I, inv22 Type II, del22Type I, del22Type II, dup 22) and Int 1-related inversion variation can be distinguished while Int22 and its related inversion, deletion and recombination variation can be detected.
(2) Multiple mutation types are detected by a single kit. The conventional method needs to set a detection system for each mutation type: detection of SNVs and Indels requires detection using pcr+sanger or NGS methods; structural variations of Int22 and Int1 require detection using LR-PCR or IS-PCR; large fragment deletions associated with the F8 gene need to be detected using MLPA; in the invention, a plurality of mutations including SNVs, indels and structural variations are detected simultaneously in a reaction primer system.
(3) The detection false detection and omission rate is low. The current common method for detecting the F8 point mutation of the most common pathogenic gene of HA is PCR+Sanger. Because the F8 gene is huge, the detection range of Sanger is limited, and the detection experiment is complicated, the missed diagnosis of pathogenic mutation is easy to cause false negative judgment. The method directly amplifies all exon regions of the F8 gene, all Int1 and Int22 related structural variation fragments and GAP fragments with large fragment deletion, thereby greatly reducing the risks of false detection and missed detection for patients, greatly improving the simplicity of HA gene diagnosis and greatly reducing the time cost and labor cost of HA gene diagnosis.
(4) Samples are diversified. Templates for PCR may be peripheral blood, dried blood spots or extracted genomic DNA, but also cell lines of human origin or other specific tissues.
(5) High throughput detection. The long fragment sequencing can realize 384 Barcode joints, and more Barcode joints can be designed according to the requirement. Or a dual-Barcode system with a primer and an adapter for the Barcode is utilized to realize more than one Barcode combination. The high throughput characteristics of the long fragment sequencing platform dictate that high throughput sample detection can be achieved.
(6) The accuracy is high. SMRT dumbbell libraries from PacBio can be read in multiple rounds during sequencing, and the accuracy of the bases in the corrected sequencing results is greater than 99%. And SMRT sequencing errors are random, and the accuracy of the corrected bases by sequencing depth is more than 99.9%. Thus, the mutation of the gene within the detection range of the primer can be precisely interpreted.
(7) The detection time is flexible. The Nanopore platform can generate data in minutes and can initiate data analysis in minutes or hours depending on the actual data volume requirements. The Nanopore platform has time advantages when the requirements for detection aging are high.
Drawings
Fig. 1: schematic of multiplex-long fragment PCR primer design;
fig. 2: DNA gel electrophoresis of amplified samples according to the multiplex-long fragment PCR method in example 1;
fig. 3: representative HA-related gene mutation sample PacBIO sequencing results.
Detailed Description
While this invention may be embodied in many different forms, there are disclosed herein specific illustrative embodiments thereof which embody the principles of the invention. It should be emphasized that the present invention is not limited to the specific embodiments illustrated. Furthermore, any section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.
Unless otherwise defined herein, scientific and technical terms used in connection with the present invention will have the meanings commonly understood by one of ordinary skill in the art. Furthermore, unless the context requires otherwise, terms in the singular shall include the plural and terms in the plural shall include the singular. More specifically, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. In this application, the use of "or" means "and/or" unless stated otherwise. Furthermore, the use of the term "include" and other forms (such as "include" and "contain") is not limiting. Furthermore, the scope provided in the specification and the appended claims includes all values between the endpoints and between the endpoints.
Summary of the sequence Listing
The present application is accompanied by a sequence listing comprising a number of nucleic acid and amino acid sequences. Table a below provides an overview of the sequences involved.
Table A
/>
Example 1: amplification of HA-related Gene mutations Using the multiplex-Long fragment PCR method of the present invention
The reaction system was prepared as follows in table 1, and peripheral blood, dried blood spots and genomic DNA samples were amplified:
table 1:
on a PCR apparatus, pre-amplification was performed under the conditions shown in Table 2 below:
table 2:
after the amplification is completed, 5ul of each sample is taken and detected on 1% of DNA gel, and the result is shown in figure 2, and by taking different samples as templates, the F8 gene related to HA can be effectively amplified.
Example 2: construction of PacBio sequencing library Using the Long fragment PCR method of the present invention
Step 1: long fragment PCR amplification
A reaction system was prepared as follows in Table 3, and samples of peripheral blood samples of different types of HA-related F8 gene mutations were amplified:
table 3:
on a PCR apparatus, pre-amplification was performed under the conditions shown in Table 4 below:
table 4:
after amplification, the amplified product was placed in a centrifuge at 10000rpm for 20min. After centrifugation, the mixture was left to stand horizontally, and 4. Mu.L of the supernatant was added to a new tube.
Step 2: construction of PacBIO sequencing library
The reaction system was prepared according to the following table 5:
table 5:
on a PCR instrument, the reaction was performed under the following conditions: 20min at 37 ℃;25 ℃ for 15min; and at 65℃for 10min. After completion of the reaction, 0.5 μ L Exonuclease III (NEB, cat#M0206L) and 0.5 μ L Exonuclease VII (NEB, cat#M0379L) were added, and the reaction was continued at 37℃for 1 hour. The DNA was purified twice with 0.6x Ampure PB beads (PacBIO, cat# 100-265-900) according to the manufacturer's instructions and finally eluted with 10uL Elution Buffer. The resulting DNA eluate was the DNAPacBio sequencing library of interest. The DNA concentration was determined on a Qubit 3 Fluoster (ThermoFisher, cat#Q 33216) with the Qubit dsDNA HS reagent (ThermoFisher, cat#Q 32851). When there are multiple sample PacBio sequencing libraries, equal amounts of the libraries can be mixed together to prepare a mixed library.
Step 3: pacBio on-machine sequencing and analysis
Based on the total and molar concentration of the library, the appropriate volume of library was reacted with binding reagents (PacBIO, cat# 101-820-200) and primers (PacBIO, cat# 100-970-100) to prepare the final on-machine library. Representative sequencing results are shown in FIG. 3, A is a schematic of a WT sample IGV, B is a schematic of an INV1 structural variation IGV, C is a schematic of an Inv22 Type I structural variation IGV, D is a schematic of an Inv22 Type II structural variation IGV, and E is a schematic of an F8 large fragment deletion IGV.
EXAMPLE 3 detection and verification of F8 Gene mutation
Peripheral blood genomic DNA from 30 subjects was collected as a validation sample, and with reference to example 2, HA-related F8 gene locus multiple mutations were simultaneously detected using the methods (and kits) of the present invention. Meanwhile, the IS-PCR or LR-PCR method IS used for detecting the structural variation of Int22, and the PCR and Sanger sequencing method IS used for detecting the point mutation of the F8 gene. The results obtained with the present invention are compared with the control results, and the results are shown in Table 6, and the results of 30 samples are completely consistent.
TABLE 6
/>
Thus, the results of the detection using the method of the present invention achieved 100% specificity and sensitivity by comparison with IS-PCR or LR-PCR or PCR+Sanger sequencing or MLPA methods. In addition, 11 samples among 30 samples determine the inverted subtype of Int22 by the method of the invention, and 2 samples determine specific breakpoint positions.
While the above embodiments have demonstrated a series of features of the present invention, it will be apparent to those skilled in the art from this disclosure that the reagents, reaction conditions, etc. involved in multiplex long fragment PCR reactions and long fragment sequencing library construction can be adapted and altered as desired. It will thus be appreciated that those skilled in the art will be able to devise numerous alternative arrangements which, although not explicitly described herein, embody the principles of the invention and are included within its spirit and scope.
Reference to the literature
[1]Miguel Martín Abelleyro,Claudia Pamela Radic,Vanina Daniela Marchione,Karen Waisman,Tomas Tetzlaff,Daniela Neme,Liliana Carmen Rossetti,Carlos Daniel De Brasi.Molecular insights into the mechanism of nonrecurrent F8 structural variants:Full breakpoint characterization and bioinformatics of DNA elements implicated in the upmost severe phenotype in hemophilia A.Hum Mutat.2020Apr；41(4):825-836.doi:10.1002/humu.23977.Epub 2020Jan 16.
[2]Dougald M Monroe,Maureane Hoffman.What does it take to make the perfect clotArterioscler Thromb Vasc Biol.2006Jan；26(1):41-8.doi:10.1161/01.ATV.0000193624.28251.83.Epub 2005Oct 27.
[3] The department of pediatrics professionals, the department of pediatrics family treatment expert consensus for children hemophilia, journal 012 (2021) of pediatrics practical use, 036.
[4]S Keeney,M Mitchell,A Goodeve.The molecular analysis of haemophilia A:a guideline from the UK haemophilia centre doctors'organization haemophilia genetics laboratory network.Haemophilia.2005Jul；11(4):387-97.doi:10.1111/j.1365-2516.2005.01111.x.
[5]Roshni Kulkarni,J Michael Soucie.Pediatric hemophilia:a review.Semin Thromb Hemost.2011Oct；37(7):737-44.doi:10.1055/s-0031-1297164.Epub 2011Dec 20.
[6] The Chinese medical society blood science is a group of thromboses and haemostatic science, a group of Chinese hemophilia cooperation, the Chinese expert consensus of hemophilia diagnosis and treatment (2017 edition), journal of Chinese hematology 38.5 (2017): 364-370.
[7]J M Soucie,R Nuss,B Evatt,A Abdelhak,L Cowan,H Hill,MKolakoski,N Wilber.Mortality among males with hemophilia:relations with source of medical care.The Hemophilia SurveillanceSystem Project Investigators.Blood.2000 Jul 15；96(2):437-42.
[8]J Oldenburg.Mutation profiling in haemophilia A.ThrombHaemost.2001 Apr；85(4):577-9.
[9]Liliana C Rossetti,Claudia P Radic,Miguel M Abelleyro,Irene BLarripa,Carlos D De Brasi.Eighteen years of molecular genotyping thehemophilia inversion hotspot:from southern blot to inverseshifting-PCR.Int J Mol Sci.2011；12(10):7271-85.doi:10.3390/ijms12107271.Epub 2011 Oct 24.
[10]D Lakich,H H Kazazian Jr,S E Antonarakis,J Gitschier.Inversions disrupting the factor VIII gene are a common cause ofsevere haemophilia A.Nat Genet.1993 Nov；5(3):236-41.doi:10.1038/ng1193-236.
[11]Richard D Bagnall,Naushin Waseem,Peter M Green,FrancescoGiannelli.Recurrent inversion breaking intron 1 of the factor VIII geneis a frequent cause of severe hemophilia A.Blood.2002 Jan1；99(1):168-74.doi:10.1182/blood.v99.1.168.
[12]John H McVey,Pavithra M Rallapalli,Geoffrey Kemball-Cook,Daniel J Hampshire,Muriel Giansily-Blaizot,Keith Gomez,Stephen JPerkins,Christopher A Ludlam.The European Association forHaemophilia and Allied Disorders(EAHAD)Coagulation FactorVariant Databases:Important resources for haemostasis clinicians andresearchers.Haemophilia.2020 Mar；26(2):306-313.doi:10.1111/hae.13947.Epub 2020 Mar 13.
[13]Factor VIII Variant Database.http://www.factorviii-db.org.
[14]R D Bagnall,F Giannelli,P M Green.Int22h-related inversionscausing hemophilia A:a novel insight into their origin and a new morediscriminant PCR test for their detection.J Thromb Haemost.2006Mar；4(3):591-8.doi:10.1111/j.1538-7836.2006.01840.x.
[15]R Santacroce,M Acquila,D Belvini,G Castaldo,I Garagiola,S HGiacomelli,A M Lombardi,B Minuti,F Riccardi,R Salviato,LTagliabue,E Grandone,M Margaglione；AICE-Genetics Study Group.Identification of 217 unreported mutations in the F8 gene in a group of1,410 unselected Italian patients with hemophilia A.J Hum Genet.2008；53(3):275-284.doi:10.1007/s10038-007-0238-y.Epub 2008 Jan23.
[16]Alok Srivastava.Diagnosis of haemophilia and other inheritedbleeding disorders-Is a new paradigm neededHaemophilia.2021Feb；27 Suppl 3:14-20.doi:10.1111/hae.14042.Epub 2020 Jun 14.
[17]N Lannoy,C Hermans.Review of molecular mechanisms at distalXq28 leading to balanced or unbalanced genomic rearrangements andtheir phenotypic impacts on hemophilia.Haemophilia.2018Sep；24(5):711-719.doi:10.1111/hae.13569.Epub 2018 Aug 8。

Claims (13)

1. A primer set for simultaneous amplification of multiple mutations in hemophilia a comprising one or more primers selected from the group consisting of:
1) The 22 primers used to amplify the exon of the F8 gene were as follows: E1F, E1R, E2F, E4R, E5F, E6F, E10R, E F, E R, E F, E13R, E14 4815R, E F, E R, E21F, E R, E F, E R, E26F, E R having the sequence set forth in SEQ ID NO:1-22;
2) The 5 primers used to amplify Int22 and its related variants were as follows: H1-F, H1-R, H2-F, H3-F, H2/3-R, the sequences of which are shown in SEQ ID NO:23-27;
3) The 3 primers used to amplify Int1 and its related variants were as follows: the sequences of int1F1 and int1R, inv F are respectively shown in SEQ ID NO: 28-30;
4) The 51 primers used to amplify the 200kb deletion within and upstream of the F8 gene were as follows: int1F2, int6F, int F1, int13F2, int14F1, int14F2, int14F3, int22F1, int22F2, int25F1, int25F2, GF1, GF2, GF3, GF4, GF5, GF6, GF7, GF8, GF9, GF10, GF11, GF12, GF13, GF14, GF15, GF16, GF17, GF18, GF19, GF20, GR1, GR2, GR3, GR4, GR5, GR6, GR7, GR8, GR9, GR10, GR11, GR12, GR13, GR14, GR15, GR16, GR17, GR18, GR19, GR20, having the sequence set forth in SEQ ID NO:31-81;
wherein the plurality of mutations in hemophilia a comprises one or more of:
1) SNVs and indels on the exon of the F8 gene;
2) Int22 and related inversion, deletion, and repeat variations thereof;
3) Inversion variation associated with Int 1;
4) F8 large fragment within 200kb upstream and downstream was deleted;
5) Point mutation within the primer range on F8 gene.
2. The primer set according to claim 1, comprising the following primers:
1) The 22 primers used to amplify the exon of the F8 gene were as follows: E1F, E1R, E2F, E4R, E5F, E6F, E10R, E F, E R, E F, E13R, E14 4815R, E F, E R, E21F, E R, E F, E R, E26F, E R having the sequence set forth in SEQ ID NO:1-22;
2) The 5 primers used to amplify Int22 and its related variants were as follows: H1-F, H1-R, H2-F, H3-F, H2/3-R, the sequences of which are shown in SEQ ID NO:23-27;
3) The 3 primers used to amplify Int1 and its related variants were as follows: the sequences of int1F1 and int1R, inv F are respectively shown in SEQ ID NO: 28-30;
4) The 51 primers used to amplify the 200kb deletion within and upstream of the F8 gene were as follows: int1F2, int6F, int F1, int13F2, int14F1, int14F2, int14F3, int22F1, int22F2, int25F1, int25F2, GF1, GF2, GF3, GF4, GF5, GF6, GF7, GF8, GF9, GF10, GF11, GF12, GF13, GF14, GF15, GF16, GF17, GF18, GF19, GF20, GR1, GR2, GR3, GR4, GR5, GR6, GR7, GR8, GR9, GR10, GR11, GR12, GR13, GR14, GR15, GR16, GR17, GR18, GR19, GR20, having the sequence set forth in SEQ ID NO:31-81;
wherein the plurality of mutations in hemophilia a comprises one or more of:
1) SNVs and indels on the exon of the F8 gene;
2) Int22 and related inversion, deletion, and repeat variations thereof;
3) Inversion variation associated with Int 1;
4) F8 large fragment within 200kb upstream and downstream was deleted;
5) Point mutation within the primer range on F8 gene.
3. The primer set according to claim 1 or 2, wherein the primer can be added with DNA barcodes of different sequences of 5-50nt at the 5' end for distinguishing different samples.
4. A primer set according to claims 1-3, wherein the primer is useful for detecting whether different mutations within the amplified product fragment are linked, if the mutations are located on the same chromosome, the mutations are linked; if the mutation is located on both stained alleles, the mutation is not linked.
5. Use of the primer set of any one of claims 1-4 in the manufacture of a kit for detecting a plurality of mutations in hemophilia a, wherein the plurality of mutations in hemophilia comprises one or more of:
1) SNVs and indels on the exon of the F8 gene;
2) Int22 and related inversion, deletion, and repeat variations thereof;
3) Inversion variation associated with Int 1;
4) F8 large fragment within 200kb upstream and downstream was deleted;
5) Point mutation within the primer range on F8 gene.
6. A kit of primers for detecting multiple mutations in hemophilia a comprising the following reagents:
1) Reagents for multiplex long fragment PCR amplification;
2) Reagents for constructing a long fragment sequencing library;
wherein the reagent for PCR amplification comprises the primer set of any one of claims 1 to 3;
wherein the plurality of mutations in hemophilia a comprises one or more of:
1) SNVs and indels on the exon of the F8 gene;
2) Int22 and related inversion, deletion, and repeat variations thereof;
3) Inversion variation associated with Int 1;
4) F8 large fragment within 200kb upstream and downstream was deleted;
5) Point mutation within the primer range on F8 gene.
7. The kit of claim 6, which can be used to detect whether different mutations within the same amplified fragment are linked, if they are located on the same chromosome; if the mutation is located on both stained alleles, the mutation is not linked.
8. The kit of claim 6, wherein the reagents for long fragment PCR amplification comprise a DNA polymerase, a reaction buffer, and primers.
9. The kit of claim 6, wherein the reagents for constructing a long fragment sequencing library comprise an end-repairing enzyme, a linker, a ligase, DNA purification magnetic beads, a reaction buffer, and an exonuclease.
10. The kit of claim 6, wherein the long fragment sequencing is selected from the group consisting of single molecule based real-time sequencing SMRT and Nanopore technology platforms.
11. A system for detecting multiple mutations in hemophilia a comprising the following modules:
1) And the acquisition module is used for: obtaining and preparing a subject sample;
2) Amplification module: multiplex long fragment PCR amplification is carried out on the sample;
3) Library construction module: constructing a long fragment sequencing library;
4) Sequencing module: sequencing and analyzing the mutation type of the genes;
wherein the PCR amplification in the module (2) employs the primer set of any one of claims 1 to 3;
wherein the plurality of mutations in hemophilia a comprises one or more of:
1) SNVs and indels on the exon of the F8 gene;
2) Int22 and related inversion, deletion, and repeat variations thereof;
3) Inversion variation associated with Int 1;
4) F8 large fragment within 200kb upstream and downstream was deleted;
5) Point mutation within the primer range on F8 gene.
12. The system of claim 11, which can be used to detect if different mutations within the same amplified fragment are linked, if the mutations are located on the same chromosome; if the mutation is located on both stained alleles, the mutation is not linked.
13. The system of claim 11, wherein the long fragment sequencing is selected from the group consisting of single molecule real-time sequencing based SMRT and Nanopore technology platforms.
CN202310224086.5A 2023-03-09 2023-03-09 Primer group, kit and system for detecting various mutations in hemophilia a Active CN116445603B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310224086.5A CN116445603B (en) 2023-03-09 2023-03-09 Primer group, kit and system for detecting various mutations in hemophilia a

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310224086.5A CN116445603B (en) 2023-03-09 2023-03-09 Primer group, kit and system for detecting various mutations in hemophilia a

Publications (2)

Publication Number Publication Date
CN116445603A true CN116445603A (en) 2023-07-18
CN116445603B CN116445603B (en) 2024-01-26

Family

ID=87131024

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310224086.5A Active CN116445603B (en) 2023-03-09 2023-03-09 Primer group, kit and system for detecting various mutations in hemophilia a

Country Status (1)

Country Link
CN (1) CN116445603B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117625778A (en) * 2024-01-24 2024-03-01 山东大学 Method, primer and kit for detecting multiple mutations of IKBKG gene of pigment incontinence disease

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103820539A (en) * 2013-09-30 2014-05-28 长沙艾迪康医学检验所有限公司 Primers, method and kit for detecting inversion of first intron of hemophilia A clotting factor VIII gene
CN105603100A (en) * 2016-03-03 2016-05-25 南京市妇幼保健院 Amplification primers, kit and method for detecting F8 gene mutation
CN105671154A (en) * 2016-02-22 2016-06-15 亚能生物技术（深圳）有限公司 Heavy hemophilia A FVIII gene intron 22 recombination gene type detection kit
CN114317728A (en) * 2022-03-11 2022-04-12 北京贝瑞和康生物技术有限公司 Primer group, kit, method and system for detecting multiple mutations in SMA

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103820539A (en) * 2013-09-30 2014-05-28 长沙艾迪康医学检验所有限公司 Primers, method and kit for detecting inversion of first intron of hemophilia A clotting factor VIII gene
CN105671154A (en) * 2016-02-22 2016-06-15 亚能生物技术（深圳）有限公司 Heavy hemophilia A FVIII gene intron 22 recombination gene type detection kit
CN105603100A (en) * 2016-03-03 2016-05-25 南京市妇幼保健院 Amplification primers, kit and method for detecting F8 gene mutation
CN114317728A (en) * 2022-03-11 2022-04-12 北京贝瑞和康生物技术有限公司 Primer group, kit, method and system for detecting multiple mutations in SMA

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
NICOLAS CHATRON等: "Severe hemophilia A caused by an unbalanced chromosomal rearrangement identified using nanopore sequencing", J THROMB HAEMOST, vol. 17, no. 7, pages 1097 - 1103 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117625778A (en) * 2024-01-24 2024-03-01 山东大学 Method, primer and kit for detecting multiple mutations of IKBKG gene of pigment incontinence disease
CN117625778B (en) * 2024-01-24 2024-04-30 山东大学 Method, primer and kit for detecting multiple mutations of IKBKG genes of pigment incontinence disease

Also Published As

Publication number Publication date
CN116445603B (en) 2024-01-26

Similar Documents

Publication Publication Date Title
CN113564247B (en) Primer group and kit for simultaneously detecting multiple mutations of 9 genes related to congenital adrenal cortical hyperplasia
CN116445603B (en) Primer group, kit and system for detecting various mutations in hemophilia a
CN107236037B (en) Mutant MSH6 protein, and coding gene and application thereof
Conlin et al. Long‐read sequencing for molecular diagnostics in constitutional genetic disorders
Cooper et al. Quality in molecular biology testing for inherited thrombophilia disorders
Norris et al. High-throughput STELA provides a rapid test for the diagnosis of telomere biology disorders
Jin et al. Identification of novel deep intronic PAH gene variants in patients diagnosed with phenylketonuria
Sutherland et al. The mutation spectrum associated with type 3 von Willebrand disease in a cohort of patients from the north west of England
CN112442530B (en) Method for detecting CAH related true and false gene
Aspesi et al. A functional assay for the clinical annotation of genetic variants of uncertain significance in Diamond–Blackfan anemia
CN117248030A (en) PKD1 variant molecule detection method based on single-cell whole genome amplification and application thereof
CN116121360A (en) Kit for detecting DBA pathogenic gene set and detection method
EP3474168B1 (en) Method for measuring mutation rate
Li et al. Accurate genotype diagnosis of Hong Kongαα thalassemia based on third-generation sequencing
Manderstedt et al. Detection of mosaics in hemophilia A by deep Ion Torrent sequencing and droplet digital PCR
Bladbjerg et al. Internal quality control of PCR-based genotyping methods in research studies and patient diagnostics
EP4041921A1 (en) Use of simultaneous marker detection for assessing difuse glioma and responsiveness to treatment
Shoukier et al. Characterization of five novel large deletions causing hereditary haemorrhagic telangiectasia
CN116732168B (en) Method and kit for detecting multiple mutations of autosomal dominant polycystic kidney
CN117487907B (en) KCNH2 gene mutant, mutant protein, reagent, kit and application
James et al. Molecular diagnostic approaches to hemostasis
CN115948541A (en) Primer composition for detecting CDA gene and application thereof
US11060146B2 (en) Method and kit for identifying gene mutations
CN117327781A (en) Nucleic acid product for detecting F8 gene inversion and application thereof
Xu et al. Comparison of Third-Generation Sequencing and Routine Polymerase Chain Reaction in Genetic Analysis of Thalassemia

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
REG Reference to a national code

Ref country code: HK

Ref legal event code: DE

Ref document number: 40099364

Country of ref document: HK