CN114317728A - Primer group, kit, method and system for detecting multiple mutations in SMA - Google Patents

Abstract

The invention relates to a primer group, a kit, a method and a system for detecting multiple mutations in SMA, wherein the method for detecting the mutation of the SMA disease-related gene comprises the following steps: (1) providing a subject genomic DNA sample; (2) amplifying the SMN gene in the genomic DNA sample by PCR with a primer set; (3) constructing a third generation sequencing library; and (4) carrying out third-generation sequencing and analyzing the gene mutation type.

Description

Primer group, kit, method and system for detecting multiple mutations in SMA

Technical Field

The invention relates to the technical field of gene detection, in particular to a primer group, a kit, a method and a system for detecting multiple mutations in SMA.

Background

Spinal Muscular Atrophy (SMA) is a group consisting of chromosome 5q13SMN1Autosomal recessive genetic disease caused by homozygous deletion of gene¹. The clinical manifestations are progressive muscle weakness and atrophy with spinal cord degeneration, which in the most severe patients, leads to lower motor neuron damage. SMA is one of the major genetic causes of infant death, found in almost all populations; according to statistics, the incidence rate of SMA is 4.1 in 6000-11000 live-delivery infants, and the incidence rate of I-type SMA is 4.1 in 10 ten thousand live-delivery infants. In the general populationSMN1The frequency of mutations carried is 2% to 3% (one in 40)^{2, 3}. Despite the high population carry frequency, SMA incidence is lower than expected. This may reflect that some fetuses have 0/0SMN1/SMN2Genotype (i.e., absence of SMN protein at all), leading to embryonic death⁴。

The natural course and examination of SMA depends on phenotypic variation and is clinically classified as "type" of SMA. Of all SMA types, five types of SMA are summarized below: SMA type 0 occurs in the neonatal period, with death usually occurring at or within the first month after birth; type I SMA is characterized by severe general muscle weakness and hypotonia at birth or within the first three months. Death from respiratory failure usually occurs within the first two years; SMA type II children are able to sit, but they are unable to stand or walk on their own and can usually survive for more than four years; type III SMA is a mild form, with onset in infancy or adolescence, and patients with type III SMA learn to walk independently and have a longer survival rate; type IV SMA, the patient presents in adulthood and is the mildest phenotype of SMA¹。

Surviving motor neurons(SMN)The gene contains nine exons, is about 28kb in length, and has two almost identical exons on 5q13SMNGene:SMN1genes andSMN2a gene. Due to the fact thatSMN2The generation of a critical single nucleotide mutation in exon 7 of (A) to (B)SMN2Function of Gene GenerationLess SMN protein, onlySMN110 to 15 percent of⁵. About 95% of SMA patients haveSMN1Homozygous deletion of the gene, and 5% with compound heterozygous mutation. Most SMA patient presents with involvementSMN1Homozygous deletion of exon 7 of the gene and dependence on the residueSMN2Functional SMN proteins are produced. Therefore, the temperature of the molten metal is controlled,SMN2there is a positive correlation between copy number and phenotypic severity, with most critically ill type I patients having one or two copies of SMN 2; most type II patients have 3 copies of SMN 2; and most type III patients have 3 or 4 copies of SMN 2. In the normal populationSMN2The copy number of (A) varies from zero to three, with about 10% -15% of the population lacking SMN2⁶。

At present, the most commonly used method for molecular detection of SMA is to detect deletion or copy number variation of a large fragment by MLPA or qPCR (quantitative polymerase chain reaction), and combines Sanger sequencing specificity detectionSMN1Point mutations in genes⁷. However, MLPA can only be detected on the basis of gene copy numberSMN1Is missing, cannot detectSMN1Point mutation of (2). About 5% of SMA patients carry a point mutationSMN1A copy of (c). Therefore, some SMA patients are inevitably misdiagnosed as carriers⁸. In addition, MLPA and qPCR cannot be identifiedSMN1(2+0) silencing the carrier, causing false negative false positive⁹. And because ofSMN1AndSMN2is a high degree of homology of (A) to (B),SMN2will also existSMN1The characteristic sequences can also interfere with the specificity of PCR amplification primers and sequencing primers in Sanger sequencing, and can cause missed diagnosis and misdiagnosis in actual detection. At the same time, conventional diagnostic methods do not distinguish betweenSMN1Is absent andSMN1whether or not to cooperate withSMN2Homologous recombination occurs.

Next-generation sequencing (NGS) requires pairingSMN1AndSMN2construction of NGS sequencing libraries separately for specific detectionSMN1Genes orSMN2The point mutation of (2) is not compatible with other gene detection, and the process is relatively complicated¹⁰. The study published at presentSMNMethods for gene integrity include Whole Genome Sequencing (WGS) and multiple direct genome selection (MDiGS) sequencing. WGS is a relatively expensive and laborious technique, often requiring complex birthAnd (4) performing physical informatics analysis. In MDiGS, the entire DNA is prepared in a library, and the experimental procedure is also rather complicated^{11, 12}。

Current methods based on qPCR, MLPA, Sanger sequencing or second generation sequencing can be implementedSMN1AndSMN2the detection of gene copy number and point mutation of a detection part, but the detection mainly has the following limitations:

1. cannot realize simultaneous detection in the same systemSMN1AndSMN2detecting all point mutation types and copy number variations of the gene;

2. due to the fact thatSMN1AndSMN2the possibility of multiple recombination exists between the primers, the combination of MLPA probes and the design of Sanger sequencing primers are influenced, and the missed detection and the false detection are caused to a certain extent;

3. is unable to detectSMN1AndSMN2the gene is full-length and cannot detect the exon 1 under the influence of the detection range;

4. when two or more mutations exist on the same gene locus at the same time, the existing method can not distinguish cis-mutation or trans-mutation and whether the mutation has a linkage effect;

5. can not be aligned withSMN1(2+0) -type silent carriers were tested.

Incomplete coverage of SMA pathogenic genes at the present stage,SMN1AndSMN2the problems of missed detection and false detection in clinic can be caused by difficult copy number detection, incapability of determining whether the mutation is linked and the like.

Therefore, it is highly desirable to find a new method for detecting multiple mutations of 2 SMA-associated pathogenic genes in multiple samples with high specificity, accuracy and rapidity.

Disclosure of Invention

The method for detecting multiple mutations of 2 pathogenic genes related to SMA based on the design of a primer group, long-fragment PCR amplification and third-generation sequencing can realize simple and convenient operation of the method, reliable quality and strong repeatability of the long-fragment PCR and third-generation library, is favorable for the application of the third-generation sequencing technology in clinical detection, and further solves the problems.

According to a first aspect of the present application, there is provided a method for amplificationSMNA primer set for a gene, wherein the primer set comprises the following primers:

SMN-FL-F and SMN-FL-R; and

SMN-DOWN-F and SMN-DOWN-R;

wherein the SMN-FL-F in the primer group is positioned inSMN1AndSMN2homologous region upstream of the gene, SMN-FL-R being locatedSMN1AndSMN2homologous region downstream of exon 7 c.840, SMN-FL-F and SMN-FL-R amplified length not more than 35 kb; SMN-DOWN-F is located atSMN1AndSMN2c.840, SMN-DOWN-R in the region of homology upstream of exon 7SMN1AndSMN2the amplified length of the homologous regions downstream of the gene, SMN-DOWN-F and SMN-FL-R, is no more than 35 kb.

In one embodiment, the amplification products of the primer set are used to construct a third generation sequencing library and are simultaneously detected by third generation sequencingSMN1AndSMN2copy number and point mutation of (a), andSMN1(2+0) Silent Carrier, in which the point mutations comprise at least the ones shown in Table 1SMN1190 point mutations in the gene.

In one embodiment, the amplification products of the primer set are used to construct a third generation sequencing library, and the amplification products are tested for linkage of different mutations within the same amplified fragment by third generation sequencing.

In one embodiment, the primer can be added with 5-50nt of DNA with different sequences at the 5' end, i.e., DNA barcodes, to distinguish different samples.

In one embodiment, the primer SMN-FL-F is selected from the group consisting of SEQ ID NOs: 1-4, SMN-FL-R is selected from SEQ ID NOs: 5-8, SMN-DOWN-F is selected from the group consisting of SEQ ID NOs: 9-12, SMN-DOWN-R is selected from the group consisting of SEQ ID NOs: 13-16.

In one embodiment, the third generation sequencing is selected from PacBio sequencing by Pacific Biosciences, Inc., or Nanopore sequencing by Oxford Nanopore Technologies (ONT).

According to a second aspect of the present application, there is provided a kit comprising a DNA polymerase, a reaction buffer and a primer set according to the first aspect described above.

According to a third aspect of the present application, there is provided an apparatus for detecting a mutation in a SMA disease-associated gene, comprising:

the method according to the second aspect of the present application for amplificationSMNA kit of genes; and

a kit for constructing a third generation sequencing library.

In one embodiment, the kit for constructing the third generation sequencing library comprises an end repair enzyme, a linker, a ligase, a DNA purification magnetic bead, a reaction buffer and an exonuclease.

According to a fourth aspect of the present application, there is provided a method for detecting a mutation in a SMA disease associated gene, comprising the steps of:

(1) providing a subject genomic DNA sample;

(2) amplifying the genomic DNA sample by PCR with the primer set according to the first aspect of the present applicationSMNA gene;

(3) constructing a third generation sequencing library; and

(4) and (4) carrying out third-generation sequencing and analyzing the gene mutation type.

In one embodiment, the third generation sequencing is selected from PacBio sequencing by Pacific Biosciences, Inc., or Nanopore sequencing by Oxford Nanopore Technologies (ONT).

In one embodiment, after three generations of sequencing and analysis of the type of gene mutation, mutations in the SMA disease-associated genes that can be simultaneously detected includeSMN1AndSMN2copy number and point mutation of (a), andSMN1(2+0) Silent Carrier, in which the point mutations comprise at least the ones shown in Table 1SMN1190 point mutations in the gene.

According to a fifth aspect of the present application, there is provided a system for detecting SMA disease associated gene mutation, comprising the following modules:

(1) an acquisition module for providing a subject genomic DNA sample;

(2) an amplification module for amplifying by PCR in the genomic DNA sample with the primer set according to the first aspect of the applicationSMNA gene, whereinSMNThe gene includesSMN1，SMN2AndSMN1andSMN2the fusion gene of (4);

(3) a library construction module for constructing a third generation sequencing library;

(4) and the sequencing analysis module is used for third generation sequencing and analyzing the gene mutation types.

In one embodiment, the amplification module comprises a kit according to the second aspect of the present application.

In one embodiment, the library construction template comprises reagents for constructing a third generation sequencing library, the reagents for constructing a third generation sequencing library comprising a linker, a ligase, a DNA purification magnetic bead, a reaction buffer, and an exonuclease.

In one embodiment, the third generation sequencing is selected from PacBio sequencing by Pacific Biosciences, Inc., or Nanopore sequencing by Oxford Nanopore Technologies (ONT).

In one embodiment, after three generations of sequencing and analysis of the types of gene mutations performed by the sequencing analysis module, SMA disease-associated gene mutations that can be simultaneously detected includeSMN1AndSMN2copy number and point mutation of (a), andSMN1(2+0) Silent Carrier, in which the point mutations comprise at least the ones shown in Table 1SMN1190 point mutations on the gene and whether there is linkage between different mutations therein.

According to a sixth aspect of the present application, there is provided a use of the primer set of the first aspect of the present application in the preparation of a kit for detecting mutations in SMA disease associated genes.

In one embodiment, the method for detecting SMA disease associated gene mutation comprises the steps of:

(1) providing a subject genomic DNA sample;

(2) amplifying the genomic DNA sample by PCR with the primer set according to the first aspect of the present applicationSMNA gene;

(3) constructing a third generation sequencing library; and

(4) and (4) carrying out third-generation sequencing and analyzing the gene mutation type.

Drawings

FIG. 1 is a schematic diagram of the design of primers for detecting 4 fragments of 2 SMA-associated genes.

FIGS. 2a-2b are DNA gel electrophoresis of gene fragments amplified by long-fragment PCR, wherein FIG. 2a is DNA gel electrophoresis of SMN1/SMN2 amplified by long-fragment PCR, and FIG. 2b is DNA gel electrophoresis of gene fragments amplified by long-fragment PCRSMN1 Down/SMN2DNA gel electrophoresis of Down.

FIGS. 3a-3f are graphs showing the sequencing results of representative SMA-associated gene mutation samples PacBio, wherein FIG. 3a is a normal human sample: (SMN1Two copies-SMN2-two copies) sequencing result map; FIG. 3b is a graph showing the sequencing results of the SMA carrier sample (SMN 1-one copy/SMN 2-three copies); FIG. 3c is a graph showing the sequencing results of an SMA patient sample (SMN 1-zero copy/SMN 2-two copies); FIG. 3d is a graph showing the sequencing results of SMA (2+0) silencing carrier samples (SMN 1/SMN1-SMN2 fusion gene/SMN 2); FIG. 3e shows a sample of SMN2-SMN1 fusion gene carriers (SMN1/SMN2-SMN1Fusion gene-SMN2/SMN2) A sequencing result graph; FIG. 3f is a diagram of the sequencing result of SMN1 point mutation sample.

Detailed Description

Embodiments of the present application will be described in more detail below. However, it should be understood that the present application may be embodied in various forms and should not be construed as limited to the embodiments set forth herein, but rather these embodiments are provided for a more thorough and complete understanding of the present application. It should also be understood that the drawings and embodiments of the present application are for illustration purposes only and are not intended to limit the scope of the present application.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. In case of conflict, the present specification, including definitions, will control.

The terms "comprises," "comprising," "includes," "including," "has," "having," "contains," "containing," or any other variation thereof, as used herein, are intended to cover a non-exclusive inclusion.

When an amount, concentration, or other value or parameter is expressed as a range, preferred range, or as a range of values bounded by upper preferable values and lower preferable values, this is to be understood as specifically disclosing all ranges formed from any pair of any upper range limit or preferred value and any lower range limit or preferred value, regardless of whether ranges are separately disclosed. For example, when a range of "1 to 5" is disclosed, the described range should be interpreted to include the ranges "1 to 4," "1 to 3," "1-2 and 4-5," "1-3 and 5," and the like. When a range of values is described herein, unless otherwise stated, the range is intended to include the endpoints thereof and all integers and fractions within the range.

In addition, the indefinite articles "a" and "an" preceding an element or component herein do not limit the quantitative requirement (i.e., the number of occurrences) of the element or component. Thus, "a" or "an" should be read to include one or at least one, and the singular form of an element or component also includes the plural unless the stated number is explicitly intended to limit the singular form.

Further, in the following description, reference will be made to a number of expressions which are defined to have the following meanings.

"SMN-FL" refers to a nucleic acid molecule for amplificationSMNPrimers for full-length fragment, wherein "SMN-FL-F" refers to forward primer and "SMN-FL-R" refers to reverse primer.

"SMN-DOWN" refers to a method for amplificationSMNAnd (3) a primer of a downstream gene segment, wherein the 'SMN-DOWN-F' refers to a forward primer, and the 'SMN-DOWN-R' refers to a reverse primer.

"sequencing" refers to the determination of the sequence of a gene.

"third generation sequencing" refers to "single molecule sequencing technology". When DNA sequencing is carried out, PCR amplification is not needed, and each DNA molecule is independently sequenced. Third generation sequencing techniques are also called de novo sequencing techniques, i.e., single molecule real-time DNA sequencing.

As described above, there is a lack in the prior art of methods that can be used to achieve the simultaneous detection of multiple mutations of 2 pathogenic genes associated with SMA in multiple samples with high specificity, accuracy and speed.

In view of this, the invention provides a method for detecting multiple mutations of 2 SMA-related genes based on long-fragment PCR amplification and third-generation sequencing. The long fragment PCR amplification is realized in two reaction tubesRespectively amplifying 4 segments of 2 genes related to SMA (SMN1, SMN2, SMN1 Down, SMN2 Down) The point mutation, the structural variation and the copy number mutation are combined with the characteristics of reading length and measuring length of a third generation sequencing platform for reading length and measuring length and the like, so that the SMA related gene mutation can be accurately, quickly and high-flux detected. The method provided by the invention is simple and convenient to operate, the long fragment PCR and the third-generation library have reliable quality and strong repeatability, and the application of the third-generation sequencing technology to clinical detection is facilitated.

The invention aims to solve the problems of incomplete SMA pathogenic gene coverage at the present stage,SMN1AndSMN2the problems of missed detection and false detection in clinic can be caused by difficult copy number detection, incapability of determining whether the mutation is linked and the like. The target of comprehensively, accurately and quickly detecting multiple mutations of SMA genes of multiple samples is realized by simultaneously amplifying 4 segments of 2 pathogenic genes related to SMA through long-segment PCR and preparing a third-generation sequencing library.

Primer set

To at least partially address one or more of the above issues and other potential issues, a first exemplary embodiment of the present application proposes a method for amplificationSMNA primer set for a gene, wherein the primer set comprises the following primers:

SMN-FL-F and SMN-FL-R; and

SMN-DOWN-F and SMN-DOWN-R;

wherein the SMN-FL-F in the primer group is positioned inSMN1AndSMN2homologous region upstream of the gene, SMN-FL-R being locatedSMN1AndSMN2homologous region downstream of exon 7 c.840, SMN-FL-F and SMN-FL-R amplified length not more than 35 kb; SMN-DOWN-F is located atSMN1AndSMN2c.840, SMN-DOWN-R in the region of homology upstream of exon 7SMN1AndSMN2the amplified length of the homologous regions downstream of the gene, SMN-DOWN-F and SMN-FL-R, is no more than 35 kb.

As for the "primer set", the design concept thereof can be referred to FIG. 1. Wherein the primers contained in the primer set can amplify all sequences in the primer range on the genome, including any type of mutant sequence in the primer range. Preferably, the amplification product of each primer is about 28 Kb. PreferablyIf the primer has a SNP, a degenerate base primer is used. Further, the amplification products of the primer group are used for constructing a third-generation sequencing library and are simultaneously detected through third-generation sequencingSMN1AndSMN2copy number and point mutation of (a), andSMN1(2+0) Silent Carrier, in which the point mutation comprises at least one of the following Table 1SMN1190 point mutations in the gene. Among these, point mutations and structural variations at the genetic loci described herein can be queried in LOVD, ClinVar, and references.

Preferably, the primer sets can be detected simultaneouslySMN1、SMN2AndSMN1-SMN2the fusion gene of (A),SMN2- SMN1Copy number of the fusion gene of (1), andSMN1(2+0) silencing the carrier for prompting.

TABLE 1

In addition, the amplification products of the primer group can be used for constructing a third-generation sequencing library, and whether different mutations in the same amplification fragment in the amplification products are linked or not can be detected through third-generation sequencing. Preferably, the primer can be added with 5-50nt of DNA with different sequences at the 5' end, i.e., DNA barcode, to distinguish different samples. Preferably, the 5' end Barcode of the F and R primers may be the same or different, and may be selected by those skilled in the art as desired.

Preferably, the primer group is used for 2-system long fragment PCR amplification of 4 fragments of 2 genes; it can also be used to detect whether different mutations within a single amplified gene fragment are linked.

Preferably, the primer set can be used for long-fragment PCR amplification of the SMA-related pathogenic gene fragment including mutation types in all primer ranges in 2 individual lines. In combination with subsequent PacBio or Nanopore sequencing platforms, the mutation patterns of all gene fragments within the primer range can be detected.

As regards the "primer SMN-FL-F", it is preferably chosen from the group consisting of SEQ ID NOs: 1-4.

As regards the "primer SMN-FL-R", it is preferably chosen from the group consisting of SEQ ID NOs: 5-8.

With respect to "SMN-DOWN-F", it is preferably selected from the group consisting of SEQ ID NOs: 9-12.

With respect to "SMN-DOWN-R", it is preferably selected from the group consisting of SEQ ID NOs: 13-16.

With respect to SEQ ID NOs: 1-16, see table 2 below:

as regards "third generation sequencing", it may be chosen from PacBio sequencing by Pacific Biosciences or Nanopore sequencing by Oxford Nanopore Technologies (ONT).

Preferably, PacBio library adaptor ligation can be performed using blunt-end ligation or TA ligation.

Typically, the PacBio universal blunt-end linker sequence is 5 '-pATCTCTCTCTTTTCCTCCCTCCGTCTGTTGTTGTTGAGAGAGAT-3', and blunt-end stemcyclic structure linker aptamers are formed by annealing. Different linker aptamers with Barcode can be formed by adding DNA (Barcode) with 5-50nt different sequences to the stem. The PacBio libraries with different barcodes can be sequenced mixed together.

Typically, the PacBio universal TA linker sequence is 5 '-pattctctctctcttcctcctcctcctccgttgttgttgttgagagagagatt-3', which is annealed to form a blunt-ended stem-loop structure linker aptamer. Different linker aptamers with Barcode can be formed by adding DNA (Barcode) with 5-50nt different sequences to the stem. The PacBio libraries with different barcodes can be sequenced mixed together.

The PacBio linker may or may not be Barcode. Preferably, the PacBio linker is a Barcode designed by PacBio corporation or a Barcode designed by itself, which can be selected by those skilled in the art as desired. Preferably, the PacBio library is matched to the Pacific Biosciences sequencing platform.

With respect to "Nanopore sequencing", typically, reagents used to construct a three-generation Nanopore library include end-repair enzymes, linkers, ligases, DNA purification magnetic beads, 80% ethanol, and reaction buffers. The Nanopore library adaptor ligation may be performed using blunt end ligation or TA ligation. The Nanopore linker may or may not be Barcode. Preferably, the Nanopore linker is either Barcode, available from ONT corporation, or Barcode, available from self-designed sources, and can be selected by those skilled in the art as desired. Preferably, the Nanopore library is matched to the ONT corporation sequencing platform.

Reagent kit

In order to at least partially solve one or more of the above problems and other potential problems, a second exemplary embodiment of the present application proposes a kit for amplifying an SMN gene, which includes a DNA polymerase, a reaction buffer, and a primer set according to the first exemplary embodiment of the present application.

Device for measuring the position of a moving object

To address at least in part one or more of the above problems, and other potential problems, a third exemplary embodiment of the present application provides an apparatus for detecting mutations in SMA disease-associated genes, comprising:

amplification according to the second exemplary embodiment of the present applicationSMNA kit of genes;and

a kit for constructing a third generation sequencing library.

With regard to "a kit for constructing a three-generation sequencing library", it typically includes a terminal repair enzyme, a linker, a ligase, a DNA purification magnetic bead, a reaction buffer, and an exonuclease.

As "third generation sequencing", it is selected from PacBio sequencing by Pacific Biosciences or Nanopore sequencing by ONT.

Preferably, PacBio library adaptor ligation can be performed using blunt-end ligation or TA ligation.

Typically, the PacBio universal blunt-end linker sequence is 5 '-pATCTCTCTCTTTTCCTCCCTCCGTCTGTTGTTGTTGAGAGAGAT-3', and blunt-end stemcyclic structure linker aptamers are formed by annealing. Different linker aptamers with Barcode can be formed by adding DNA (Barcode) with 5-50nt different sequences to the stem. The PacBio libraries with different barcodes can be sequenced mixed together.

Typically, the PacBio universal TA linker sequence is 5 '-pattctctctctcttcctcctcctcctccgttgttgttgttgagagagagatt-3', which is annealed to form a blunt-ended stem-loop structure linker aptamer. Different linker aptamers with Barcode can be formed by adding DNA (Barcode) with 5-50nt different sequences to the stem. The PacBio libraries with different barcodes can be sequenced mixed together.

The PacBio linker may or may not be Barcode. Preferably, the PacBio linker is a Barcode designed by PacBio corporation or a Barcode designed by itself, which can be selected by those skilled in the art as desired. Preferably, the PacBio library is matched to the Pacific Biosciences sequencing platform.

With respect to "Nanopore sequencing", typically, reagents used to construct a three-generation Nanopore library include end-repair enzymes, linkers, ligases, DNA purification magnetic beads, 80% ethanol, and reaction buffers. The Nanopore library adaptor ligation may be performed using blunt end ligation or TA ligation. The Nanopore linker may or may not be Barcode. Preferably, the Nanopore linker is either Barcode, available from ONT corporation, or Barcode, available from self-designed sources, and can be selected by those skilled in the art as desired. Preferably, the Nanopore library is matched to the ONT corporation sequencing platform.

Detection method

To address at least in part one or more of the above problems, and other potential problems, a fourth exemplary embodiment of the present application provides a method for detecting mutations in SMA disease-associated genes, comprising the steps of:

(1) providing a subject genomic DNA sample;

(2) amplifying the genomic DNA sample by PCR with the primer set according to the first exemplary embodiment of the present applicationSMNA gene;

(3) constructing a third generation sequencing library; and

(4) and (4) carrying out third-generation sequencing and analyzing the gene mutation type.

As regards the "third generation sequencing" in the above detection method, it is chosen from PacBio sequencing by Pacific Biosciences or Nanopore sequencing by Oxford Nanopore Technologies (ONT).

Preferably, PacBio library adaptor ligation can be performed using blunt-end ligation or TA ligation.

Typically, the PacBio universal blunt-end linker sequence is 5 '-pATCTCTCTCTTTTCCTCCCTCCGTCTGTTGTTGTTGAGAGAGAT-3', and blunt-end stemcyclic structure linker aptamers are formed by annealing. Different linker aptamers with Barcode can be formed by adding DNA (Barcode) with 5-50nt different sequences to the stem. The PacBio libraries with different barcodes can be sequenced mixed together.

Typically, the PacBio universal TA linker sequence is 5 '-pattctctctctcttcctcctcctcctccgttgttgttgttgagagagagatt-3', which is annealed to form a blunt-ended stem-loop structure linker aptamer. Different linker aptamers with Barcode can be formed by adding DNA (Barcode) with 5-50nt different sequences to the stem. The PacBio libraries with different barcodes can be sequenced mixed together.

The PacBio linker may or may not be Barcode. Preferably, the PacBio linker is a Barcode designed by PacBio corporation or a Barcode designed by itself, which can be selected by those skilled in the art as desired. Preferably, the PacBio library is matched to the Pacific Biosciences sequencing platform.

With respect to "Nanopore sequencing", typically, reagents used to construct a three-generation Nanopore library include end-repair enzymes, linkers, ligases, DNA purification magnetic beads, 80% ethanol, and reaction buffers. The Nanopore library adaptor ligation may be performed using blunt end ligation or TA ligation. The Nanopore linker may or may not be Barcode. Preferably, the Nanopore linker is either Barcode, available from ONT corporation, or Barcode, available from self-designed sources, and can be selected by those skilled in the art as desired. Preferably, the Nanopore library is matched to the ONT corporation sequencing platform.

As for the above detection method, after the third generation sequencing and the analysis of the gene mutation type, the SMA disease-related gene mutation which can be simultaneously detected comprisesSMN1AndSMN2copy number and point mutation of (a), andSMN1(2+0) Silent Carrier, in which the point mutation comprises at least one of the mutations shown in Table 1 aboveSMN1190 point mutations in the gene.

Preferably, in the detection method, the long-fragment PCR amplification is performed in two reaction tubes.

By "DNA sample" it is selected from a biological sample or gDNA extracted from a sample. Typically, it is selected from at least one of the following groups: cultured cell lines, blood, amniotic fluid, villi, gametes, blastocytes, joint fluid, urine, sweat, saliva, stool, cerebrospinal fluid, ascites, pleural fluid, bile, or pancreatic fluid.

The method based on the specific combination of long-fragment PCR amplification and third-generation high-throughput sequencing can be used for detecting multiple mutations of 2 pathogenic genes related to SMA of multiple samples at the same time with high specificity, accuracy and rapidness.

Detection system

To address at least in part one or more of the above problems, and other potential problems, a fifth exemplary embodiment of the present application provides a system for detecting mutations in SMA disease-associated genes, comprising the following modules:

(1) an acquisition module for providing a subject genomic DNA sample;

(2) an amplification module for amplifying in the genomic DNA sample by PCR with a primer set according to the first exemplary embodiment of the present applicationSMNA gene, whereinSMNThe gene includesSMN1，SMN2AndSMN1andSMN2the fusion gene of (4);

(3) a library construction module for constructing a third generation sequencing library;

(4) and the sequencing analysis module is used for third generation sequencing and analyzing the gene mutation types.

With respect to the "amplification module", it includes the kit according to the second exemplary embodiment of the present application.

With respect to the "library construction module", it includes reagents for constructing a third generation sequencing library including linkers, ligases, DNA purification beads, reaction buffers and exonucleases.

Regarding "third generation sequencing" in the detection system, it is selected from PacBio sequencing by Pacific Biosciences, Inc. or Nanopore sequencing by Oxford Nanopore Technologies (ONT).

Preferably, PacBio library adaptor ligation can be performed using blunt-end ligation or TA ligation.

Typically, the PacBio universal blunt-end linker sequence is 5 '-pATCTCTCTCTTTTCCTCCCTCCGTCTGTTGTTGTTGAGAGAGAT-3', and blunt-end stemcyclic structure linker aptamers are formed by annealing. Different linker aptamers with Barcode can be formed by adding DNA (Barcode) with 5-50nt different sequences to the stem. The PacBio libraries with different barcodes can be sequenced mixed together.

Typically, the PacBio universal TA linker sequence is 5 '-pattctctctctcttcctcctcctcctccgttgttgttgttgagagagagatt-3', which is annealed to form a blunt-ended stem-loop structure linker aptamer. Different linker aptamers with Barcode can be formed by adding DNA (Barcode) with 5-50nt different sequences to the stem. The PacBio libraries with different barcodes can be sequenced mixed together.

The PacBio linker may or may not be Barcode. Preferably, the PacBio linker is a Barcode designed by PacBio corporation or a Barcode designed by itself, which can be selected by those skilled in the art as desired. Preferably, the PacBio library is matched to the Pacific Biosciences sequencing platform.

With respect to "Nanopore sequencing", typically, reagents used to construct a three-generation Nanopore library include end-repair enzymes, linkers, ligases, DNA purification magnetic beads, 80% ethanol, and reaction buffers. The Nanopore library adaptor ligation may be performed using blunt end ligation or TA ligation. The Nanopore linker may or may not be Barcode. Preferably, the Nanopore linker is either Barcode, available from ONT corporation, or Barcode, available from self-designed sources, and can be selected by those skilled in the art as desired. Preferably, the Nanopore library is matched to the ONT corporation sequencing platform.

As for the detection system, after the third generation sequencing is carried out by a sequencing analysis module and the types of the gene mutations are analyzed, the SMA disease related gene mutations which can be simultaneously detected compriseSMN1AndSMN2copy number and point mutation of (a), andSMN1(2+0) Silent Carrier, in which the point mutation comprises at least one of the mutations shown in Table 1 aboveSMN1190 point mutations on the gene and whether there is linkage between different mutations therein.

By "DNA sample" it is selected from a biological sample or gDNA extracted from a sample. Typically, it is selected from at least one of the following groups: cultured cell lines, blood, amniotic fluid, villi, gametes, blastocytes, joint fluid, urine, sweat, saliva, stool, cerebrospinal fluid, ascites, pleural fluid, bile, or pancreatic fluid.

Use of

In order to at least partially solve one or more of the above problems and other potential problems, a sixth exemplary embodiment of the present application proposes the use of the primer set according to the first exemplary embodiment of the present application in the preparation of a kit for detecting mutations in SMA disease-associated genes.

With respect to "the method for detecting SMA disease associated gene mutation", it comprises the steps of:

(1) providing a subject genomic DNA sample;

(2) with the first example according to the present applicationEmbodiment of the primer set for amplifying the genomic DNA sample by PCRSMNA gene;

(3) constructing a third generation sequencing library; and

(4) and (4) carrying out third-generation sequencing and analyzing the gene mutation type.

PREFERRED EMBODIMENTS

The following detailed description of the preferred embodiments of the present invention, taken in conjunction with the accompanying drawings, is intended to be illustrative, and not restrictive, and it is intended that all such modifications and equivalents be included within the scope of the present invention.

Example 1: amplification of SMA-associated Gene mutations Using the Long fragment PCR method of the invention

Reaction systems were prepared to amplify peripheral blood, dried blood spots and genomic DNA samples according to tables 3 and 4 below:

table 3:

table 4:

on a PCR instrument, pre-amplification was performed under the conditions shown in Table 4 below:

table 5:

after amplification, 5 ul of each sample was taken and tested on 1% DNA gel, and the results are shown in FIGS. 2a-2b, and different samples were used as templates, and SMA-related genes were efficiently amplified.

Example 2: construction of PacBio sequencing library Using Long fragment PCR method of the invention

Step 1: long fragment PCR amplification

Reaction systems were prepared to amplify peripheral blood samples of different types of SMA-related gene mutations according to tables 6 and 7 below:

table 6:

table 7:

on a PCR instrument, pre-amplification was performed under the conditions shown in Table 8 below:

table 8:

after amplification, the amplification product was put into a centrifuge at 10000rpm for 20 min. After the centrifugation, the mixture was left standing horizontally, and 4. mu.L of the supernatant was added to a new tube.

Step 2: construction of PacBio sequencing library

The reaction system was prepared as follows:

table 9:

on a PCR instrument, the reaction is carried out according to the following conditions: 37 ℃ for 20min, 25 ℃ for 15 min and 65 ℃ for 10 min. After the reaction was completed, 0.5. mu.L of Exonase III (NEB, Cat # M0206L) and 0.5. mu.L of Exonase VII (NEB, Cat # M0379L) were added and the reaction was continued at 37 ℃ for 1 hour. The DNA was purified twice using 0.6X Ampure PB beads (PacBio, Cat # 100-. The resulting DNA eluate was the target DNACBio sequencing library. The DNA concentration was determined on a Qubit 3 Fluorometer (ThermoFisher, Cat # Q33216) using a Qubit dsDNA HS reagent (ThermoFisher, Cat # Q32851). When there are multiple samples of the PacBio sequencing library, equal amounts of the library can be mixed together to prepare a mixed library.

And step 3: sequencing and analysis on a PacBio machine

According to the total concentration and molar concentration of the library, the library with an appropriate volume is reacted with a binding reagent (PacBio, Cat #101-820-200) and a primer (PacBio, Cat # 100-970-100) to prepare the final operable library. A representative sequencing result is shown in FIG. 3, FIG. 3a is a normal human sample (SMN1Two copies-SMN2Two copies), figure 3b SMA carrier sample: (SMN1-a copy-SMN2-three copies), figure 3c SMA patient sample: (SMN1-zero copy-SMN2Two copies), FIG. 3dSMN1(2+0) silent carrier sample: (SMN1/SMN1-SMN2Fusion gene/SMN2) FIG. 3eSMN2-SMN1Fused gene carrier sample: (SMN1/SMN2-SMN1Fusion gene/SMN2/SMN2) FIG. 3fSMN1Point mutation samples.

Example 3:SMN1/SMN2detection and validation of Gene mutation detection

The genomic DNA of the peripheral blood of 25 subjects was collected as 25 validation samples, and the method (and kit) of the present invention was used to simultaneously detect multiple mutations at 2 loci associated with SMA, as described in example 2. Simultaneous detection by qPCRSMN1/SMN2And (3) detecting the point mutation of the related gene by combining a Sanger sequencing method. The results obtained by the present invention were compared with the control results, and the results are shown in table 10 below, and the results of 25 samples are completely consistent.

Watch 10

Therefore, the detection result obtained by the method of the invention is compared with a qPCR combined PCR-Sanger sequencing method, and the specificity and the sensitivity reach 100 percent. In addition, 10 samples out of 25 samples are determined the accurate position of point mutation by the method of the invention, or the cis-trans relationship among different mutation points is clarified.

In conclusion, the primer group, the kit, the method and the system provided by the invention at least have the following obvious beneficial technical effects:

(1) the detection range is wide. The invention can simultaneously detect all point mutations on the SMA-related gene SMN1 which are researched and found at present, wherein the point mutations comprise 190 types in total, and can detect all unknown types of point mutations on SMN1 and SMN 2; large fragment deletions occurred in the SMN1 and SMN2 genes and copy number variations of SMN1 and SMN2 could be detected; the method can detect the fusion gene of the SMN1-SMN2 and the SMN2-SMN1 and the copy number of the fusion gene, and can detect whether different mutations are linked or not due to the characteristics of third-generation sequencing, reading and length measuring.

(2) And detecting multiple mutation types by using a single kit. The traditional method needs to set a detection system for each mutation type, and the invention simultaneously detects a plurality of mutations including SNV, Indel, gene recombination and copy number variation in two reaction primer systems.

(3) The detection error detection rate and the detection omission rate are low. The current universal method for detecting the copy number of most common pathogenic genes of SMA, namely SMN1 and SMN2, is MLPA or qPCR. Since there is approximately 5% of SMA patients carry one copy of SMN1 with a point mutation. Therefore, some SMA patients are inevitably misdiagnosed as carriers, resulting in false negative judgment. Meanwhile, as silent carriers of SMN1 (2+0) exist, the carriers can be misdiagnosed as healthy people, and false negative judgment is caused. The method directly amplifies full-length fragments of SMN1, SMN2 and a partial recombinant gene, does not have the risk of false detection and omission of a patient, and also has an indication effect on silent carriers of SMN1 (2+ 0).

(4) The samples were diversified. The template for PCR may be peripheral blood, dried blood spots or extracted genomic DNA, or may be a human cell line or other specific tissue.

(5) High-throughput detection. The third generation sequencing can realize 384 Barcode linkers, and actually more Barcode linkers can be designed according to needs. Or a double Barcode system of primer strip Barcode and linker strip Barcode is utilized to realize more Barcode combinations. The high throughput characteristics of the third generation sequencing platform determine that high throughput sample detection can be achieved.

(6) The accuracy is high. The dumbbell library of PacBio can be subjected to multiple rounds of reading during sequencing, and the base accuracy of the corrected sequencing result is more than 99%. And PacBio sequencing errors were random and corrected for base accuracy by sequencing depth to greater than 99.9%. Therefore, gene mutations within the detection range of the primers can be accurately read.

(7) The detection time is flexible. The Nanopore platform can generate data in minutes, and can start data analysis in minutes or hours according to actual data volume requirements. The Nanopore platform has time advantages when the requirement for detection time efficiency is high.

It should be noted that the foregoing examples are merely illustrative and are intended to illustrate some of the features of the present application. The appended claims are intended to claim as broad a scope as is contemplated, and the examples presented herein are merely illustrative of selected implementations in accordance with all possible combinations of examples. Accordingly, it is applicants' intention that the appended claims are not to be limited by the choice of examples illustrating features of the application. As used in the claims, the term "comprising" and its grammatical variants are also logically inclusive of different and varying phrases, such as, but not limited to, "consisting essentially of" or "consisting of. Where desired, numerical ranges are provided and sub-ranges therebetween are included. Variations in these ranges are also self-explanatory to those skilled in the art and should not be considered to be dedicated to the public, but rather should be construed to be covered by the appended claims where possible. Such as the long fragment PCR reaction and the three-generation sequencing library construction, the reaction reagents, reaction conditions and the like can be adjusted and changed according to specific needs. And that advances in science and technology will result in possible equivalents or sub-substitutes not currently contemplated for reasons of inaccuracy in language representation, and such changes should also be construed where possible to be covered by the appended claims.

Sequence listing

<110> Beijing Beirui and kang Biotechnology Co., Ltd

<120> primer set, kit, method and system for detecting multiple mutations in SMA

<130> CID220004

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tacacaatat gctccaaacg ccgcc 25

<210> 2

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

caaaacaaac aacaaataag gttgg 25

<210> 3

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ccttccttcc tgcccccatg tttgtct 27

<210> 4

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gccactgcac tctgacgaca gagcga 26

<210> 5

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gccacatacg cctcacatac attttgt 27

<210> 6

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ctaatccaca ttcaaatttt ctcaac 26

<210> 7

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

caacaccctt ctcacagctc ataaa 25

<210> 8

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ttaagtggga atacacatgc acatacac 28

<210> 9

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

actgtgtatt gggatggggt tagaac 26

<210> 10

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ggcgctctca gattgttttg tagagttc 28

<210> 11

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ctgcagccta ataattgttt tctttgg 27

<210> 12

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

agatctgggg taatgtgtac cacattg 27

<210> 13

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

atcacgtgca tatatcctgt cagtcaat 28

<210> 14

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

caccagccta tcctaatagt tcatgg 26

<210> 15

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gagcaagagg caggagtgag ttgtga 26

<210> 16

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

aacggttgaa tcactttcat acatggatg 29

Claims (19)

1. For amplificationSMNA primer set for a gene, wherein the primer set comprises the following primers:

SMN-FL-F and SMN-FL-R; and

SMN-DOWN-F and SMN-DOWN-R;

wherein the SMN-FL-F in the primer group is positioned inSMN1AndSMN2homologous region upstream of the gene, SMN-FL-R being locatedSMN1AndSMN2homologous region downstream of exon 7 c.840, SMN-FL-F and SMN-FL-R amplified length not more than 35 kb; SMN-DOWN-F is located atSMN1AndSMN2c.840, SMN-DOWN-R in the region of homology upstream of exon 7SMN1AndSMN2the amplified length of the homologous regions downstream of the gene, SMN-DOWN-F and SMN-FL-R, is no more than 35 kb.

2. The primer set according to claim 1, wherein the amplification products of the primer set are used for constructing a third generation sequencing library and are simultaneously detected by third generation sequencingSMN1AndSMN2copy number and point mutation of (a), andSMN1(2+0) Silent Carrier, in which the point mutations comprise at least the ones shown in Table 1SMN1190 point mutations in the gene.

3. The primer set according to claim 2, wherein the amplification products of the primer set are used for constructing a third generation sequencing library, and whether different mutations within the same amplification fragment in the amplification products are linked is detected by third generation sequencing.

4. The primer set of claim 1, wherein the primer can be added with 5-50nt of DNA with different sequences at the 5' end, i.e., DNA barcode, to distinguish different samples.

5. The primer set of claim 1, wherein the primer SMN-FL-F is selected from the group consisting of SEQ ID NOs: 1-4, SMN-FL-R is selected from SEQ ID NOs: 5-8, SMN-DOWN-F is selected from the group consisting of SEQ ID NOs: 9-12, SMN-DOWN-R is selected from the group consisting of SEQ ID NOs: 13-16.

6. The primer set of claim 2, wherein said three-generation sequencing is selected from PacBio sequencing by Pacific Biosciences or Nanopore sequencing by Oxford Nanopore Technologies (ONT).

7. For amplificationSMNA kit of genes comprising a DNA polymerase, a reaction buffer and a primer set according to any one of claims 1-6.

8. An apparatus for detecting mutations in SMA disease-associated genes, comprising:

the method of claim 7 for amplificationSMNA kit of genes; and

a kit for constructing a third generation sequencing library.

9. The apparatus of claim 8, wherein the kit for constructing a third generation sequencing library comprises end repair enzymes, linkers, ligases, DNA purification beads, reaction buffers, and exonucleases.

10. A method for detecting mutations in SMA disease-associated genes comprising the steps of:

(1) providing a subject genomic DNA sample;

(2) amplifying in the genomic DNA sample by PCR with the primer set according to any one of claims 1 to 6SMNA gene;

(3) constructing a third generation sequencing library; and

(4) and (4) carrying out third-generation sequencing and analyzing the gene mutation type.

11. The method of claim 10, wherein the third generation sequencing is selected from PacBio sequencing by Pacific Biosciences or Nanopore sequencing by Oxford Nanopore Technologies (ONT).

12. The method of claim 10, wherein the SMA disease associated gene mutations that can be simultaneously detected after third generation sequencing and analysis of the type of gene mutation compriseSMN1AndSMN2copy number and point mutation of (a), andSMN1(2+0) Silent Carrier, in which the point mutations comprise at least the ones shown in Table 1SMN1190 point mutations in the gene.

13. A system for detecting SMA disease associated gene mutations, comprising the following modules:

(1) an acquisition module for providing a subject genomic DNA sample;

(2) an amplification module for amplifying in the genomic DNA sample by PCR with the primer set according to any one of claims 1-6SMNA gene, whereinSMNThe gene includesSMN1，SMN2AndSMN1andSMN2the fusion gene of (4);

(3) a library construction module for constructing a third generation sequencing library;

(4) and the sequencing analysis module is used for third generation sequencing and analyzing the gene mutation types.

14. The system of claim 13, wherein the amplification module comprises the kit of claim 7.

15. The system of claim 13, wherein the library construction templates comprise reagents for constructing a tertiary sequencing library comprising linkers, ligases, DNA purification beads, reaction buffers, and exonucleases.

16. The system of claim 13, wherein the third generation sequencing is selected from PacBio sequencing by Pacific Biosciences, Inc., or Nanopore sequencing by Oxford Nanopore Technologies (ONT).

17. The system of claim 13, wherein after third generation sequencing by the sequencing analysis module and analysis of the type of gene mutation, the SMA disease associated gene mutation that can be detected simultaneously comprisesSMN1AndSMN2copy number and point mutation of (a), andSMN1(2+0) Silent Carrier, in which the point mutations comprise at least the ones shown in Table 1SMN1190 point mutations on the gene and whether there is linkage between different mutations therein.

18. Use of a primer set according to any one of claims 1-6 in the preparation of a kit for detecting mutations in SMA disease associated genes.

19. The use of claim 18, wherein the method for detecting SMA disease associated gene mutation comprises the steps of:

(1) providing a subject genomic DNA sample;

(2) amplifying the genomic DNA-like by PCR with the primer set according to any one of claims 1 to 6In this paperSMNA gene;

(3) constructing a third generation sequencing library; and

(4) and (4) carrying out third-generation sequencing and analyzing the gene mutation type.

Images