CN116732168B

CN116732168B - Method and kit for detecting multiple mutations of autosomal dominant polycystic kidney

Info

Publication number: CN116732168B
Application number: CN202310979909.5A
Authority: CN
Inventors: 陈立保; 马熠熠; 徐德超; 梅长林; 武乐; 毛爱平; 任志林
Original assignee: Berry Genomics Co Ltd
Current assignee: Berry Genomics Co Ltd
Priority date: 2023-08-04
Filing date: 2023-08-04
Publication date: 2023-11-03
Anticipated expiration: 2043-08-04
Also published as: CN116732168A

Abstract

The application provides a method and a kit for detecting multiple mutations of autosomal dominant polycystic kidney disease, in particular to a primer group, a kit and a method for detecting multiple mutations of autosomal dominant polycystic kidney disease (Autosomal dominant polycystic kidney disease, ADPKD) in the same tube reaction system, wherein the kit comprises the following reagents: (1) reagents for multiplex long fragment PCR amplification; and (2) reagents for constructing a sequencing library.

Description

Method and kit for detecting multiple mutations of autosomal dominant polycystic kidney

Technical Field

The application relates to a primer and a method for detecting multiple mutations of autosomal dominant polycystic kidney disease in the same tube reaction system by utilizing a long-fragment long-reading long-sequencing platform, and a kit suitable for the method.

Background

Autosomal dominant hereditary polycystic kidney disease (Autosomal dominant polycystic kidney disease, ADPKD) is the most common kidney disease in mendelian inherited mode with a global prevalence of 1/400 to 1/10001.ADPKD often involves multiple organs throughout the body, whose clinical manifestations include renal manifestations and extra-renal manifestations. Kidneys manifest as lumbago, abdominal pain, under-the-lens or macroscopic hematuria, hypertension, renal insufficiency, etc. Extrarenal is often manifested as liver, pancreas, seminal vesicles, spleen and arachnoid cysts, heart valve abnormalities, intracranial aneurysms, etc., with approximately 50% of ADPKD patients suffering from end stage renal disease 2 at age 60.

ADPKD genotypes and phenotypes are relatively complex to associate with. Patients with mutations in the PKD1 gene have been reported to have larger kidneys, earlier onset times (mean ages of ESRD 53.4 and 72.7 years, respectively), lower glomerular filtration rate and higher total kidney volume by 1,3 compared to PKD2 patients. In addition, a strong correlation between the type of mutation and the severity of the disease was observed, the phenotype of the patient with the truncated type mutation was more severe, and homozygous mutant children died more frequently at embryonic stage 1,3. Double gene patients with ADPKD (i.e., patients with both PKD1 and PKD2 mutations) are more severely ill than single gene family members, but double gene mutations are not fatal in humans 4. Combinations of ADPKD alleles with alleles of another blastula gene (e.g., HNF 1B) may also exacerbate kidney disease phenotype 5. About 10% -15% of adpkd patients have no positive family history, suggesting that the neonatal mutation occurs at considerable rates 6.

ADPKD is caused mainly by PKD1 or PKD2 gene mutations, and about 90% of patients can detect PKD gene mutations, but 10% of cases still fail to detect mutations, and in clinically established populations, 85% of patients find PKD1 mutations, and the remaining 15% of patients present PKD2 mutation 7. PKD1 is located on chromosome 16p13.3, has 46 exons, is full-length of 50kb, and encodes polycystic protein-1; PKD2 is located on chromosome 4q21-22, with 15 exons, full length 68Kb, encoding polycystic protein-28. Analysis of the PKD2 gene region is simpler, compared to the PKD1 gene, which is more complex, with 6 pseudogenes PKD1P1-P6, and the first 33 exons have 98% DNA sequence homology to the pseudogenes, plus their size, high GC content, and no mutation hotspots, making comprehensive PKD1 mutation screening challenging 9. To date, pathogenic germ line mutations of 1,200 and 200 more PKD1 and PKD2, respectively, were recorded in the Mayo PKD database (http:// pkdb. Mayo. Edu), with the most common point mutations accounting for 97% and the remaining 3% being structural variations 10.

Renal cysts 11 can be sensitively detected by renal imaging by ultrasound, computed Tomography (CT) or Magnetic Resonance Imaging (MRI) for patients with a well-defined family history of ADPKD. Gene detection is suitable for patients with no positive family history, ambiguous image presentation, atypical clinical features, and is also useful for patients or households suspected of having a complex genetic basis. Traditional ADPKD diagnostics often requires multiple technical combinations due to the long PKD1 and PKD2 genomes and the absence of mutational hot spots. LR-PCR uses rare mismatch between PKD1 gene and pseudogene to amplify specific template and then carries out Sanger sequencing, so that comprehensive mutation screening can be carried out on PKD1 and PKD2, but structural variation cannot be detected, and the method has the advantages of complicated experiment and long period of 12. The SNVs and indexes detection depth in the PKD1 and PKD2 gene regions can be greatly improved by using second generation sequencing (NGS), but the structural variation types of the PKD1 and PKD2 genes cannot be detected due to the limitation of short reading length, and the MLPA is required to detect the deletion 13 of large fragments which cannot be detected by NGS and PCR+Sanger.

Disclosure of Invention

At present, screening can be combined based on methods such as LR-PCR, MLPA, sanger sequencing or second generation sequencing, and the like, so that PKD1 and PKD2 SNVs and index detection and structural variation detection can be realized, but the detection is mainly limited in the following aspects:

1. SNVs & indexes and SV detection of PKD1 and PKD2 genes can not be realized in the same tube reaction system at the same time;

2. since PKD1 has 6 pseudogenes, the combination of the MLPA probe and the design of Sanger sequencing primers are affected, and detection omission and false detection can be caused to a certain extent;

3. the accurate breaking point of the large fragment deletion cannot be determined by only one detection method;

4. the traditional method needs a plurality of technologies to be combined, so that the requirement on the quality of a sample is high, the gene diagnosis time is long, and the detection cost is high.

In view of this, the present application provides a method for detecting multiple mutations of ADPKD-related PKD1 and PKD2 genes by performing multiplex long fragment PCR amplification and long fragment sequencing in the same tube reaction system. The long fragment PCR amplification was performed in one reaction tube, and multiplex long fragment PCR amplification of the PKD1 and PKD2 genes in the samples was used to detect 12 fragments of exons SNVs and indels (PKD 1 Exon1, PKD1 Exon2-16, PKD1 Exon17-26, PKD1 Exon27-34, PKD1 Exon35-46,PKD2 Exon1,PKD2 Exon2,PKD2 Exon3-5, PKD2 Exon6-7, PKD2 Exon8-9, PKD2 Exon10-13, PKD2 Exon 14-15), and Gap fragments amplified for detecting deletions and duplications within the PKD1 and PKD2 genes and large fragment deletions; by combining the characteristics of length measurement, length measurement and the like of a long fragment sequencing platform, the accurate, rapid and high-throughput detection of PKD1 and PKD2 gene mutation can be realized. The method is simple and convenient to operate, the long fragment PCR and the long fragment library are reliable in quality and high in repeatability, and the method is favorable for the application of the long fragment sequencing technology in clinical detection.

The application aims to solve the problems of clinical missed detection and false detection caused by single detection variation types of different methods due to incomplete coverage of pathogenic genes of PKD1 and PKD2 at the present stage and complicated gene diagnosis detection methods. The target of comprehensively, accurately and rapidly detecting multiple mutations of the PKD1 and PKD2 genes of multiple samples is realized by simultaneously amplifying multiple fragments of the PKD1 and PKD2 related pathogenic genes of the ADPKD in the same tube reaction system through long-fragment PCR and preparing a long-fragment sequencing library.

According to a first aspect of the present application there is provided a primer set for simultaneous amplification of multiple mutations in ADPKD comprising:

the 24 primers used to amplify all exons within the PKD1 and PKD2 genes are as follows:

PKD1-1F, PKD1-1R, PKD1-2F, PKD1-2R, PKD1-3F, PKD1-3R, PKD1-4F, PKD1-4R, PKD1-5F, PKD1-5R, PKD2-1F, PKD2-1R, PKD2-2F, PKD2-2R, PKD2-3F, PKD2-3R, PKD2-4F, PDK2-4R, PKD2-5F, PDK2-5R, PKD2-6F, PKD2-6R, PKD2-7F, PKD2-7R having the sequence set forth in SEQ ID NO: 1-24;

the 9 primers used to amplify the deletion in the PKD1 and PKD2 genes were as follows:

PKD1-2F2-F, PKD2-G1F, PKD2-G1R, PKD-G2R, PKD2-G2F, PKD2-G3R, PKD2-G4R, PKD2-G3F, PKD2-G5R, the sequences of which are shown in SEQ ID NO: 25-33;

the novel 49 primers used to amplify 200kb deletions upstream and downstream of PKD1 were as follows:

2F, G3F, G4F, G5F, G6F, G7F, G8F, G9F, G10F, G11F, G12F, G13F, G14F, G2F, G3F, G4F, G5F, G6F, G7F, G8F, G9F, G10F, G12F, G13F, G14F, G15, F, G, 16, F, G, 18, F, G, 21, F, G, 22, 23, F, G, 25, F, G R, the sequences of the sequences are respectively shown in SEQ ID NO:34-82 (82 primer positions are shown in FIG. 1).

The primers can amplify the entire sequence within the primer range on the PKD1 and PKD2 genes, including any type of mutant sequence within the primer range. Preferably, the amplification product is between about 4K and about 13K. Preferably, degenerate base primers are used if there are SNPs at the primer positions.

In a specific embodiment, wherein the primer sequence is selected from the group consisting of those shown in SEQ ID NOS: 1-82 in Table 1

Wherein, the primer can amplify more than 12 target fragments in the same tube reaction system, and simultaneously detect a plurality of mutations in ADPKD:

1) SNVs and indels on exons of PKD1 and PKD2 genes;

2) PKD1 and PKD2 intragenic deletions and duplications;

3) A large fragment within 200kb upstream and downstream of PKD1 was deleted; and

4) Over 2000 point mutations in the PKD1 and PKD2 genes.

Wherein the point mutations comprise more than 2000 point mutations on the PKD1 and PKD2 genes from two databases (PKDB and ClinVar) listing.

Among them, point mutations and structural variations at the genetic loci described herein can be queried in PKDB (https:// PKDB. Mayo. Edu/variants) and ClinVar (https:// www.ncbi.nlm.nih.gov/ClinVar).

In a preferred embodiment, the primer set of the present application can detect simultaneously the point mutations of 46 exons on the PKD1 gene and 15 exons on the PKD2 gene, the deletion and duplication in PKD1 and PKD2 genes, and the deletion of a large fragment within 200kb upstream and downstream of PKD1 in the same tube reaction system.

In one embodiment, 5-50nt of DNA of different sequences, namely DNA bar code (Barcode), can be added at the 5' end of the primer for distinguishing between different samples; preferably, the 5' end Barcode of the F and R primers may be the same or different, and may be selected as desired by one skilled in the art.

In a preferred embodiment, the primer set is used for multiplex long fragment PCR amplification of more than 12 target fragments of PKD1 and PKD2 genes.

The primer set can be used for carrying out multiplex long-fragment PCR amplification on ADPKD related pathogenic gene fragments comprising mutation types in the range of all primers in the same tube reaction system, and can detect the mutation types of all the gene fragments in the range of the primers by combining with a subsequent long-fragment sequencing platform.

In one embodiment, the primers can be used for long fragment PCR amplification and the cis-trans distribution of different mutations within the amplified product fragments can be detected using long fragment sequencing methods.

According to a second aspect of the present application, there is provided a kit for detecting primers for detecting multiple mutations of ADPKD in the same tube reaction system, comprising the following reagents:

(1) Reagents for performing multiplex long fragment PCR amplification in the same tube reaction system, wherein the reagents for PCR amplification comprise the primer set described above;

(2) Reagents for constructing long fragment sequencing libraries.

In one embodiment, wherein the reagents for performing multiplex long fragment PCR amplification in the same tube reaction system comprise a DNA polymerase, a reaction buffer, and a primer set.

In a preferred embodiment, the primer set in the kit is selected from the following 82 primers (primer positions are shown in FIG. 1):

2F, G3F, G4F, G5F, G6F, G7F, G8F, G9F, G10F, G11F, G12F, G13F, G14F, G2F, G3F, G4F, G5F, G6F, G7F, G8F, G9F, G10F, G12F, G13F, G14F, G15, F, G, 16, F, G, 18, F, G, 21, F, G, 22, 23, F, G, 25, F, G R, the sequences of the sequences are respectively shown in SEQ ID NO: 34-82.

In a preferred embodiment, the primers can amplify the entire sequence within the primer range, including any type of mutant sequence within the primer range. Preferably, the amplification product of each primer is between about 4kb and about 13 kb. Preferably, degenerate base primers are used if there are SNPs at the primer positions.

In a preferred embodiment, wherein the primer sequences are shown in SEQ ID NOS.1-82 in Table 1.

In a preferred embodiment, 5-50nt of DNA of different sequences (Barcode) can be added to the 5' end of the primer in the kit for distinguishing between different samples; preferably, the 5' end Barcode of the F and R primers may be the same or different, and may be selected as desired by one skilled in the art.

In one embodiment, for the kit, the long fragment PCR amplification products may or may not be purified prior to the next reaction, and may be selected as desired by one of skill in the art.

In one embodiment, wherein the kit, reagents for constructing a long fragment sequencing library include end repair enzymes, linkers, ligases, DNA purification magnetic beads, reaction buffers, and exonucleases.

In a preferred embodiment, the kit primer can detect multiple mutations in ADPKD simultaneously in the same tube reaction system:

1) SNVs and indels on exons of PKD1 and PKD2 genes;

2) PKD1 and PKD2 intragenic deletions and duplications;

4) Over 2000 point mutations in the PKD1 and PKD2 genes.

In a preferred embodiment, the primer set is used for long fragment PCR amplification of more than 12 gene fragments.

In a specific embodiment, wherein multiplex long fragment PCR amplification is accomplished in one reaction tube for the kit.

In a preferred embodiment, the long fragment sequencing is selected from the group consisting of SMRT-based sequencing from Pacific Biosciences (PacBio detected) or the Nanopore sequencing platform from ONT.

In a specific embodiment, SMRT library linker ligation may be performed using blunt end ligation or TA ligation.

In a specific embodiment, the SMRT universal blunt end linker sequence is 5 '-pATCTCTCTCTTTTCCTCCTTGTTGTTTTGTTTTGTTGAGAGAGAGAGAT-3' (SEQ ID NO: 83) that is annealed to form a blunt end stem loop structure linker aptamer. DNA (Barcode) with different sequences of 5-50nt can be added to the stem to form different adaptor aptamers with Barcode. SMRT libraries with different Barcode can be pooled together for sequencing.

In a specific embodiment, the SMRT universal TA linker sequence is 5 '-pATCTCTCTCTTTTCCTCCTTGTTGTTTTGTTGTTGAGAGAGAGAGATT-3' (SEQ ID NO: 84) that is annealed to form a blunt-ended stem loop structure linker aptamer. DNA (Barcode) with different sequences of 5-50nt can be added to the stem to form different adaptor aptamers with Barcode. SMRT libraries with different Barcode can be pooled together for sequencing.

In one embodiment, the SMRT joint may or may not be Barcode. Preferably, the SMRT connector is either a PacBio-designed Barcode or a self-designed Barcode, which can be selected by those skilled in the art as desired.

In a preferred embodiment, the SMRT library is matched to a PacBio corporation sequencing platform.

In a preferred embodiment, wherein the reagents for constructing a long fragment Nanopore library include end repair enzymes, linkers, ligases, DNA purification magnetic beads, 80% ethanol, and reaction buffers.

In one embodiment, the Nanopore library linker ligation may use blunt end ligation or TA ligation.

In one embodiment, the Nanopore linker may or may not be Barcode. Preferably, the Nanopore connector is a Barcode designed by ONT company or a Barcode designed by itself, and can be selected by those skilled in the art as required.

In a preferred embodiment, the Nanopore library is matched to an ONT company sequencing platform.

According to a third aspect of the present application, there is provided a method for simultaneously detecting a plurality of mutations of ADPKD in the same tube reaction system, comprising the steps of:

(1) And the acquisition module is used for: obtaining and preparing a subject sample;

(2) Amplification module: carrying out multiplex long fragment PCR amplification on PKD1 and PKD2 genes in the sample in the same tube reaction system;

(3) Library construction module: constructing a long fragment sequencing library;

(4) Sequencing module: sequencing and analyzing the mutation type of the genes;

wherein the PCR amplification in the amplification module adopts the primer group.

In one embodiment, the method of the application uses a long fragment PCR primer set, selected from the primers as described above, performed in the same tube reaction system. Preferably, 5-50nt of DNA (Barcode) of different sequences can be added to the 5' end of the primer described above for distinguishing between different samples.

In a preferred embodiment, the 5' end Barcode of the F and R primers may be the same or different, and may be selected as desired by one skilled in the art.

In a preferred embodiment, the method described therein allows for simultaneous detection of at least multiple mutations in ADPKD within the same tube reaction system:

1) 12 fragments of the exons SNVs and indels of PKD1 and PKD2 genes: PKD1 Exon1, PKD1 Exon2-16, PKD1 Exon17-26, PKD1 Exon27-34, PKD1 Exon35-46,PKD2 Exon1,PKD2 Exon2,PKD2 Exon3-5, PKD2 Exon6-7, PKD2 Exon8-9, PKD2 Exon10-13, PKD2 Exon14-15;

2) PKD1 and PKD2 intragenic deletions and duplications; and

4) Over 2000 point mutations in the PKD1 and PKD2 genes. .

In a preferred embodiment, the method described therein allows simultaneous detection of 46 exons on the PKD1 gene and 15 exons on the PKD2 gene in a single tube reaction system, deletion and duplication in the PKD1 and PKD2 genes, and deletion of large fragments within 200kb upstream and downstream of PKD 1.

In a preferred embodiment, the primer set is used for multiplex long fragment PCR amplification of more than 12 fragments of PKD1 and PKD2 genes.

In a preferred embodiment, wherein the method, multiplex long fragment PCR amplification is accomplished in one reaction tube.

In one embodiment, wherein the sample is selected from a biological sample or a sample-extracted gDNA. Wherein the biological sample is selected from cultured cell lines, blood, amniotic fluid, villus, gametes, blasts, joint fluid, urine, sweat, saliva, feces, cerebrospinal fluid, ascites fluid, hydrothorax, bile, pancreatic fluid, or the like.

In a specific embodiment, wherein the long fragment sequencing of the method is selected from SMRT sequencing by pacbrio corporation or Nanopore sequencing by ONT corporation.

In one embodiment, SMRT library linker ligation may use blunt end ligation or TA ligation.

In one embodiment, the SMRT library universal blunt end linker sequence is 5 '-pATCTCTCTCTTTTCCTCCTTGTTGTTTTGTTGTTGAGAGAGAGAGAT-3' (SEQ ID NO: 83) that is annealed to form a blunt end stem loop structure linker aptamer. DNA (Barcode) with different sequences of 5-50nt can be added to the stem to form different adaptor aptamers with Barcode. PacBIO libraries with different Barcode can be pooled together for sequencing.

In one embodiment, the SMRT library universal TA adaptor sequence is 5 '-pATCTCTCTCTTTTCCTCCTTGTTGTTTTGTTGTTGAGAGAGAGAGATT-3' (SEQ ID NO: 84) and is annealed to form a blunt-ended stem-loop adaptor aptamer. DNA (Barcode) of 5-50nt different sequences can be added to the stem to form different adaptor aptamers with Barcode, and PacBIO libraries with different Barcode can be mixed together for sequencing.

In one embodiment, the SMRT library linker may or may not be Barcode. In a preferred embodiment, the SMRT library is designed with Barcode by PacBio corporation or self-designed Barcode. Those skilled in the art can choose this as desired.

In one embodiment, the Nanopore linker may or may not be Barcode, and may be selected as desired by those skilled in the art. Preferably, the Nanopore connector is a Barcode designed by ONT company or a Barcode designed by itself, and can be selected by those skilled in the art as required.

The method based on the specific combination of long fragment PCR amplification and long fragment high throughput sequencing can realize high specificity, accuracy and rapidness for simultaneously detecting a plurality of mutations of the pathogenic genes of the PKD1 and the PKD2 related to a plurality of samples.

The excellent technical effects of the method and the kit disclosed by the application are mainly as follows:

(1) The detection range is wide. The application can detect all the point mutations on the exons of the ADPKD related genes PKD1 and PKD2 which are researched and found at present in the same tube reaction system, and the total of the application comprises more than 2000, and can detect all the unknown types of the point mutations on the PKD1 and PKD2 genes; deletion and duplication within PKD1 and PKD2 genes can be detected; the deletion of the large fragment within 200kb at the upstream and downstream of the PKD1 gene can be detected, and the position of the breaking point of the deletion of the large fragment can be accurately judged.

(2) Multiple mutation types are detected by a single kit. The conventional method needs to set a detection system for each mutation type: detection of SNVs and Indels requires detection using LR-PCR+Sanger or NGS methods; large fragment deletions associated with PKD1 and PKD2 genes need to be detected using MLPA; the application detects a plurality of mutations including SNVs, indels and structural variation in a tube reaction primer system.

(3) The detection false detection and omission rate is low. The current common method for detecting the point mutations in the most common pathogenic genes PKD1 and PKD2 of ADPKD is LR-PCR+Sanger. Because 6 false genes exist in PKD1 genes, the detection range of Sanger is limited, the detection experiment is tedious, and the missed diagnosis of pathogenic mutation is easy to cause false negative judgment. The method directly and specifically amplifies all exon regions of PKD1 and PKD2 genes, all related structural variation fragments in the PKD1 and PKD2 genes and GAP fragments with large fragment deletion in the same tube reaction system, thereby greatly reducing the risks of false detection and missed detection of patients, greatly improving the simplicity of the diagnosis of the PKD1 and PKD2 genes and greatly reducing the time cost and labor cost of the diagnosis of the ADPKD genes.

(4) Samples are diversified. Templates for PCR may be peripheral blood, dried blood spots or extracted genomic DNA, but also cell lines of human origin or other specific tissues.

(5) High throughput detection. The long fragment sequencing can realize 384 Barcode joints, and more Barcode joints can be designed according to the requirement. Or a dual-Barcode system with a primer and an adapter for the Barcode is utilized to realize more than one Barcode combination. The high throughput characteristics of the long fragment sequencing platform dictate that high throughput sample detection can be achieved.

(6) The accuracy is high. SMRT dumbbell libraries from PacBio can be read in multiple rounds during sequencing, and the accuracy of the bases in the corrected sequencing results is greater than 99%. And SMRT sequencing errors are random, and the accuracy of the corrected bases by sequencing depth is more than 99.9%. Thus, the mutation of the gene within the detection range of the primer can be precisely interpreted.

(7) The detection time is flexible. The Nanopore platform can generate data in minutes and can initiate data analysis in minutes or hours depending on the actual data volume requirements. The Nanopore platform has time advantages when the requirements for detection aging are high.

Drawings

FIG. 1 is a schematic diagram of the design of PCR primers for multiple long fragments in the same reaction tube, wherein FIG. 1A is a schematic diagram of PKD1 detection primers and FIG. 1B is a schematic diagram of PKD2 detection primers.

FIG. 2 is a DNA gel electrophoresis diagram of amplified samples (PKD 1 and PKD2 genes) according to the multiplex long fragment PCR method in example 1.

FIG. 3 is a graph of the results of PacBio sequencing of representative ADPKD-related gene mutation samples, wherein FIG. 3A shows: PKD1 gene internal point mutation; fig. 3B shows: deletion of large segments of PKD1 gene; fig. 3C shows: repeated samples within PKD1 gene; fig. 3D shows: PKD2 gene internal deletions.

Detailed Description

While this application may be embodied in many different forms, there are disclosed herein specific illustrative embodiments thereof which embody the principles of the application. It should be emphasized that the present application is not limited to the specific embodiments illustrated. Furthermore, any section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

Unless otherwise defined herein, scientific and technical terms used in connection with the present application will have the meanings commonly understood by one of ordinary skill in the art. Furthermore, unless the context requires otherwise, terms in the singular shall include the plural and terms in the plural shall include the singular. More specifically, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. In the present application, the use of "or" means "and/or" unless stated otherwise. Furthermore, the use of the term "include" and other forms (such as "include" and "contain") is not limiting. Furthermore, the scope provided in the specification and the appended claims includes all values between the endpoints and between the endpoints.

Summary of the sequence Listing

The application is accompanied by a sequence listing comprising a plurality of nucleic acid and amino acid sequences. Table 1 below provides an overview of the sequences involved.

TABLE 1

Example 1: the method for carrying out multiplex long fragment PCR in the same tube reaction system is utilized to amplify the related gene mutation of the ADPKD.

The reaction system was prepared as follows in table 2, and peripheral blood, dried blood spots and genomic DNA samples were amplified:

table 2:

on a PCR apparatus, pre-amplification was performed under the conditions shown in Table 3 below:

table 3:

after amplification, 5 ul samples were taken from each sample and detected on a 1% DNA gel, the results are shown in FIG. 2, with different samples as templates, ADPKD-relatedPKD1 and PKD2The genes can be amplified effectively.

Example 2: construction of PacBio sequencing library Using the Long fragment PCR method of the present application

The reaction system was prepared in the same reaction tube according to the following Table 4 to amplify the different types of ADPKD-relatedPKD1AndPKD2peripheral blood samples of gene mutations:

table 4:

on a PCR apparatus, pre-amplification was performed under the conditions shown in Table 5 below:

table 5:

after amplification, the amplified product was placed in a centrifuge at 10000rpm for 20min. After centrifugation, the mixture was left to stand horizontally, and 4mL of supernatant was added to a new tube.

The reaction system was prepared according to the following table 6:

table 6:

on a PCR instrument, the reaction was performed under the following conditions: 37 ℃ for 20min, 25 ℃ for 15 min and 65 ℃ for 10 min. After completion of the reaction, 0.5 mL Exonuclease III (NEB, cat#m0206l) and 0.5 mL Exonuclease VII (NEB, cat#m0379L) were added and the reaction was continued at 37 ℃ for 1 hour. The DNA was purified twice with 0.6x Ampure PB beads (PacBIO, cat# 100-265-900) according to the manufacturer's instructions and finally eluted with 10uL Elution Buffer. The resulting DNA eluate was the DNAPacBio sequencing library of interest. The DNA concentration was determined on a Qubit 3 Fluoster (ThermoFisher, cat#Q 33216) with the Qubit dsDNA HS reagent (ThermoFisher, cat#Q 32851). When there are multiple sample PacBio sequencing libraries, equal amounts of the libraries can be mixed together to prepare a mixed library.

Based on the total and molar concentration of the library, the appropriate volume of library was reacted with binding reagents (PacBIO, cat# 101-820-200) and primers (PacBIO, cat# 100-970-100) to prepare the final on-machine library. Representative sequencing results are shown in fig. 3, wherein a is a schematic diagram of a point mutation sample IGV, B is a schematic diagram of a PKD1 large fragment deletion structure variation IGV, C is a schematic diagram of a repeated structure variation IGV within a PKD1 gene, and D is a schematic diagram of a deletion structure variation IGV within a PKD2 gene.

Example 3:PKD1andPKD2detection and verification of Gene mutations

Peripheral blood genomic DNA from 182 subjects was collected as a validation sample, and ADPKD-related assays were performed simultaneously using the methods (and kits) of the application as described in example 2PKD1AndPKD2multiple mutations at the gene locus. At the same time, MLPA is used for detecting structural variation, and PCR and Sanger sequencing methods are used for detecting the structural variationPKD1AndPKD2point mutation of genes. The results obtained by the application are compared with the control results, and the results are shown in Table 7, and the results of 182 samples are completely consistent.

TABLE 7

/>

Thus, the results of the detection using the method of the present application achieved 100% specificity and sensitivity by comparison with the LR-PCR or PCR+Sanger sequencing or MLPA methods. Furthermore, among 182 samples, 7 samples were identified by the method of the present application as specific breaking point positions.

It is to be noted that: while the above embodiments have demonstrated a series of features of the present application, it will be apparent to those skilled in the art from this disclosure that the reagents, reaction conditions, etc. involved in the multiplex+long fragment PCR reaction and long fragment sequencing library construction can be adapted and varied as desired. It will thus be appreciated that those skilled in the art will be able to devise numerous alternative arrangements which, although not explicitly described herein, embody the principles of the application and are included within its spirit and scope.

Reference to the literature

[1] Cornec-Le Gall E, Audrézet MP, Chen JM, Hourmant M, Morin MP, Perrichot R, Charasse C, Whebe B, Renaudineau E, Jousset P, Guillodo MP, Grall-Jezequel A, Saliou P, Férec C, Le Meur Y. Type of PKD1 mutation influences renal outcome in ADPKD. J Am Soc Nephrol. 2013 May;24(6):1006-13. doi: 10.1681/ASN.2012070650.

[2] Xue C, Zhou CC, Wu M, Mei CL. The Clinical Manifestation and Management of Autosomal Dominant Polycystic Kidney Disease in China. Kidney Dis (Basel). 2016 Oct;2(3):111-119. doi: 10.1159/000449030.

[3] Heyer CM, Sundsbak JL, Abebe KZ, Chapman AB, Torres VE, Grantham JJ, Bae KT, Schrier RW, Perrone RD, Braun WE, Steinman TI, Mrug M, Yu AS, Brosnahan G, Hopp K, Irazabal MV, Bennett WM, Flessner MF, Moore CG, Landsittel D, Harris PC; HALT PKD and CRISP Investigators. Predicted Mutation Strength of Nontruncating PKD1 Mutations Aids Genotype-Phenotype Correlations in Autosomal Dominant Polycystic Kidney Disease. J Am Soc Nephrol. 2016 Sep;27(9):2872-84. doi: 10.1681/ASN.2015050583.

[4] Pei Y, Paterson AD, Wang KR, He N, Hefferton D, Watnick T, Germino GG, Parfrey P, Somlo S, St George-Hyslop P. Bilineal disease and trans-heterozygotes in autosomal dominant polycystic kidney disease. Am J Hum Genet. 2001 Feb;68(2):355-63. doi: 10.1086/318188.

[5]Bergmann C, von Bothmer J, Ortiz Brüchle N, Venghaus A, Frank V, Fehrenbach H, Hampel T, Pape L, Buske A, Jonsson J, Sarioglu N, Santos A, Ferreira JC, Becker JU, Cremer R, Hoefele J, Benz MR, Weber LT, Buettner R, Zerres K. Mutations in multiple PKD genes may explain early and severe polycystic kidney disease. J Am Soc Nephrol. 2011 Nov;22(11):2047-56. doi: 10.1681/ASN.2010101080.

[6] Rossetti S, Strmecki L, Gamble V, Burton S, Sneddon V, Peral B, Roy S, Bakkaloglu A, Komel R, Winearls CG, Harris PC. Mutation analysis of the entire PKD1 gene: genetic and diagnostic implications. Am J Hum Genet. 2001 Jan;68(1):46-63. doi: 10.1086/316939.

[7] Audrézet MP, Cornec-Le Gall E, Chen JM, Redon S, Quéré I, Creff J, Bénech C, Maestri S, Le Meur Y, Férec C. Autosomal dominant polycystic kidney disease: comprehensive mutation analysis of PKD1 and PKD2 in 700 unrelated patients. Hum Mutat. 2012 Aug;33(8):1239-50. doi: 10.1002/humu.22103.

[8] Wilson PD. Polycystic kidney disease. N Engl J Med. 2004 Jan 8;350(2):151-64. doi: 10.1056/NEJMra022161.

[9] Song X, Haghighi A, Iliuta IA, Pei Y. Molecular diagnosis of autosomal dominant polycystic kidney disease. Expert Rev Mol Diagn. 2017 Oct;17(10):885-895. doi: 10.1080/14737159.2017.1358088.

[10] PKD FOUNDATION Variation Database. https://pkdb.mayo.edu/variants.

[11] Jin X, Rong S, Mei C, Chen J, Ye C, Chen X. Ultrasonic characterization (integrated backscatter) of myocardial tissue in patients with autosomal dominant polycystic kidney disease. Nephron Clin Pract. 2010;114(4):c288-94. doi: 10.1159/000276581.

[12] Bergmann C. Recent advances in the molecular diagnosis of polycystic kidney disease. Expert Rev Mol Diagn. 2017 Dec;17(12):1037-1054. doi: 10.1080/14737159.2017.

[13] Consugar MB, Wong WC, Lundquist PA, Rossetti S, Kubly VJ, Walker DL, Rangel LJ, Aspinwall R, Niaudet WP, Ozen S, David A, Velinov M, Bergstralh EJ, Bae KT, Chapman AB, Guay-Woodford LM, Grantham JJ, Torres VE, Sampson JR, Dawson BD, Harris PC; CRISP Consortium. Characterization of large rearrangements in autosomal dominant polycystic kidney disease and the PKD1/TSC2 contiguous gene syndrome. Kidney Int. 2008 Dec;74(11):1468-79. doi: 10.1038/ki.2008.485.

Claims

1.A primer set for simultaneously amplifying multiple mutations in ADPKD, comprising:

2F, G3F, G4F, G5F, G6F, G7F, G8F, G9F, G10F, G11F, G12F, G13F, G14F, G2F, G3F, G4F, G5F, G6F, G7F, G8F, G9F, G10F, G12F, G13F, G14F, G15, F, G, 16, F, G, 18, F, G, 21, F, G, 22, 23, F, G, 25, F, G R, the sequences of the sequences are respectively shown in SEQ ID NO: 34-82;

wherein, the primer can detect a plurality of mutations in ADPKD simultaneously in the same tube reaction system:

1) SNVs and indels on exons of PKD1 and PKD2 genes;

2) PKD1 and PKD2 intragenic deletions and duplications;

4) Over 2000 point mutations in the PKD1 and PKD2 genes.

2. The primer set according to claim 1, wherein the primer can be added with 5-50nt DNA of different sequences, namely DNA bar codes, at the 5' end for distinguishing different samples.

3. The primer set of claim 1, wherein the primers are useful for long fragment PCR amplification and detect cis-trans distribution of different mutations within the amplified product fragments using long fragment sequencing methods.

4. Kit for detecting multiple mutations of ADPKD in the same tube reaction system, comprising the following reagents:

(1) Reagents for performing multiplex long fragment PCR amplification in the same tube reaction system, wherein the reagents for PCR amplification comprise the primer set of any one of claims 1-3;

(2) Reagents for constructing long fragment sequencing libraries.

5. The kit of claim 4, wherein the kit can detect multiple mutations in ADPKD simultaneously in the same tube reaction system:

1) SNVs and indels on exons of PKD1 and PKD2 genes;

2) PKD1 and PKD2 intragenic deletions and duplications;

4) Over 2000 point mutations in the PKD1 and PKD2 genes.

6. The kit of claim 4, wherein the kit is used for long fragment PCR amplification and uses a method of long fragment sequencing to detect different mutational cis-trans distributions within the same amplified fragment.

7. The kit of claim 4, wherein the reagents for long fragment PCR amplification comprise a DNA polymerase, a reaction buffer, and primers.

8. The kit of claim 4, wherein the primer is the primer set of claim 1.

9. The kit of claim 4, wherein the reagents for constructing a long fragment sequencing library comprise a linker, a ligase, DNA purification magnetic beads, a reaction buffer, and an exonuclease.

10. The kit of claim 4, wherein the long fragment sequencing is selected from platforms based on single-molecule real-time Sequencing (SMRT) and Nanopore (Nanopore) technology.