CN117448342A - Application of SlPUT3 gene in inhibiting germination of tomato lateral branches - Google Patents

Application of SlPUT3 gene in inhibiting germination of tomato lateral branches Download PDF

Info

Publication number
CN117448342A
CN117448342A CN202310917245.XA CN202310917245A CN117448342A CN 117448342 A CN117448342 A CN 117448342A CN 202310917245 A CN202310917245 A CN 202310917245A CN 117448342 A CN117448342 A CN 117448342A
Authority
CN
China
Prior art keywords
tomato
gene
put3
germination
slput3
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310917245.XA
Other languages
Chinese (zh)
Inventor
钟珉
覃鸿毅
王国虎
岳玲琦
康云艳
杨暹
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
South China Agricultural University
Original Assignee
South China Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by South China Agricultural University filed Critical South China Agricultural University
Priority to CN202310917245.XA priority Critical patent/CN117448342A/en
Publication of CN117448342A publication Critical patent/CN117448342A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8205—Agrobacterium mediated transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Botany (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention relates to the technical field of agricultural biology, in particular to application of a PUT3 gene in inhibiting tomato lateral branch germination, wherein the nucleotide and amino acid sequences of the PUT3 gene are respectively shown as SEQ ID NO.1 and SEQ ID NO. 2; the tomato PUT3 gene is applied to regulating and controlling the germination of tomato side branches, and the lPUT3 gene is applied to inhibiting the germination of tomato side branches, so that the growth of plants can be effectively regulated and controlled by regulating and controlling the SlPUT3 gene.

Description

Application of SlPUT3 gene in inhibiting germination of tomato lateral branches
Technical Field
The invention relates to the technical field of agricultural biology, in particular to application of a PUT3 gene in inhibiting germination of tomato lateral branches.
Background
Tomato (Solanum lycopersicum) is the vegetable with the largest sowing area in facility cultivation in China, and has strong branching force. The branching mode of tomatoes is one of determining factors of indexes such as yield, quality and the like, the proper branching mode can improve yield and economic benefits, and excessive branching can cause a plurality of negative effects, such as excessive space density caused by excessive branching, and diseases can be caused; plants are easy to conceal each other when branches grow rapidly, so that nutrient consumption is caused; and the management input cost of pruning and branching and the like is increased. The research on tomato branching mechanism and the search of reasonable tomato plant type have important production value.
Polyamines (PAs) are a class of compounds containing two or more amino groups and play a wide variety of roles in plant growth and development processes and stress responses, and have been increasingly paid attention as a novel plant growth regulator. Putrescine (Put), spermidine (Spd) and spermine (Spm) are the major PAs in plants and are involved in the regulation of various physiological processes such as floral development, embryogenesis, organogenesis, senescence and fruit ripening development, as well as in responses to biotic and abiotic stresses. With the development of molecular biotechnology, there is growing evidence that the growth, yield and stress resistance of plants can be positively affected, both by exogenous application and by endogenous control of PAs production by genetic engineering.
PAs transport plays a critical role in regulating PAs levels in plant cells, and research finds that type I amino acid transporter (LAT) family transmembrane proteins play an important role in regulating PAs transport. Polyamine transport proteins AtPUT5, osPUT1, atPUT2, atPUT3 and OsPUT3 of arabidopsis thaliana and rice precisely regulate dynamic balance of spermidine, so that flowering time of plants is controlled. The arabidopsis put2 mutant excessively accumulates polyamine and is actively involved in phyA (phytochrome A) -mediated plant seed germination.
In Arabidopsis, the LHR1 gene encodes the polyamine transporter LHR1/PUT3, which is essential for extracellular polyamine uptake, and regulates the stabilization of endogenous PAs at elevated temperatures and thus parametersmRNA for several key heat stress genes. Found that plasma membrane Na + /H + Transporter SOS1 and protein kinase SOS2 are responsible for the maintenance of intracellular Na + And K + Both of the two important proteins in homeostasis, PUT3 and SOS1, can form complexes with the protein kinase SOS2 under stress conditions and regulate each other's transport activity through protein interactions and phosphorylation, thereby regulating salt tolerance in plants. Although the function of Put3 in plants is gradually recognized by people, it is still quite inadequate; therefore, there is a need for further intensive studies of the function of the Put3 gene.
Disclosure of Invention
The invention provides application of the SlPUT3 gene in inhibiting the germination of tomato lateral branches, aiming at the defects in the prior art, and the growth of plants can be effectively regulated by regulating the SlPUT3 gene.
In order to achieve the above purpose, the present invention provides the following technical solutions:
a tomato PUT3 gene is provided, and the nucleotide sequence of the PUT3 gene is shown as SEQ ID NO. 1.
Screening shows that the tomato SlPUT3 gene is related to development of tomato lateral branches, the lateral branch germination quantity of tomato SlPUT3 gene mutant put3 is obviously reduced compared with that of wild type Ailsa Craig (WT), and the gene can be used for breeding less-branched tomato varieties and improving tomato plant types.
The protein coded by the tomato PUT3 gene is provided, and the amino acid sequence of the protein is shown as SEQ ID NO. 2.
Provides an application of the tomato PUT3 gene in regulating and controlling the germination of tomato lateral branches.
The tomato PUT3 gene can regulate and control the germination quantity of the tomato lateral branches, so that the tomato lateral branches can be effectively inhibited from germination by regulating the tomato PUT3 gene on a tomato plant.
Provides an application of the tomato PUT3 gene in tomato plant breeding for reducing lateral branch germination.
Since the expression of the tomato PUT3 gene is found to be closely related to the germination quantity of the tomato lateral branches, the tomato variety with less tomato lateral branches can be screened out by identifying the expression condition of the tomato PUT3 gene in the tomato plant.
Provides a tomato plant type improvement method with less lateral branch germination, wherein the tomato PUT3 gene is silenced or knocked out.
The number of tomato side shoots can be reduced when the function of the SlPUT3 gene in tomatoes is reduced or deleted by gene silencing or knocking out.
In some embodiments, the silencing or knocking-out step comprises: designing a gene editing target sequence according to a tomato PUT3 gene target, and transferring the gene editing target sequence into a host cell to obtain a recombinant CRISPR vector;
and transferring the CRISPR vector into tomatoes through agrobacterium mediation to obtain gene editing tomato plants with improved plant types.
Designing a gene editing target sequence aiming at a tomato PUT3 gene target, loading the gene editing target sequence into a host cell, and introducing the gene editing target sequence into a tomato plant by the host cell as a carrier to edit the tomato PUT3 gene target, thereby silencing the tomato PUT3 gene or knocking out the SlPUT3 gene.
In some embodiments, the tomato PUT3 gene target has the sequence:
GTGTGGGTTTCATCTGCTTT; and ATGGGGGACTACAATGGTGC.
In some embodiments, the host cell is agrobacterium GV3101.
In some embodiments, the agrobacterium-mediated comprises: and (3) the CRISPR carrier containing the agrobacterium tumefaciens liquid is used for transfecting tomato cotyledons, seedlings are obtained again through tissue culture, and mutant plants with the PUT3 gene deletion are obtained through screening.
The invention is favorable for revealing molecular action mechanism of tomato lateral branch development, lays a foundation for creating new species of tomatoes with few branches and cultivating new varieties, improves the tomato light-simplified cultivation efficiency and reduces the production cost.
Drawings
FIG. 1 is a graph showing the detection results of a SlPUT3 knockout plant according to an embodiment.
FIG. 2 is a diagram of tomato less lateral mutant Slput3 and wild type Ailsa Craig plants according to an embodiment.
FIG. 3 is a graph comparing the side bud abortion of wild type control (WT) and tomato SlPUT3 knockout plants of the specific example embodiment.
FIG. 4 is a graph showing the comparison of the plant height of mutant Slput3 with the plant height of WT according to the embodiment.
FIG. 5 is a graph showing the comparison between the relative expression level of the SlPUT3 gene of the mutant Slput3 and the relative expression level of the SlPUT3 gene of WT according to the embodiment.
Detailed Description
Preferred embodiments of the present invention will be described in more detail below with reference to the accompanying drawings. While the preferred embodiments of the present invention are shown in the drawings, it should be understood that the present invention may be embodied in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.
Example 1
Cloning of tomato SlPUT3 gene and construction of knockout vector of tomato SlPUT3 gene
1. Tomato total RNA extraction
Extracting total RNA of tender tomato leaves by adopting Plant total RNAextraction kit (TIANGEN), wherein the method comprises the following steps:
(1) Grinding 0.1g tomato leaf in liquid nitrogen, adding 1mL lysate, and treating with a homogenizer;
(2) Placing the homogenate sample at 15-30deg.C for 5min to completely separate nucleic acid protein complex;
(3) Centrifuge at 12,000rpm for 5min at 4℃and remove supernatant and transfer to a new RNase-free centrifuge tube.
(4) Adding 200 mu L of chloroform, covering a tube cover, vigorously shaking for 15s, and standing at room temperature for 3min;
(5) Centrifugation at 12,000rpm at 4℃for 10min, the samples were divided into three layers: a yellow organic phase, an intermediate layer and a colourless aqueous phase, the RNA being predominantly in the aqueous phase, the volume of the aqueous phase being approximately 50% of the lysate RZ reagent used. Transferring the water phase into a new pipe for the next operation;
(6) Slowly add 0.5 times volume of absolute ethanol, mix well (precipitation may occur at this time). Transferring the obtained solution and the precipitate into an adsorption column CR3, centrifuging at 12,000rpm at 4deg.C for 30s, and discarding the waste liquid in the collection tube;
(7) Adding 500 mu L deproteinized solution RD into an adsorption column CR3, centrifuging at 12,000rpm at 4 ℃ for 30s, and discarding the waste liquid;
(8) 600. Mu.L of rinse liquid RW is added into an adsorption column CR3, the mixture is kept still at room temperature for 2min, and centrifuged at 12,000rpm for 30s, and the waste liquid is discarded;
(9) Repeating the operation step (8);
(10) Placing the adsorption column into a 2mL collecting pipe, centrifuging at 12,000rpm for 2min at 4 ℃ to remove residual waste liquid;
(11) Transferring the adsorption column CR3 into a new centrifuge tube, adding 50 mu LRNase-Free ddH2O, standing at room temperature for 2min, and centrifuging at 12,000rpm for 2min;
(12) The content and purity of the RNA samples were checked by UV spectrophotometry at OD260/OD280 at a concentration of 835 ng/. Mu.L and OD260/OD280 = 2.12.
2. Gene cloning and construction of knockout vector CRISPR/Cas9-PUT3 of tomato PUT3 gene
Using ReverTraAce qPCR RTKit (Toyobo), 1. Mu.g of tomato total RNA was reverse transcribed into cDNA.
The genomic sequence of tomato PUT3 was obtained by searching from the NCBI (http:// www.ncbi.nlm.nih.gov /) database of the website, the design of candidate targets GTGTGGGTTTCATCTGCTTT and ATGGGGGACTACAATGGTGC of the SlPUT3 gene sgRNA (small guide RNA) was performed using the website (http:// skl. Scau. Edu. Cn/targetdiesign /) CRISPR-GE, the two target sequences were inserted into a single guide RNA (sgRNA) expression cassette by overlap extension PCR, and then cloned into the pYLCRISPR/Cas9Pubi-H vector by the Golden Gate ligation method. The correctly sequenced pFGC1008-Put2-3HA and pYLCRISPR/Cas9Pubi-H-Put2 binary vectors were transformed into Agrobacterium tumefaciens GV3101 strain by point transfection.
(1) Construction of sgRNA expression cassette by overlay PCR method
In the first round of PCR, the target sequence was introduced downstream of the U3/U6 promoter and upstream of the sgRNA sequence.
The PCR reaction system is as follows:
and (3) setting PCR reaction conditions:
in the second round of PCR, the promoter, target and sgRNA are constructed into a complete expression cassette.
Reaction 1+reaction 2 dilution = reaction 1 product 1 μl+reaction 2 product 1 μl+ddh 2 The O8. Mu. LPCR reaction system is as follows:
and (3) setting PCR reaction conditions:
(2) Cloning of the sgRNA expression cassette into the pYLCRISPR/Cas9 vector
The PCR reaction system is as follows:
and (3) setting PCR reaction conditions:
example 2
Construction of tomato SlPUT3 Gene knockout transgenic plants
1 tomato Ailsa Craig seeds were soaked in tap water (or with shaker 28 ℃ C. 200 r/min) for 6-8h, then sterilized with 75% alcohol for 30sec, then sterilized in 10% NaClO for 15min (with shaker 28 ℃ C. 200 r/min), rinsed 3 times with sterilized distilled water and transferred to sterilization vessel, inoculated in 1/2MS medium. Culturing in dark at 25deg.C until germination, and transferring into illumination culture room under conditions of 25deg.C, 16 hr illumination/8 hr darkness, and illumination intensity of 1800lx.
2 preparation of explants and cultivation of Agrobacterium
6d after germination of the seeds, cutting off the cotyledons of the aseptic seedlings by a knife, putting the cotyledons with a small section of petioles into a nursing culture medium KCMS for pre-culturing for 1d (the seeds are protected from light and are obtained overnight, and the overlength of nursing culture time is easy to cause overinfection). Single colonies of Agrobacterium were picked on LB plates containing antibiotics and inoculated into 20mL of LB containing antibiotics and incubated overnight at 28℃at 200r/min to mid-log (OD 600. Apprxeq.1.0, about 16-24 h). Shaking bacteria, and cutting cotyledon (inoculating for 12-20 hr).
3 conversion regeneration
3.1 infestation of
Transferring the cultured agrobacterium tumefaciens engineering bacteria A bacterial liquid containing the tomato SlPUT3 gene knockout carrier into a 10mL centrifuge tube (sealed by a sealing film), and centrifuging at 4 ℃ for 10min at 4000 r/min; pouring out the culture medium, adding the suspension culture medium MS0.2, and shaking uniformly. 3-4 dishes of cotyledon explants are transferred to a sterilization culture dish poured with MS0.2, the suspended bacterial liquid is poured into the culture dish until OD600 is approximately equal to 0.2-0.3 (7-8 mM S0.2, 2-3mL of the bacterial liquid is poured into the culture dish) and inoculated with infection for 4-5min, and the culture dish is gently rocked. The explants were transferred to sterile filter paper, the residual bacterial solution was blotted dry, inoculated back onto KCMS and co-cultured at 22℃for 2d (protected from light). The reverse side faces upwards.
3.2 Selective cultivation, regeneration
After co-cultivation, the explant is carefully transferred onto MRS1 (2Z+) and then transferred into MRS2 (0.2Z+) for cultivation after 2-3 weeks, and the polluted materials are cleaned in time in the cultivation process until regeneration buds grow out.
4. Rooting and transplanting of regenerated buds
When the regenerated buds grow to about 1cm, cutting off the buds (without cutting off the buds so as not to hurt rooting parts), and putting the buds into a rooting culture medium for rooting. Hardening seedlings of transformed seedlings which are good in rooting and grow to about 5cm after 2 weeks, transplanting the seedlings into disposable plastic cups, transplanting the seedlings into flowerpots after survival to obtain tomato SlPUT3 gene knockout plants, wherein the detection results of the tomato SlPUT3 gene knockout plants are shown in figure 1, and tomato few-side-branch mutants Slput3 and wild type Ailsa Craig plants are shown in figure 2.
The results showed that the tomato SlPUT3 knock-out plants had a side bud abortion (fig. 3) compared to the wild type control (WT), the mutant SlPUT3 had a significantly higher plant height than WT (fig. 4), and the mutant SlPUT3 had a significantly lower relative expression of the SlPUT3 gene than WT (fig. 5).
The nucleotide sequence of the tomato SlPUT3 is shown as SEQ ID NO. 1.
Wherein, the nucleotide sequence SEQ ID NO.1:
ATGGTGCCAACAACAACAACAACATCATCATCAGAAACTCTTCAAAATTCTTCAATTTCAGTAGCAGACAAGAAAACTTCTCAACAAAATGGTGATAACAACAATCAGGTTTTGAGGGGTGTAAATGTTGGAACCTTCAAAATTGAGTTGCATTTCTTCATGAAATTGAGGGTTTCAGCTCAAAGAGAAGCTGCAATTCCTATGGGGGACTACAATGGTGCTGAGTACATAGGGATTAACGAGGTTCCATCTCCTAGAGCAAATAATTCTAATAAAGTTTCACTTTTGCCATTAATTTTCCTTATTTTCTATGAGGTTTCTGGTGGACCTTTTGGTGTTGAGGACACTGTGCAAGCAGCTGGTCCTCTTTTTGCTCTTCTTGGATTCTTGATTTTCCCATTAATATGGAGTGTCCCTGAGGCACTTATTACTGCTGAAATGGGTACTATGTTCCCTGAGAATGGTGGTTATGTTGTGTGGGTTTCATCTGCTTTAGGTCCATACTGGGGGTTTCAACAAGGTTGGATGAAATGGCTGAGTGGAGTCATTGATAATGCACTTTACCCTGTTATGTTCTTAGATTACCTTAAATCAGCGATTCCTGCATTAGGTGGTGGCCTTCCTAGGATTGTAGCTGTTTTAGCACTTACTGTGGTTCTCACTTATATGAACTATAGAGGTTTAACTATTGTGGGATGGGTAGCTGTATCGCTTGGTATATTGTCGATGCTACCTTTTGTTGTTATGGGGCTTATTTCGATTCCCAAAATTAGGCCTGAGAGATGGTTGGTGGCAGATGTACATAGTATTGATTGGAACTTATATCTGAATACTCTTTTCTGGAATTTGAACTATTGGGATTCGATTAGTACTCTTGCTGGAGAAGTACGTAACCCGAAAAAGACTCTGCCTAAGGCTTTGTTTTATGCTGTGCTTTTAGTTGTGCTGTCTTATCTTTTCCCTTTGCTGATTGGTACTGGAGCTGTTCCACTCGAACGTGAATTGTGGACTGATGGATATTTCTCAGACATTGCGAAGATACTTGGTGGAGTTTGGCTCAGATTTTGGCTTCAAGGGGCTGCTGCAGTATCAAACATGGGTATGTTTGTAGCTGAAATGAGCAGTGACTCTTTTCAGTTACTTGGTATGGCTGAGAGGGGAATGCTCCCTGAGTTCTTCGCAAAGAGATCGCGTCATGGAACTCCAATACTTGGGATTATCTTCTCGGCTTCTGGTGTGCTTTTACTTTCATGGTTGAGCTTTCAGGAGATAGTAGCAGCAGAAAATTTCTTGTATTGCTTTGGAATGATCTTGGAATTTATAGCATTTGTATGGTTAAGGATTAAGTATCCAAATGCACCACGCCCGTTCAAGATACCGGGTGGAATAATTGGAGCCATCTTGTTGTGTGTACCTCCAGCCATTCTCATTGGTGTTGTATTGGCCTTCTCTACAATCAAAATTATGATTGTAAGCCTCGCTGCTGTTGCAATCGGGATGGTGTTGCAGCCATGCATTAAGCTTATCGAGAGGAAGAGATGGTTGAAGTTCTCAACTAGTTCAGATCTTCCTGATATCACAGCACATGGTCCATTAATTCGATGA
the amino acid sequence of the protein coded by the tomato SlPUT3 is shown as SEQ ID NO.2
Amino acid sequence SEQ ID No.2:
MVPTTTTTSSSETLQNSSISVADKKTSQQNGDNNNQVLRGVNVGTFKIELHFFMKLRVSAQREAAIPMGDYNGAEYIGINEVPSPRANNSNKVSLLPLIFLIFYEVSGGPFGVEDTVQAAGPLFALLGFLIFPLIWSVPEALITAEMGTMFPENGGYVVWVSSALGPYWGFQQGWMKWLSGVIDNALYPVMFLDYLKSAIPALGGGLPRIVAVLALTVVLTYMNYRGLTIVGWVAVSLGILSMLPFVVMGLISIPKIRPERWLVADVHSIDWNLYLNTLFWNLNYWDSISTLAGEVRNPKKTLPKALFYAVLLVVLSYLFPLLIGTGAVPLERELWTDGYFSDIAKILGGVWLRFWLQGAAAVSNMGMFVAEMSSDSFQLLGMAERGMLPEFFAKRSRHGTPILGIIFSASGVLLLSWLSFQEIVAAENFLYCFGMILEFIAFVWLRIKYPNAPRPFKIPGGIIGAILLCVPPAILIGVVLAFSTIKIMIVSLAAVAIGMVLQPCIKLIERKRWLKFSTSSDLPDITAHGPLIR
according to the invention, the SlPUT3 gene is cloned from tomatoes, and transgenic experiments prove that the lateral branch germination quantity of the mutant SlPUT3 after the mutation of the tomato SlPUT3 gene is reduced compared with that of a wild type Ailsa Craig', and the gene can be used for screening less-branched tomato varieties and improving tomato plant types. The research is favorable for revealing the molecular action mechanism of the development of the lateral branches of the tomatoes, lays a foundation for the creation of new species and the cultivation of new varieties of the tomatoes with few branches, improves the light simplified cultivation efficiency of the tomatoes, and reduces the production cost.
The above description is only of the preferred embodiments of the present invention and is not intended to limit the present invention, but various modifications and variations can be made to the present invention by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims (9)

1. A tomato PUT3 gene is characterized in that the nucleotide sequence of the PUT3 gene is shown as SEQ ID NO. 1.
2. A protein encoded by the tomato PUT3 gene of claim 1, wherein the amino acid sequence of said protein is shown in SEQ ID No. 2.
3. Use of the tomato PUT3 gene of claim 1 in regulating tomato lateral branch germination.
4. Use of the tomato PUT3 gene of claim 1 in breeding tomato plants that reduce lateral shoot germination.
5. A method for improving tomato plant type with little lateral branch germination, which is characterized in that the tomato PUT3 gene of claim 1 is silenced or knocked out.
6. The method for improving tomato plant type with low lateral branch germination according to claim 5, wherein the silencing or knocking out comprises the following steps: designing a gene editing target sequence according to a tomato PUT3 gene target, and transferring the gene editing target sequence into a host cell to obtain a recombinant CRISPR vector; and transferring the CRISPR vector into tomatoes through agrobacterium mediation to obtain gene editing tomato plants with improved plant types.
7. The method for improving tomato plant type with low lateral branch germination according to claim 6, wherein the sequence of the tomato PUT3 gene target is:
GTGTGGGTTTCATCTGCTTT; and ATGGGGGACTACAATGGTGC.
8. The method for improving tomato plant type with low lateral branch germination according to claim 6, wherein said host cell is agrobacterium GV3101.
9. The method for improving tomato plant type with less side branch germination according to claim 6, wherein said agrobacterium mediation is according to the following steps: and (3) impregnating a CRISPR vector containing agrobacterium tumefaciens bacteria liquid with ordinary wild tomato cotyledons, recovering seedlings through tissue culture, and screening to obtain a PUT3 gene deleted mutant plant.
CN202310917245.XA 2023-07-25 2023-07-25 Application of SlPUT3 gene in inhibiting germination of tomato lateral branches Pending CN117448342A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310917245.XA CN117448342A (en) 2023-07-25 2023-07-25 Application of SlPUT3 gene in inhibiting germination of tomato lateral branches

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310917245.XA CN117448342A (en) 2023-07-25 2023-07-25 Application of SlPUT3 gene in inhibiting germination of tomato lateral branches

Publications (1)

Publication Number Publication Date
CN117448342A true CN117448342A (en) 2024-01-26

Family

ID=89580568

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310917245.XA Pending CN117448342A (en) 2023-07-25 2023-07-25 Application of SlPUT3 gene in inhibiting germination of tomato lateral branches

Country Status (1)

Country Link
CN (1) CN117448342A (en)

Similar Documents

Publication Publication Date Title
CN107338230B (en) The application of OsMPK11 albumen and its encoding gene in regulation plant drought resistance
CN113604497A (en) Genetic transformation method of gramineous plants
CN110885842A (en) Application of tomato TGase gene in improvement of abiotic stress resistance of tomato
CN102154314B (en) Photoinduced cotton anthocyanidin synthesis regulatory gene GhMYBAP (Gossypium hirsutum Anthocyanin Promoting MYB) and application thereof
CN102399271A (en) Protein used for controlling sizes of seeds and organs, coding gene thereof, and application thereof
CN117448342A (en) Application of SlPUT3 gene in inhibiting germination of tomato lateral branches
KR20080067435A (en) The production of fruit tree for transforming tree form by using mads-box gene
CN115058433A (en) Tobacco leaf yellowing regulation gene NtMYB2, protein and application thereof
CN116286863B (en) Application of polynucleotide in promoting growth of orchid plant buds
CN115704036B (en) Tobacco NtDSR1 gene and application thereof
Xu et al. High-efficiency agrobacterium-mediated transformation of chrysanthemum via vacuum infiltration of internode
CN115704035B (en) Tobacco NtDSR2 gene and application thereof
CN115058432B (en) Tobacco NtWRKY51 gene and application thereof in regulation and control of bacterial wilt resistance of tobacco
CN116063433B (en) Gene for regulating oil content of rape seeds and application thereof
CN116004646B (en) Tobacco NtSWEET gene and application thereof
CN115806999B (en) Tobacco NtEIJ gene and application thereof
CN116004647B (en) Tobacco NtSWEET gene and application thereof
CN114292320B (en) Peanut SL type oil body protein gene AhOLE2 and application thereof in improving salt tolerance of plants
Gea et al. Introduction of Hd3a gene in IPB CP1 potato cultivar through Agrobacterium tumefaciens-mediated transformation under the control of use 35S CaMV promoter
CN116375835B (en) Application of Yan flower MYB4b protein in regulation and control of plant leaf morphology
CN117187294B (en) Application of BnaC5.ACBP4 gene in improving flooding resistance of plants
CN113913441B (en) Application of rice nascent polypeptide binding complex alpha subunit NACA gene in osmotic stress resistance of plants
KR101238259B1 (en) ADH gene increasing seed germination of plant at anaerobic condition and uses thereof
CN117402892A (en) Pear Pybbx24 gene mutation and application of dwarfing function thereof
CN117343955A (en) Method for improving salt tolerance of rice by OsZNF9 gene and application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination