CN117305312B

CN117305312B - Determinant Zfh3 of mulberry leaf for silkworm to specifically eat and application of determinant

Info

Publication number: CN117305312B
Application number: CN202311357687.XA
Authority: CN
Inventors: 邹云龙; 童晓玲; 代方银; 唐玉霞; 胡海
Original assignee: Southwest University
Current assignee: Southwest University
Priority date: 2023-10-19
Filing date: 2023-10-19
Publication date: 2024-08-20
Anticipated expiration: 2043-10-19
Also published as: CN117305312A

Abstract

The invention discloses a determinant Zfh of mulberry leaf of silkworm for special feeding and application thereof, and also provides a preparation method of broad-feeding silkworm. The invention changes the expression quantity of the gene and protein products by targeting the Zfh gene of the silkworm and carrying out genetic modification operation on the gene, thereby changing the predatory property of the silkworm to the mulberry leaf and leading the silkworm to be capable of eating various non-mulberry plants such as cabbage, apples and the like. The invention provides a gene target Zfh gene for obtaining a wide-feeding silkworm variety, which is favorable for solving the problems of cultivation and production application of the silkworm variety with wide feeding and excellent adaptability to artificial feed.

Description

Determinant Zfh3 of mulberry leaf for silkworm to specifically eat and application of determinant

Technical Field

The invention belongs to the technical research field of silkworms, and particularly relates to a determinant Zfh of silkworm special feeding mulberry leaves and application thereof.

Background

Silkworm is not only an important economic insect, but also a well-known oligophagy insect, mainly fed on mulberry leaves, so that the silkworm is an important model for researching the feeding habits of insects as a typical model of lepidoptera. To date, the silkworm industry still belongs to the traditional labor-intensive industry, the growth of mulberry leaves is limited by seasons and regions, the time and the labor are consumed for picking and raising silkworms, and the efficiency is low. With the rapid development of economy and society, the conventional silkworm rearing mode, which consumes a great deal of manpower, material resources and land resources, is severely challenged. The industrial silkworm breeding with artificial feed becomes the future development direction of the silkworm industry, and the silkworm variety with good adaptability to the artificial feed is a necessary basis for realizing the industrial silkworm breeding with the artificial feed. However, the existing artificial feed silkworm varieties in China cannot completely meet the production requirement, and the effect of full-age artificial feed breeding is a certain gap from the level of Sang Sheyo, so that the requirement of accelerating the breeding of excellent artificial feed adaptation varieties is urgent, and the method has become an important limiting factor for realizing industrial silkworm breeding.

The development of genetic modification means such as gene editing, transgenosis and the like injects new vitality and hope into the cultivation of silkworm varieties, however, the key of cultivating artificial feed-adaptive silkworm varieties by the advanced breeding methods lies in the deep understanding of the genetic basis and regulation mechanism of silkworm feeding habits, and the method can be definitely used for modifying silkworm feeding habits so as to comprehensively adapt to molecular targets of artificial feed feeding. However, the molecular targets with breeding prospects have been found to be quite lacking so far, and the reported method is limited to the silkworm bitter receptor GR66, and after the gene is knocked out, the feeding habit of the silkworm is changed from the special feeding habit of the mulberry leaves to the wide feeding habit.

The feeding habits of silkworms are complex characters controlled by multiple genes, and sensory systems including taste sense and smell sense play an important role in synergy in the feeding process of silkworms. Therefore, by analyzing the genetic basis of silkworm feeding habits, more new key genes for regulating and controlling silkworm feeding habits are determined, and accurate and directional genetic operation is carried out on the key genes, the silkworm strain with good adaptability to artificial feed and good economical properties can be obtained quickly and efficiently. The Zfh gene in the patent is a very potential molecular target, and has an important determining function on the feeding habit of silkworm for exclusively feeding mulberry leaves.

Disclosure of Invention

Accordingly, the present invention is directed to providing a determining gene Zfh for a silkworm to specifically feed on mulberry leaves; the second purpose of the invention is to provide the application of knocking out or silencing the silkworm gene Zfh in the creation of a wide feeding strain of silkworm; the third object of the invention is to provide a method for creating a wide feeding strain of silkworms; the fourth object of the present invention is to provide a reagent or a compound which inhibits transcription, translation or function of the determinant Zfh of mulberry leaf which is fed exclusively by the silkworm.

In order to achieve the above purpose, the present invention provides the following technical solutions:

1. A mulberry leaf determinant Zfh for silkworm to specifically feed on, the nucleotide sequence of the gene comprising 1) and 2):

1) SEQ ID NO. 1;

2) A nucleotide sequence which is at least 70% identical to SEQ ID NO.1 and which expresses the same functional protein as the gene sequence.

Preferably, the amino acid sequence of the gene-encoded protein of the present invention comprises 1) and 2):

1) SEQ ID NO. 2;

2) A derivative protein which is formed by substituting, deleting or adding one or more amino acid residues in the amino acid sequence of SEQ ID NO.2 and has the same function as the protein; or a derivative protein having at least 50% homology with the amino acid sequence of SEQ ID NO.2 and having the same function as the protein.

2. The application of knocking out or silencing the silkworm gene Zfh in the creation of silkworm wide feeding strain.

3. A method for creating broad-feeding strain of silkworm features that the gene Zfh of silkworm is used as target to reduce or inhibit the transcription and translation of gene Zfh of silkworm.

Preferably, the methods of reducing or inhibiting include, but are not limited to, gene mutation, gene silencing, and gene knockout.

In the preferred method, a CRISPR/Cas9 system is adopted to carry out genetic modification operations such as gene editing and the like, so as to knock out Zfh genes.

Preferably, the expression level of Zfh genes of silkworms is down-regulated by knocking down or silencing Zfh genes by adopting interfering molecules which specifically interfere Zfh gene expression; specifically, the interfering molecule is dsRNA, antisense nucleic acid, small interfering RNA, or micro RNA taking Zfh genes or transcripts thereof as inhibition or silencing targets, or a construct capable of expressing or forming the dsRNA, the antisense nucleic acid, the small interfering RNA, or the micro RNA.

Preferably, the gene editing method is to select an sgRNA binding site for a protein coding region sequence of Zfh genes or a sequence of cis-regulatory elements such as a promoter, an enhancer and the like, synthesize an sgRNA sequence, mix the sgRNA with Cas9 protein or mRNA and inject the mixture into silkworm eggs just under birth.

It is further preferred in the present invention that the sgRNA binding site sequence is shown as SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO. 5.

4. An agent or compound for inhibiting transcription, translation or function of the determinant Zfh of mulberry leaf fed specifically to bombyx mori as claimed in claim 1 or 2.

The invention has the beneficial effects that:

according to the invention, through targeting the Zfh gene of the silkworm, the expression quantity is reduced, or the Zfh gene structure is destroyed, the predatory property of the silkworm to the mulberry leaf can be changed, so that the silkworm can eat non-mulberry plants such as cabbage, apples and the like. The invention can be used for cultivating silkworm materials and varieties which are widely edible and have excellent adaptability to artificial feed in silkworm production.

Drawings

In order to make the objects, technical solutions and advantageous effects of the present invention more clear, the present invention provides the following drawings for description:

FIG. 1 is a schematic structural diagram of silkworm Zfh gene and sgRNA target sequence, and the NGG sequence is represented in bold font;

FIG. 2 is a Zfh mutant type of knockout silkworm;

FIG. 3 shows Zfh gene knockout shows wide feeding habit, and can feed on non-mulberry plants such as cabbage, apples and the like.

Detailed Description

The present invention will be further described with reference to the accompanying drawings and specific examples, which are not intended to be limiting, so that those skilled in the art will better understand the invention and practice it. The experimental procedure, in which specific conditions are not noted in the examples, is generally carried out according to conventional conditions such as those described in the guidelines for molecular cloning experiments (third edition, J. Sam Brookfield et al), or according to the manufacturer's recommendations.

Example 1

Ribonucleoprotein-based CRISPR/Cas9 gene editing system knockout Zfh gene

(1) Selection of sgRNA binding sites and synthesis of sgrnas

The sequence of the sgRNA binding site present in the Zfh gene sequence (including the protein coding sequence and the cis regulatory element sequence) was designed using the website CHOPCHOP (http:// chopchop. Cbu. Uib. No /), and 3 sequences of the higher specific sgRNA binding site were selected. The nucleotide sequence of Zfh gene is shown as SEQ ID NO.1, and the amino acid sequence is shown as SEQ ID NO. 2. The schematic structure diagram of silkworm Zfh gene and sgRNA target sequence are shown in figure 1.

The sgRNA recognition target sequences are as follows (NGG sequences underlined):

sgRNA1 target: 5'-GTCGTCGTCTGGTTCGAGCGCGG-3' (SEQ ID NO. 3)

SgRNA2 target: 5'-CGGCTATCGACAATGCACCCAGG-3' (SEQ ID NO. 4)

SgRNA3 target: 5'-CGTTCGACGTCTGAGGAGAGGGG-3' (SEQ ID NO. 5)

Based on the selected sgRNA target sequence, the following primers were synthesized (the sgRNA target sequence is underlined):

zfh3-sgRNA-F1：

TAATACGACTCACTATAGGGTCGTCGTCTGGTTCGAGCGGTTTTAGAGCTAGAAAT AGC(SEQ ID NO.6)

zfh3-sgRNA-F2：

TAATACGACTCACTATAGGCGGCTATCGACAATGCACCCGTTTTAGAGCTAGAAA TAGC(SEQ ID NO.7)

zfh3-sgRNA-F3：

TAATACGACTCACTATAGGCGTTCGACGTCTGAGGAGAGGTTTTAGAGCTAGAAA TAGC(SEQ ID NO.8)

sgRNA-R(Universal)：

AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTA ACTTGCTATTTCTAGCTCTAAAAC(SEQ ID NO.9)

annealing and extension are carried out by using PRIMESTAR GXL DNA POLYMERASE high-fidelity polymerase produced by Takara company, and after PCR is completed, the template for in vitro transcription is obtained by cutting gel and recovering for purification. Next, sgRNA was synthesized by in vitro transcription using a T7 in vitro transcription kit manufactured by Promega corporation and purified.

SgRNA framework sequence:

TAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAA ATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGG TGCTTTT(SEQ ID NO.10)

(2) Silkworm embryo microinjection and knockout strain screening

Mixing sgRNA and Cas9 protein, wherein the final concentration of the sgRNA is 1000 ng/. Mu.L, the final concentration of the Cas9 is 500 ng/. Mu.L, incubating the mixed solution, reacting for 15min at 37 ℃, injecting into wild large silkworm eggs within 3h below the egg yield by a microinjection instrument, sealing the silkworm eggs by instant adhesive glue after injection, placing the silkworm eggs in an artificial climate incubator, carrying out incubation at 25 ℃ and 80% humidity, and observing the growth condition of the silkworm eggs every other day.

After the silkworm eggs are hatched, fresh mulberry leaves are fed to the silkworm eggs, the silkworm eggs are fed to a moth stage under proper temperature and humidity, wings of the silkworm moth are cut, genomic DNA is extracted, PCR amplification is carried out by using primers zfh-F4 and zfh-R4 at the upstream and downstream of 3 sgRNA targets, and mutation types are detected by sequencing.

zfh3-F4：ACGGATAAATTGATCGCGGC(SEQ ID NO.11)

zfh3-R4：GCACACTTCGCATCTGTAGG(SEQ ID NO.12)

And (3) screening the G ₀ generation silkworm moth containing the sequence mutation, carrying out mating, continuously breeding the produced silkworm eggs for several generations, and obtaining the mutation type of the coding region sequence of Zfh3 containing non-3 base multiples through screening, and obtaining the silkworm capable of being stably inherited, wherein the mutation type is shown in figure 2.

(3) Zfh3 Gene knockout silkworm feeding habit observation

And feeding cabbage and apples to the Zfh gene knockout silkworms obtained by screening, and selecting a wild large-sized strain as a control. The result shows that Zfh gene knockout silkworms can continuously feed cabbage and apples (shown in figure 3), and wild type large-sized silkworms refuse to feed the two non-mulberry plants.

The present invention of example 1 uses CRISPR/Cas9 mediated gene editing techniques to knock out Zfh genes, as is well known to those skilled in the art, any means that would enable the knock-out or knock-down of Zfh genes can achieve the objectives of the present invention. It will be appreciated by those skilled in the art that various modifications may be made to the invention without departing from the scope thereof as defined in the appended claims.

Finally, it is noted that the above embodiments are only for illustrating the technical solution of the present invention and not for limiting the same, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications and equivalents may be made thereto without departing from the spirit and scope of the present invention, which is intended to be covered by the claims of the present invention.

Claims

1. The application of the decision gene Zfh3 of the silkworm special feeding mulberry leaf in the creation of the silkworm wide feeding strain is characterized in that the amino acid sequence of the protein coded by the decision gene Zfh3 of the silkworm special feeding mulberry leaf is shown as SEQ ID NO.2, and the nucleic acid sequence of the decision gene Zfh3 of the silkworm special feeding mulberry leaf is shown as SEQ ID NO. 1.

2. A method for creating a wide feeding strain of silkworms is characterized by comprising the following steps: the silkworm gene Zfh shown in SEQ ID NO.1 is used as a target to reduce or inhibit transcription and translation of the silkworm gene Zfh.

3. The method of claim 2, wherein the method of reducing or inhibiting comprises, but is not limited to, gene silencing and gene knockout.

4. The method of claim 3, wherein the gene knockout is performed by: genetic modification operations such as gene editing and the like are carried out by adopting a CRISPR/Cas9 system, and Zfh genes are knocked out.

5. The method of claim 3, wherein the expression level of the Zfh gene of bombyx mori is down-regulated by knocking out or silencing Zfh3 gene with an interfering molecule that specifically interferes with Zfh gene expression; the interfering molecule is dsRNA, antisense nucleic acid, small interfering RNA, or micro RNA taking Zfh genes or transcripts thereof as inhibiting or silencing targets, or a construct capable of expressing or forming the dsRNA, the antisense nucleic acid, the small interfering RNA, or the micro RNA.

6. The method of claim 4, wherein the gene editing method is to select a sgRNA binding site for a sequence of a protein coding region of Zfh genes or a sequence of cis-regulatory elements such as a promoter and an enhancer, synthesize a sgRNA sequence, mix the sgRNA with Cas9 protein or mRNA, and inject the mixture into newly produced silkworm eggs.

7. The method of claim 6, wherein the sgRNA binding site sequence is set forth in SEQ ID No.3, SEQ ID No.4, or SEQ ID No. 5.