CN107619836B - System for reducing activity 20E concentration in spinning period, changing silk pupa nutrition distribution proportion and increasing silkworm cocoon yield, application and method - Google Patents

Abstract

The invention relates to a system for reducing the concentration of 20E activity in the spinning period, changing the nutrition distribution proportion of silk pupae and increasing the yield of silkworm cocoons, and an application and a method thereof.A Gal4/UAS binary system is used for expressing exogenous protein EGT in the terminal silkworm to prolong the spinning period of the silkworm and increase the yield of silk, in the system, GAL4 gene is started to express by BmLP3, the UAS is used for regulating the expression of the EGT, the GAL4/UAS system takes silkworm fat as a bioreactor, and the promoter of the silkworm LP3 gene skillfully expresses 20E inactivated protein-EGT in the silkworm fat in the spinning period, the protein is secreted into the silkworm haemolymph in the spinning period to prevent the silkworm pupae from being metamorphosed, so that the silkworm spinning period is successfully prolonged, the yield of the silkworm cocoons is increased, and a thought is provided for reducing the cost of silkworm breeding.

Description

System for reducing activity 20E concentration in spinning period, changing silk pupa nutrition distribution proportion and increasing silkworm cocoon yield, application and method

Technical Field

The invention belongs to the field of genetic engineering, and particularly relates to a system for reducing the distribution proportion of activity 20E concentration change pupa nutrition in a spinning period and increasing the yield of silkworm cocoons, application of the system and a method for reducing the distribution proportion of activity 20E concentration change pupa nutrition in the spinning period and increasing the yield of silkworm cocoons.

Background

The silkworm has important economic value due to the unique spun silk characteristics, so that the silk yield is improved on the basis of not increasing the previous silkworm breeding period by distributing the substances and energy accumulated in the silkworm larva stage to the direction of the silkworm cocoon as much as possible, and the silk yield is always the most keen topic of related practitioners. But the breeding of high silk quantity silkworm varieties by traditional breeding almost reaches the limit. China is a world silkworm breeding big country, and silkworm cocoons are produced tens of thousands of tons every year, so that the modern molecular biology technology becomes an important means for further improving the silk spinning quantity of the silkworms.

Silkworm is a completely metamorphotic insect, and one life cycle is subject to four completely different development stages of egg, larva, pupa and moth in morphological structure and function. The pupal stage is the metamorphosis stage of the transition of the terminal larva of the silkworm to the imago, wherein the stage from the later stage of the terminal larva to the prophase of the pupal is the most critical stage for the nutrition and material distribution of the silkworm: the end-aged larva stops eating, silks and cocoons, completes the conversion from larva to pupa in the cocoon layer, and distributes energy and substances to the silkworm cocoons for protecting the larva and the pupas which continue to develop backwards. The material and energy distributed into the cocoons and pupae showed significant genetic characteristics, with a high positive correlation between cocoon weight and pupae weight (correlation coefficient 0.85, usually measured as cocoon weight/(cocoon weight + pupae weight) × 100%).

It has been shown that the lepidopteran insect terminal larva-pupa metamorphosis process is accomplished under the control of ecdysone (20-hydroxybydysone, 20E). The appearance of prepupa after the silkworm silking is finished under the precise control of 20E, in fact, the 20E concentration of the silkworm in the silking period before the prepupa appears is not high, and the silking is finished after the 20E concentration in the body enters a very high level, at the moment, the high concentration 20E in the silkworm hemolymph promotes the degradation of larva tissue organs including silk glands, and simultaneously induces the formation of the tissue organs in the pupal period to promote the silkworm to pupate. Ecdysteroid uridine diphosphate glucose transferase (EGT) is capable of transferring UDP-glucoside to the hydroxyl group at the 22 nd carbon atom of ecdysone (20E) to form the inactive 20E complex-20E-22- β -D-glucopyranoside. When an insect is infected with such a virus, the EGT secreted by this virus can inactivate 20E in the body of the insect, preventing normal molting and feathering of the insect.

Because the EGT has toxic and lethal effects on the silkworms, the EGT protein cannot be preserved and utilized in production no matter what way is adopted to directly express the EGT protein. The GAL4/UAS binary system constructed by the invention is utilized to store lethal genes; the system comprises two transgenic lines, UAS and GAL 4. In the UAS-target gene system, no transcriptional activator protein exists, and the target gene is in a silent state; in the GAL4 transgenic line, a transcriptional activator is present, but there are no regulatory sequences and associated target genes, and progeny expressing the target genes can only be generated by crossing the GAL4 transgenic line with the UAS transgenic line. Thus, the UAS transgenic line survives without activation of GAL4 even though the target gene is a lethal gene. A GAL4/UAS binary hybridization system can be used for constructing a GAL4 transgenic line with period and tissue specificity so as to form a GAL4 transgenic line library, and the GAL4 transgenic line with period and tissue specificity in the library is selected to be hybridized with a UAS-target gene transgenic line so as to regulate and control the specific expression of a target gene. In addition, the EGT can reduce the activity of 20E, and the silkworms can purify and further utilize the EGT after silking.

BmLP3 is a protein specifically expressed by fat bodies from late stage to early stage of pupae of terminal-age silkworms, and has been reported to have a tissue and period specific promoter sequence, and the tissue and period of the sequence driving the expression of red fluorescent protein are consistent with the endogenous LP3 protein. And the active exogenous protein-phytase is successfully used to express in the fat body of the later five-year-old silkworm.

Disclosure of Invention

In view of the above, an object of the present invention is to provide a system for increasing silkworm cocoon yield by reducing the concentration of 20E in the silking period activity, changing the nutrient distribution ratio of silkworms, maintaining 20E in the silking period at a low level by using LP3 to drive EGT protein expression, and increasing the time for nutrient flow to the silkworm cocoon by prolonging the silking period time and delaying the nutrient distribution to the pupa time point, thereby increasing silkworm cocoon yield; the third purpose is to provide the application of the system in improving the yield of silkworm cocoons; the invention also aims to provide a method for reducing the activity 20E concentration in the spinning period, changing the nutrient distribution proportion of silk pupae and increasing the yield of silkworm cocoons by using the system.

The foreign protein is used for reducing the ecdysone content in the silk spinning period of the silkworms to prolong the silk spinning period of the silkworms, thereby increasing the yield of silkworm cocoons.

In order to achieve the above purpose, the invention provides the following technical scheme:

1. a system for reducing the concentration of 20E activity in the spinning period, changing the nutrition distribution proportion of silk pupae and increasing the yield of silkworm cocoons comprises a GAL4/UAS binary system, wherein the GAL4 gene is expressed by BmLP3, the UAS regulates the expression of EGT, the nucleotide sequence of the BmLP3 is shown as SEQ ID No.1, the nucleotide sequence of the EGT gene is shown as SEQ ID No.2, the nucleotide sequence of the GAL4 gene is shown as SEQ ID No.3, and the nucleotide sequence of the UAS is shown as SEQ ID No. 4.

Preferably, the GAL4/UAS binary system is respectively positioned on two vectors which are respectively marked as a recombinant transgenic vector A and a recombinant transgenic vector B, and the recombinant transgenic vector A contains an expression frame for promoting GAL4 gene expression by BmLP 3; the recombinant transgenic vector B contains an expression frame for regulating and controlling EGT expression by UAS.

Preferably, the recombinant transgenic vector A is prepared by the following method: the gene group of silkworm variety dazao is used as a template, LP3 promoter sequence is amplified and is connected to Sal I/BamH I enzyme digestion site of pSL1180 plasmid to obtain pSL1180[ LP3-SV40] vector, and the synthesized GAL4 nucleic acid sequence is connected to BamH I/Not I enzyme digestion site of pSL1180[ LP3-SV40] vector to obtain pSL1180[ LP3-GAL4-SV40] intermediate vector. Further, pSL1180[ Lp3-GAL4-SV40] intermediate vector plasmid and pBac [3xP3-EGFP ] plasmid are subjected to single enzyme digestion by AscI, an expression frame and a vector skeleton which contain BmLP3 and start GAL4 gene expression are respectively recovered, and a recombinant transgenic vector A is obtained by connection and is named as pBac [3xP3-EGFP, BmLP3-GAL4-SV40 ].

Preferably, the recombinant transgenic vector B is prepared by the following method: by taking a bombyx mori nuclear polyhedrosis virus BmNPV genome as a template, amplifying an EGT gene and connecting the EGT gene to an EcoR I/Xho I enzyme digestion site of a pSL1180 plasmid to obtain an intermediate vector pSL1180[ EGT-SV40], synthesizing a UAS nucleic acid sequence and connecting the UAS nucleic acid sequence to an Asc I/EcoRI enzyme digestion site of the intermediate vector pSL1180[ EGT-SV40] to obtain a recombinant vector pSL1180[ UAS-EGT-SV40], then respectively performing single enzyme digestion on the recombinant vector pSL1180[ UAS-EGT-SV40] and a pBac [3xP3-DsRed ] plasmid by using Asc I, respectively recovering an expression frame and a vector skeleton containing UAS regulation EGT expression, and connecting to obtain a recombinant transgenic vector B which is named as pBac [3xP3-DsRed, UAS-EGT-SV40 ].

2. The method for preparing the silkworm cocoon with the concentration of 20E for reducing the activity in the spinning period, the ratio of the silk pupa to the nutrition distribution and the yield increase of the silkworm cocoons by using the system comprises the following steps: mixing a recombinant transgenic vector A containing BmLP3 start GAL4 gene expression with an auxiliary plasmid, injecting a silkworm egg with diapause removed, and screening a positive transgenic silkworm after hatching to prepare a transgenic silkworm GAL4 system; then mixing a recombinant transgenic vector B containing UAS (upflow anaerobic digestion) regulation EGT expression with an auxiliary plasmid, injecting a silkworm egg with diapause removed, and screening a positive transgenic silkworm after hatching to prepare a transgenic silkworm UAS-EGT system; then the transgenic silkworm GAL4 system and the transgenic silkworm UAS-EGT system are hybridized, and the silkworm eggs containing GAL4 and EGT genes are screened, so that the transgenic silkworm material which can prolong the silking period of the silkworms and increase the silkworm cocoon yield by reducing the ecdysone content in the silking period of the silkworms through exogenous protein is obtained.

Furthermore, the recombinant transgenic vector containing BmLP3 to start GAL4 gene expression is obtained by performing single enzyme digestion on pSL1180[ Lp3-GAL4-SV40] plasmid and pBac [3xP3-EGFP ] plasmid by AscI, respectively recovering an expression frame containing BmLP3 to start GAL4 gene expression and a vector skeleton, connecting the expression frame and the vector skeleton to obtain the recombinant transgenic vector, wherein the pSL1180[ Lp3-GAL4-SV40] plasmid is prepared by connecting an LP3 promoter sequence into a Sal I/BamH I enzyme digestion site of pSL1180 plasmid to obtain a pSL1180[ Lp3-SV40] vector, and then performing BamH I/NotI enzyme digestion on the GAL4 gene L1180[ Lp3-SV40] vector.

Further, the recombinant transgenic vector B containing UAS regulation EGT expression is prepared by connecting EGT gene to EcoR I/Xho I enzyme cutting site of pSL1180 plasmid to obtain intermediate vector pSL1180[ EGT-SV40], then connecting UAS fragment to Asc I/EcoR I enzyme cutting site of intermediate vector pSL1180[ EGT-SV40] to obtain recombinant vector pSL1180[ UAS-EGT-SV40], then performing single enzyme cutting on recombinant vector pSL1180[ UAS-EGT-SV40] and pBac [3xP3-DsRed ] plasmid by Asc I respectively, recovering expression frame and vector skeleton containing UAS regulation EGT expression respectively, and finally connecting.

Further, screening of the silkworm eggs containing both GAL4 and EGT genes is to screen the hatching of silkworm eggs capable of detecting both red and green fluorescence.

Further, the helper plasmid is the pHA3PIG plasmid.

The invention has the beneficial effects that: the invention discloses a protein EGT for inactivating 20E in a silkworm fat body in a spinning period skillfully expressed by a promoter of a silkworm LP3 gene by using a transgenic technology and the silkworm fat body as a bioreactor through a GAL4/UAS system. The protein is secreted into the haemolymph of the silkworm in the spinning period to reduce the content of the activity 20E in the haemolymph, so that the spinning period of the silkworm is prolonged, a transgenic silkworm material with increased silkworm cocoon yield is successfully obtained, and a thought is provided for improving the silkworm cocoon yield and reducing the silkworm breeding cost. In addition, silkworm fat bodies are successfully used as bioreactors, the protein EGT with general toxicity to lepidoptera insects is expressed, and a foundation is laid for improving the overall economic value of silkworms by subsequently developing the EGT into insecticides.

Drawings

In order to make the object, technical scheme and beneficial effect of the invention more clear, the invention provides the following drawings for explanation:

FIG. 1 shows a schematic diagram of a transgenic vector (A: pBac [3xP3-EGFP, BmLP3-GAL4-SV40] vector, B: pBac [3xP3-DsRed, UAS-EGT-SV40] vector, C: pBac [3xP3-EGFP, BmLP3-GAL4-SV40] vector plasmid Asc I single-enzyme-digestion electrophoresis detection, D: pBac [3xP3-DsRed, UAS-EGT-SV40] vector plasmid Asc I single-enzyme-digestion electrophoresis detection).

FIG. 2 shows the positive transgenic screening (fluorescence detection of BmLP3-GAL4 transgenic bombyx mori in A1/A2: G0 generation, fluorescence detection of UAS-EGT transgenic bombyx mori in A3/A4: G0 generation, and fluorescence detection of silkworm eggs after hybridization of BmLP3-GAL4 and UAS-EGT transgenic bombyx mori).

FIG. 3 shows the investigation of relative traits such as cocoon layer ratio and cocooning frame ratio of transgenic hybrid lines (A: the number of days for silkworm to eat by terminal larva; B: the spinning duration (spinning period); C: cocoon layer ratio; and D: cocooning frame ratio).

FIG. 4 shows preferred transgenic hybrid phenotypes (A: cocoon appearance; B: cocoon section; C: phenotype of day 15 after cocooning of the filial generation; D: phenotype of day 45 after cocooning of the filial generation).

FIG. 5 is a diagram showing the EGT expression detection of transgenic hybrid lines (A: GAL4/EGT expression detection in fat body after mounting and B: EGT protein detection in hemolymph after spinning).

FIG. 6 is a preliminary evaluation chart of toxicity of transgenic hybrid strain EGT to lepidoptera insects (A: taking silkworm death phenotype containing EGT silkworm chrysalis powder, B: taking silkworm death time statistics containing EGT silkworm chrysalis powder, and C: taking silkworm death rate statistics containing EGT silkworm chrysalis powder).

Detailed Description

Preferred embodiments of the present invention will be described in detail below with reference to the accompanying drawings.

In the following examples of the present invention, the UAS fragment containing AscI/EcoR I and GAL4 fragment containing BamH I/Not I were synthesized by Kinsley, and the basic plasmids pSL1180, pBac [3xP3-EGFP ], pBac [3xP3-DsRed ] and the helper plasmid pHA3PIG for transgenic injection were stored in the laboratory. The bivoltine silkworm variety for transgenic injection is provided by a silkworm gene resource library of southwest university.

Example 1 obtaining of transgenic vectors for silkworms

First, pBac [3xP3-EGFP, BmLP3-GAL4-SV40] vector construction

LP3 promoter nucleic acid sequence acquisition

The gene group of the silkworm variety dazao is taken as a template, and a forward primer 5-gcgtcgacagtatagtta caacggc-3' (the restriction site for Sal I is underlined) (SEQ ID NO.14), and the reverse primer 5-cgggatccaaagtgtgctatatgattc-3' (the restriction sites of BamH I are underlined) (SEQ ID NO.15) amplified LP3 promoter sequence, conditions for sequence amplification: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 seconds, annealing at 60 ℃ for 30 seconds, extension at 72 ℃ for 60 seconds, and circulation for 30 times; final extension at 72 ℃ for 10min and storage at 4 ℃. And (3) carrying out electrophoresis on the PCR amplification product by using 1% agarose gel, carrying out EB (Epstein-Barr) staining, cutting off a rubber strip containing the target fragment by using a blade under ultraviolet light, recovering the target fragment by using a rubber recovery kit, and sequencing the LP3 nucleic acid sequence shown as SEQ ID NO. 1.

Construction of pSL1180[ LP3-GAL4-SV40] intermediate vector

And D, carrying out double digestion on the target fragment recovered in the step A and the pSL1180 plasmid by using Sal I/BamH I respectively, recovering a target gene fragment and a vector fragment, and constructing a vector pSL1180[ LP3-SV40] after connection and transformation. Further, plasmid pSL1180[ LP3-SV40] and GAL4 fragment (GAL4 gene sequence is shown in SEQ ID NO. 3) containing BamH I/Not I cleavage sites synthesized by the company were digested simultaneously with BamH I/Not I, respectively, to recover the target gene fragment and vector fragment, and the intermediate vector pSL1180[ LP3-GAL4-SV40] was constructed after ligation transformation.

C.pBac [3xP3-EGFP, LP3-GAL4-SV40] transgenic vector construction

pSL1180[ Lp3-GAL4-SV40] plasmid and pBac [3xP3-EGFP ] plasmid are subjected to single enzyme digestion by AscI, and a target fragment and a vector fragment are recovered and then are subjected to ligation transformation to construct a transgenic vector pBac [3xP3-EGFP, BmLP3-GAL4-SV40], and the single enzyme digestion verification of the AscI is carried out (such as A and C in FIG. 1).

Second, pBac [3xP3-DsRed, UAS-EGT-SV40] vector construction

EGT Gene sequence acquisition

Forward and reverse amplification primers were designed for the sequence based on the full length cds (coding domain sequence) sequence of the EGT gene using primer 5.0 software, BmEGT-F: 5' -ccggaattcatgactattctttgctggct-3' (SEQ ID NO.5) (restriction sites for EcoRI are underlined), BmEGT-R:

(SEQ ID NO.6) (Myc tag shaded, XhoI restriction site underlined). PCR amplification is carried out by taking a BmNPV genome as a template, and the sequence amplification conditions are as follows: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 40 seconds, annealing at 56 ℃ for 30 seconds, extension at 72 ℃ for 1min 30 seconds, and circulation for 25 times; final extension at 72 ℃ for 10min and storage at 4 ℃. And (3) carrying out electrophoresis on the PCR amplification product by using 1% agarose gel, carrying out EB (Epstein-Barr) dyeing, cutting off an adhesive tape containing the target fragment by using a blade under ultraviolet light, recovering the target fragment by using a gel recovery kit, and sequencing the EGT gene sequence shown as SEQ ID No. 2.

Construction of the intermediate vector pSL1180[ UAS-EGT-SV40]

And D, carrying out double enzyme digestion on the target fragment recovered in the step A and the plasmid pSL1180 by using EcoR I/Xho I respectively, recovering a target gene fragment and a vector fragment, and constructing a vector pSL1180[ EGT-SV40] after connection and transformation. Further carrying out double enzyme digestion on pSL1180[ EGT-SV40] plasmid and a company-synthesized UAS fragment containing AscI/EcoR I by using AscI/EcoR I respectively, recovering a target gene fragment and a vector fragment, constructing a vector pSL1180[ UAS-EGT-SV40] after connecting and transforming, and carrying out sequencing verification, wherein the sequence of the vector pSL1180[ UAS-SV 40] is shown as SEQ ID NO.7, and the sequence of the UAS gene is shown as SEQ ID NO. 4.

C.pBac [3xP3-DsRed, UAS-EGT-SV40] transgenic vector construction

pSL1180[ UAS-EGT-SV40] plasmid and pBac [3xP3-DsRed ] plasmid are subjected to single enzyme digestion by AscI, and a target fragment and a vector fragment are recovered and then are connected and transformed to construct a transgenic vector pBac [3xP3-DsRed, UAS-EGT-SV40], and the single enzyme digestion verification of the AscI is carried out (such as B and D in figure 1).

Example 2 obtaining of transgenic silkworms

pHA3PIG (Tamura et al.2000) is taken as an auxiliary plasmid, and is respectively mixed with pBac [3xP3-EGFP, BmLP3-GAL4-SV40] and pBac [3xP3-DsRed, UAS-EGT-SV40] plasmids in a molar ratio of 1:1, then the mixture is subjected to microinjection to large-sized early embryos (2-5 h after spawning) with diapause removed, the silkworm eggs after the injection are sealed by nontoxic dehydration, the silkworm eggs after the injection are subjected to incubation at 25 ℃ until hatching, the hatched larvae (G0 generation) are normally bred, after the adults are detected under a macroscopic stereovision fluorescence microscope (Olypus MVX10, Japan), transgenic positive individuals (A in figure 2) generating specific excitation fluorescence in eyes are screened out, the silkworm eggs are bred, G1 generation silkworm eggs are obtained, the fluorescent positive silkworm eggs are selected, and are continuously bred to obtain BmLP3-Gal4 and UAS-EGT transgenic lines. The two groups of obtained transgenic silkworm are hybridized, eggs laid by the silkworm are subjected to fluorescence screening (B in figure 2), silkworm eggs capable of detecting red fluorescence and green fluorescence at the same time are hatched, the silkworm eggs are conventionally fed, counting spinning periods, cocoon layer rates and the like after mounting, the expression conditions of GAL4 and EGT are detected, the effectiveness of a Gal4/UAS system is analyzed, the effectiveness of the EGT is analyzed, and the toxicity of the transgenic silkworm containing the EGT after spinning is evaluated.

The results showed that, when silkworm eggs (B in fig. 2) in which green and red fluorescence was detected simultaneously after hybridization were incubated and were then normally kept at five ages (terminal age), the silkworms were significantly increased in silking period (B in fig. 3) and cocoon layer rate (C in fig. 3) as compared with the control, although the mulberry feeding time of the hybrid silkworms was somewhat prolonged (a in fig. 3). Further investigation finds that the expression of EGT may have certain influence on silkworm cocooning (D in figure 3), a transgenic line E4G with relatively excellent cocoon layer rate, spinning period and cocooning rate is selected for further investigation, the E4G silkworm cocoon is obviously larger (A in figure 4), the silkworm cocoon on the seventh day after the cocoon is cocooned is split, and the development condition of the silkworm after the spinning is observed: it can be seen that silkworms of the control group had pupated, while silkworms of the experimental group were still in a pre-pupated state after silking (B in fig. 4). After silkworms in the experimental group were taken out from the silkworm cocoons and left at room temperature for 15 days (C in FIG. 4) and 45 days (D in FIG. 4) until they were died, no pupation was observed, indicating that the silkworm cocoon yield was successfully increased and the pupation of silkworms was prevented.

Example 3 EGT expression in transgenic hybrid lines

Taking the hybridized positive individuals as materials, taking adipose tissue at the beginning (W0) of mounting and at 120h (W120) after mounting, instantly cooling in liquid nitrogen, and putting into a refrigerator at-80 ℃ for later use. The total RNA of the obtained material was extracted, cDNA was synthesized by reverse transcription, and the expression of mRNA level in silkworm fat was examined by RT-PCR using GAL4 (primer sequences: SEQ ID NO: 8 and SEQ ID NO: 9) and EGT (primer sequences: SEQ ID NO: 10 and SEQ ID NO: 11) (Actin 3 as a control, primer sequences: SEQ ID NO: 12 and SEQ ID NO: 13). The reaction conditions are as follows: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 15s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 1min for 25 cycles; finally, extension is carried out for 10min at 72 ℃, and PCR products are detected by adopting 1% agarose gel electrophoresis, and the result is shown in figure 5. The results showed that the LP3 promoter correctly promoted expression of GAL4 in the silkworms after mounting, whereas EGT gene expression was detected only in the silkworms after crossing (a in fig. 5). Indicating that the Gal4/UAS system successfully works in the hybridized silkworms. Further, 120 hours after spinning, silkworm hemolymph was collected at 4 ℃ and 12000g, centrifuged, and the supernatant was collected, and after measuring the total protein concentration, these protein samples were mixed with 5 Xloading buffer, denatured at 100 ℃ for 10 minutes, and then subjected to electrophoresis on 10% SDS-polyacrylamide gel, followed by detection of EGT protein by Western blot (EGT antibody was prepared and stored in this laboratory). The results of using the non-transgenic large gene P50 and the unhybridized transgenic large gene as the control show that at the protein level, EGT is only detected in the hybridized silkworm hemolymph, and other samples have no signals (B in figure 5), and the result indicates that the growth stop of the silkworms after silking is caused by that the hybridization enables the Gal4/UAS system to work, and the EGT expressed by fat bodies is secreted into the hemolymph to play a role.

Example 4 preliminary evaluation of transgenic hybrid lines containing EGT for Lepidoptera toxicity

In addition to prolonging the silk spinning period and increasing the yield of silkworm cocoons, the invention also aims to express useful protein by using silkworm fat as a bioreactor, in order to evaluate the availability of EGT, the silkworms 120h after cocooning are quickly frozen by liquid nitrogen and ground into powder, then are subjected to freeze drying, the blank silkworms and the silkworms 120h after normal non-transgenic large cocooning are treated as a contrast, the silkworms which just enter five years are fed in the morning and evening by 0.1g of freeze-dried powder/g of silkworms, and the death rate statistics shows that the silkworms which take the powder containing EGT silkworm chrysalis are obviously increased in the fourth day and the fifth day after feeding (figure 6), thereby showing that the hybrid silkworms after silk spinning have the value of subsequent development and utilization. Finally, it is noted that the above-mentioned preferred embodiments illustrate rather than limit the invention, and that, although the invention has been described in detail with reference to the above-mentioned preferred embodiments, it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the scope of the invention as defined by the appended claims.

Sequence listing

<110> university of southwest

<120> a system for reducing the activity 20E concentration in the spinning period, changing the nutrient distribution proportion of silk pupae and increasing the yield of silkworm cocoons, and the application and method thereof

<160>15

<170>SIPOSequenceListing 1.0

<210>1

<211>1124

<212>DNA

<213> silkworm (Bombyx mori)

<400>1

agtatagtta caacggctgc cccacccttc aaaccgaaac gcattactgc ttcacggcag 60

aaataggcag ggaggtggta tctaaccgtg cgaatccata cgaaaatatt aatattagca 120

aaacaaatat acctttcaca tggcatgttt taaactacca cgaacaatgt gaatttttaa 180

atgtgtccat taaaattaca catttaaatt ataatgttga cggcttgata atttcactca 240

atcaataata aactatatct ttatttcaat gcactttcat ttgacatttg aactatgatg 300

ttgatattgc atctgacgtt ttttaattca aaacaatttc gagtataaaa ggcagagttt 360

caaaggaaac aggcagttcg ttcttgggta acacacaggt gagatacatt ttgtttttaa 420

ctctggagaa tccgtttcgg atacccagtc gtggggggta acagaccggg ttatgtcaga 480

cttcggttcc tccaaggaag agggagaccg aggtcctcct cttcttctaa ttcctgtcga 540

gagtctacgt cttgagatat ctacctacca cacaaaaacg ttttcttcta tttagcgttt 600

gttaaattgt aagagtttga gaaaccaatt ggccgatatt tcgacctctg gcattttttt 660

catcactccg ctgacttttc ttattctttt tattgcttag atgggtgaac gagctcacag 720

cccacctggt gttaagtggt taccggagcc catagacatt tacaacgtaa atgccccacc 780

caccttgaaa tttaaggtct aagatctcaa gtataggtac ttcttgtact ggtctccaaa 840

caccgatcgt atgaattttg tatcagtgga tataaaatta tacactaaga tgtttatgtg 900

tctaagcttt caaagaagtc aaatatataa tatacttttt tatttaacaa ttaatttgtc 960

aagttcgttt ttgctatata ctcacaaaat ctgcgaccgt tttgtctcat atatacatca 1020

aatatacata ttatgttcaa ttctcaatgt gtataattca acttacgttt ttaaaattct 1080

aatccttaac aaataatttt acatattgca ggactcgact cgac 1124

<210>2

<211>1518

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>2

atgactattc tttgctggct tgcactgctg tctacgctta ctgctgtaaa tgcggtcaat 60

atattggccg tgtttcctac gccagcttac agccaccata tagtctacaa agtgtatatt 120

gaagcccttg ccgaaaaatg tcacaacgtt acggtcgtca agcccaaact gtttgcgtat 180

tcgaccaaaa cttattgcgg taatattacg gaagttaatt ccgacatgtc ggtcaagcaa 240

tacaagaaac tagtaacgaa ttcggcaatg tttagaaagc gcggagtggt gtccgataca 300

gacacggtaa ccgccgccaa ctacctgggc ttgattgaaa tgttcaaaga ccagtttgac 360

aatatcaacg tgcgcaatct cattgccaac aaccagacgt ttgatttagt tgtcgtggaa 420

gcgtttgccg attatgcgtt ggtgtttggc cacctgtacg atcctgcgcc cgtaatccaa 480

atcgcgcctg gctacggttt ggcggaaaac tttgacacgg taggcgccgt ggcgcggcac 540

cccgttcacc atcctaacat ttggcgcaac aatttcgacg acacgaaggc gaacttgatg 600

acggaaatgc gtttgtataa agaatttaaa attttggcca acatgtccaa tgcgttgctc 660

aaacagcagt ttggacccga cacaccgaca attgaagaac tgcgcaacaa ggtgcaattg 720

cttttgctga acctacatcc catatttgac aacaaccgac ccgtgtcgcc cagcgtccag 780

tatcttggcg gaggaatcca tcttgtaaaa agtgcgccgt tgaccaaatt aagtccggtc 840

atcgacgcga aaatgaacaa gtcaaaaagc ggagcgattt acgtaagttt tgggtcgagc 900

attgacacca aatcgtttgc aaacgagttt ttttacatgt taatcaatac gcttaaagcg 960

ttggataatt acaccatatt atggaaaatt gacgacgaag tagtaaaaaa cataacgttg 1020

cccgccaacg tgatcacgca aaattggttt aatcaacgcg ccgtgttgcg tcataaaaaa 1080

atggcggcgt ttattacgca aggcggacta caatcgagcg acgaggcctt ggaagccgga 1140

atacccatgg tgtgtctgcc catgatgggc gaccagtttt accatgcgca caaattacag 1200

caactcggcg tagcccgcgc cttggacact gttaccgttt ccagcgatca actattactg 1260

gcgataaacg acgtgttgtt taacgcgtct acatacaaaa aacacatggc cgagttatat 1320

gcgcttatca ataacgataa agcaacgttt ccgcctctag ataaggccat caaatttaca 1380

gaacgcgtaa ttcgatatag acatgacatc agtcgtcgat tgtattcatt aaaaacaaca 1440

gctgccaatg taccgtactc aaattactac atgtataaat ctgtactttc tattgtaatg 1500

aatcatatag cacacttt 1518

<210>3

<211>2646

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>3

atgaagctac tgtcttctat cgaacaagca tgcgatattt gccgacttaa aaagctcaag 60

tgctccaaag aaaaaccgaa gtgcgccaag tgtctgaaga acaactggga gtgtcgctac 120

tctcccaaaa ccaaaaggtc tccgctgact agggcacatc tgacagaagt ggaatcaagg 180

ctagaaagac tggaacagct atttctactg atttttcctc gagaagacct tgacatgatt 240

ttgaaaatgg attctttaca ggatataaaa gcattgttaa caggattatt tgtacaagat 300

aatgtgaata aagatgccgt cacagataga ttggcttcag tggagactga tatgcctcta 360

acattgagac agcatagaat aagtgcgaca tcatcatcgg aagagagtag taacaaaggt 420

caaagacagt tgactgtatc gattgactcg gcagctcatc atgataactc cacaattccg 480

ttggatttta tgcccaggga tgctcttcat ggatttgatt ggtctgaaga ggatgacatg 540

tcggatggct tgcccttcct gaaaacggac cccaacaata atgggttctt tggcgacggt 600

tctctcttat gtattcttcg atctattggc tttaaaccgg aaaattacac gaactctaac 660

gttaacaggc tcccgaccat gattacggat agatacacgt tggcttctag atccacaaca 720

tcccgtttacttcaaagtta tctcaataat tttcacccct actgccctat cgtgcactca 780

ccgacgctaa tgatgttgta taataaccag attgaaatcg cgtcgaagga tcaatggcaa 840

atccttttta actgcatatt agccattgga gcctggtgta tagaggggga atctactgat 900

atagatgttt tttactatca aaatgctaaa tctcatttga cgagcaaggt cttcgagtca 960

ggttccataa ttttggtgac agccctacat cttctgtcgc gatatacaca gtggaggcag 1020

aaaacaaata ctagctataa ttttcacagc ttttccataa gaatggccat atcattgggc 1080

ttgaataggg acctcccctc gtccttcagt gatagcagca ttctggaaca aagacgccga 1140

atttggtggt ctgtctactc ttgggagatc caattgtccc tgctttatgg tcgatccatc 1200

cagctttctc agaatacaat ctccttccct tcttctgtcg acgatgtgca gcgtaccaca 1260

acaggtccca ccatatatca tggcatcatt gaaacagcaa ggctcttaca agttttcaca 1320

aaaatctatg aactagacaa aacagtaact gcagaaaaaa gtcctatatg tgcaaaaaaa 1380

tgcttgatga tttgtaatga gattgaggag gtttcgagac aggcaccaaa gtttttacaa 1440

atggatattt ccaccaccgc tctaaccaat ttgttgaagg aacacccttg gctatccttt 1500

acaagattcg aactgaagtg gaaacagttg tctcttatca tttatgtatt aagagatttt 1560

ttcactaatt ttacccagaa aaagtcacaa ctagaacagg atcaaaatga tcatcaaagt 1620

tatgaagtta aacgatgctc catcatgtta agcgatgcag cacaaagaac tgttatgtct 1680

gtaagtagct atatggacaa tcataatgtc accccatatt ttgcctggaa ttgttcttat 1740

tacttgttca atgcagtcct agtacccata aagactctac tctcaaactc aaaatcgaat 1800

gctgagaata acgagaccgc acaattatta caacaaatta acactgttct gatgctatta 1860

aaaaaactgg ccacttttaa aatccagact tgtgaaaaat acattcaagt actggaagag 1920

gtatgtgcgc cgtttctgtt atcacagtgt gcaatcccat taccgcatat cagttataac 1980

aatagtaatg gtagcgccat taaaaatatt gtcggttctg caactatcgc ccaataccct 2040

actcttccgg aggaaaatgt caacaatatc agtgttaaat atgtttctcc tggctcagta 2100

gggccttcac ctgtgccatt gaaatcagga gcaagtttca gtgatctagt caagctgtta 2160

tctaaccgtc caccctctcg taactctcca gtgacaatac caagaagcac accttcgcat 2220

cgctcagtca cgccttttct agggcaacag caacagctgc aatcattagt gccactgacc 2280

ccgtctgctt tgtttggtgg cgccaatttt aatcaaagtg ggaatattgc tgatagctca 2340

ttgtccttca ctttcactaa cagtagcaac ggtccgaacc tcataacaac tcaaacaaat 2400

tctcaagcgc tttcacaacc aattgcctcc tctaacgttc atgataactt catgaataat 2460

gaaatcacgg ctagtaaaat tgatgatggt aataattcaa aaccactgtc acctggttgg 2520

acggaccaaa ctgcgtataa cgcgtttgga atcactacag ggatgtttaa taccactaca 2580

atggatgatg tatataacta tctattcgat gatgaagata ccccaccaaa cccaaaaaaa 2640

gagtaa 2646

<210>4

<211>367

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>4

gtcggagtac tgtcctccga gcggagtact gtcctccgag cggagtactg tcctccgagc 60

ggagtactgt cctccgagcg gagtactgtc ctccgagcgg agactctagc gagcgccgga 120

gtataaatag aggcgcttcg tctacggagc gacaattcaa ttcaaacaag caaagtgaac 180

acgtcgctaa gcgaaagcta agcaaataaa caagcgcagc tgaacaagct aaacaatctg 240

cagtaaagtg caagttaaag tgaatcaatt aaaagtaacc agcaaccaag taaatcaact 300

gcaactactg aaatctgcca agaagtaatt attgaataca agaagagaac tctgaatagg 360

gaattgg 367

<210>5

<211>29

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>5

ccggaattca tgactattct ttgctggct 29

<210>6

<211>59

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>6

ccgctcgagc tacagatcct cttctgagat gagtttttgt tcaaagtgtg ctatatgat 59

<210>7

<211>1938

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>7

ggcgcgccgt cggagtactg tcctccgagc ggagtactgt cctccgagcg gagtactgtc 60

ctccgagcgg agtactgtcc tccgagcgga gtactgtcct ccgagcggag actctagcga 120

gcgccggagt ataaatagag gcgcttcgtc tacggagcga caattcaatt caaacaagca 180

aagtgaacac gtcgctaagc gaaagctaag caaataaaca agcgcagctg aacaagctaa 240

acaatctgca gtaaagtgca agttaaagtg aatcaattaa aagtaaccag caaccaagta 300

aatcaactgc aactactgaa atctgccaag aagtaattat tgaatacaag aagagaactc 360

tgaataggga attgggaatt catgactatt ctttgctggc ttgcactgct gtctacgctt 420

actgctgtaa atgcggtcaa tatattggcc gtgtttccta cgccagctta cagccaccat 480

atagtctaca aagtgtatat tgaagccctt gccgaaaaat gtcacaacgt tacggtcgtc 540

aagcccaaac tgtttgcgta ttcgaccaaa acttattgcg gtaatattac ggaagttaat 600

tccgacatgt cggtcaagca atacaagaaa ctagtaacga attcggcaat gtttagaaag 660

cgcggagtgg tgtccgatac agacacggta accgccgcca actacctggg cttgattgaa 720

atgttcaaag accagtttga caatatcaac gtgcgcaatc tcattgccaa caaccagacg 780

tttgatttag ttgtcgtgga agcgtttgcc gattatgcgt tggtgtttgg ccacctgtac 840

gatcctgcgc ccgtaatcca aatcgcgcct ggctacggtt tggcggaaaa ctttgacacg 900

gtaggcgccg tggcgcggca ccccgttcac catcctaaca tttggcgcaa caatttcgac 960

gacacgaagg cgaacttgat gacggaaatg cgtttgtata aagaatttaa aattttggcc 1020

aacatgtcca atgcgttgct caaacagcag tttggacccg acacaccgac aattgaagaa 1080

ctgcgcaaca aggtgcaatt gcttttgctg aacctacatc ccatatttga caacaaccga 1140

cccgtgtcgc ccagcgtcca gtatcttggc ggaggaatcc atcttgtaaa aagtgcgccg 1200

ttgaccaaat taagtccggt catcgacgcg aaaatgaaca agtcaaaaag cggagcgatt 1260

tacgtaagtt ttgggtcgag cattgacacc aaatcgtttg caaacgagtt tttttacatg 1320

ttaatcaata cgcttaaagc gttggataat tacaccatat tatggaaaat tgacgacgaa 1380

gtagtaaaaa acataacgtt gcccgccaac gtgatcacgc aaaattggtt taatcaacgc 1440

gccgtgttgc gtcataaaaa aatggcggcg tttattacgc aaggcggact acaatcgagc 1500

gacgaggcct tggaagccgg aatacccatg gtgtgtctgc ccatgatggg cgaccagttt 1560

taccatgcgc acaaattaca gcaactcggc gtagcccgcg ccttggacac tgttaccgtt 1620

tccagcgatc aactattact ggcgataaac gacgtgttgt ttaacgcgtc tacatacaaa 1680

aaacacatgg ccgagttata tgcgcttatc aataacgata aagcaacgtt tccgcctcta 1740

gataaggcca tcaaatttac agaacgcgta attcgatata gacatgacat cagtcgtcga 1800

ttgtattcat taaaaacaac agctgccaat gtaccgtact caaattacta catgtataaa 1860

tctgtacttt ctattgtaat gaatcatata gcacactttg aacaaaaact catctcagaa 1920

gaggatctgt agctcgag 1938

<210>8

<211>21

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>8

gcaatcccat taccgcatat c 21

<210>9

<211>22

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>9

aggttcggac cgttgctact gt 22

<210>10

<211>18

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>10

ccagcgtcca gtatcttg 18

<210>11

<211>19

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>11

cgacgactga tgtcatgtc 19

<210>12

<211>21

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>12

aacaccccgt cctgctcact g 21

<210>13

<211>21

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>13

gggcgagacg tgtgatttcc t 21

<210>14

<211>25

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>14

gcgtcgacag tatagttaca acggc 25

<210>15

<211>27

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>15

cgggatccaa agtgtgctat atgattc 27

Claims (10)

1. A system for reducing the activity 20E concentration in the spinning period, changing the nutrient distribution proportion of silk pupae and increasing the yield of silkworm cocoons is characterized in that: the system comprises a GAL4/UAS binary system, wherein GAL4 gene is expressed by BmLP3, UAS regulates EGT expression, the nucleotide sequence of BmLP3 is shown in SEQ ID NO.1, the nucleotide sequence of EGT gene is shown in SEQ ID NO.2, the nucleotide sequence of GAL4 gene is shown in SEQ ID NO.3, and the nucleotide sequence of UAS is shown in SEQ ID NO. 4.

2. The system of claim 1, wherein: the GAL4/UAS binary system is respectively positioned on two vectors and respectively marked as a recombinant transgenic vector A and a recombinant transgenic vector B, and the recombinant transgenic vector A contains an expression frame for promoting GAL4 gene expression by BmLP 3; the recombinant transgenic vector B contains an expression frame for regulating and controlling EGT expression by UAS.

3. The system of claim 2, wherein: the recombinant transgenic vector A is prepared by the following method: by silkworm varietydazaoGenome as template, the LP3 promoter sequence was amplified and ligated into the pSL1180 plasmidSalI /BamHI, obtaining pSL1180[ Lp3-SV40] at the enzyme digestion site]Support, GA to be synthesizedL4The nucleic acid sequence is ligated into pSL1180[ Lp3-SV40]]Of carriersBamHI/NotObtaining pSL1180[ Lp3-GAL4-SV40] at the enzyme digestion site of I]Intermediate vector, further pSL1180[ Lp3-GAL4-SV40]Intermediate vector plasmid and pBac [3xP3-EGFP]For plasmidsAscI single enzyme digestion, respectively recovering an expression frame containing BmLP3 for promoting GAL4 gene expression and a vector skeleton, connecting to obtain a recombinant transgenic vector A which is named as pBac [3xP3-EGFP, BmLP3-GAL4-SV40]。

4. The system of claim 2, wherein: the recombinant transgenic vector B is prepared by the following method: amplification of the EGT Gene and ligation into the pSL1180 plasmidEcoRI/XhoI enzyme cutting site to obtain intermediate vector pSL1180[ EGT]The UAS fragment was then religated into the intermediate vector pSL1180[ EGT]Is/are as followsAscⅠ/EcoRI, obtaining a recombinant vector pSL1180[ UAS-EGT ] at the enzyme digestion site]Then, the recombinant vector pSL1180[ UAS-EGT ]]And pBac [3xP3-DsRed]Respectively using plasmidsAscI single enzyme digestion, respectively recovering an expression frame containing UAS regulation EGT expression and a vector skeleton, connecting to obtain a recombinant transgenic vector B named pBac [3xP3-DsRed, UAS-EGT]。

5. Use of the system of any one of claims 1 to 4 for increasing silkworm cocoon yield.

6. The method for preparing the silkworm cocoon with the activity 20E concentration reducing in the spinning period and the nutrition distribution ratio changing silk pupa ratio to increase the yield of the silkworm cocoons by using the system as claimed in any one of claims 1 to 4, is characterized by comprising the following steps: mixing a recombinant transgenic vector containing BmLP3 start GAL4 gene expression with an auxiliary plasmid, injecting a silkworm egg with diapause removed, and screening a positive transgenic silkworm after hatching to prepare a transgenic silkworm GAL4 system; then mixing a recombinant transgenic vector containing UAS (upflow anaerobic digestion) regulation EGT expression with an auxiliary plasmid, injecting a silkworm egg with diapause removed, and screening a positive transgenic silkworm after hatching to prepare a transgenic silkworm UAS-EGT system; then the transgenic silkworm GAL4 system and the transgenic silkworm UAS-EGT system are hybridized, and the silkworm eggs containing GAL4 and EGT genes are screened, so that the transgenic silkworm material which can prolong the silking period of the silkworms and increase the silkworm cocoon yield by reducing the ecdysone content in the silking period of the silkworms through exogenous protein is obtained.

7. The method of claim 6, wherein: the recombinant transgenic vector containing BmLP3 for promoting GAL4 gene expression consists of pSL1180[ Lp3-GAL4-SV40]Plasmid and pBac [3xP3-EGFP]For plasmidsAscI, single enzyme digestion, respectively recovering an expression frame containing BmLP3 for promoting GAL4 gene expression and a vector skeleton, and connecting to obtain the pSL1180[ Lp3-GAL4-SV40]]The plasmid was constructed from the LP3 promoter sequence and ligated into the pSL1180 plasmidSalI /BamHI, obtaining pSL1180[ Lp3-SV40] at the enzyme digestion site]A carrier, thenGAL4 gene is connected into pSL1180[ Lp3-SV40]]Of carriersBamHI/NotI, obtaining the enzyme cutting site.

8. The method of claim 6, wherein: the recombinant transgenic vector containing the UAS for regulating and controlling the EGT expression is formed by connecting an EGT gene into a pSL1180 plasmidEcoRI/XhoI enzyme cutting site to obtain intermediate vector pSL1180[ EGT]The UAS fragment was then religated into the intermediate vector pSL1180[ EGT]Is/are as followsAscⅠ/EcoRI, obtaining a recombinant vector pSL1180[ UAS-EGT ] at the enzyme digestion site]Then, the recombinant vector pSL1180[ UAS-EGT ]]And pBac [3xP3-DsRed]Respectively using plasmidsAscI Single enzyme digestion, recovery of the Table containing UAS regulated EGT expressionThe frame and the carrier skeleton are connected to obtain the product.

9. The method according to claim 7 or 8, characterized in that: screening of silkworm eggs containing GAL4 and EGT genes is to hatch silkworm eggs capable of detecting red and green fluorescence simultaneously.

10. The method of claim 6, wherein: the helper plasmid is the pHA3PIG plasmid.

Images