CN117051009A - Rice endosperm flour related gene OsFLO26, encoding protein and application thereof - Google Patents

Abstract

The invention discloses a rice endosperm flour related gene OsFLO26, and a coding protein and application thereof, and the gene OsFLO26 provided by the invention is a DNA molecule as described in the following 1) or 2) or 3) or 4): 1) A DNA molecule shown in SEQ ID No. 1; 2) A DNA molecule shown in SEQ ID No. 2; 3) A DNA molecule which hybridizes under stringent conditions to the DNA sequence defined in 1) or 2) and which encodes said protein; 4) A DNA molecule having more than 90% homology with the DNA sequence defined in 1) or 2) or 3) and encoding a plant endosperm development related protein. The invention also provides the protein encoded by the gene, the protein affects the development of plant endosperm, and the encoding gene of the protein is introduced into plants with abnormal endosperm development, so that transgenic plants with normal endosperm development can be cultivated. The protein and the coding gene thereof can be applied to plant genetic improvement.

Description

Rice endosperm flour related gene OsFLO26, encoding protein and application thereof

Technical Field

The invention belongs to the field of genetic engineering, and in particular relates to a rice endosperm flour related gene OsFLO26, and a coding protein and application thereof.

Background

The rice is grains with more than 50% of population in the world, is also an important grain crop in China, and the position of rice production in national economy is very important. The rice eaten by people in daily life is the endosperm part of rice, and the endosperm of rice mainly contains substances such as starch, protein and the like, wherein the content and the characteristics of the starch determine the appearance quality, the cooking taste quality and the nutrition quality of the rice, and the content of the protein influences the taste and the nutrition quality of the rice. The formation and development of endosperm directly affect the yield and quality of rice, thus having great significance for the deep research of the development of endosperm of rice

The endosperm of rice seeds accumulates a lot of starch during the ripening process, about 60-80% of the dry weight of the seeds, and the starch content and characteristics determine the quality of rice. Starch biosynthesis is a complex and well regulated process requiring the involvement of many starch synthesis-related enzymes and regulatory factors, and is ultimately stored in the amylopectin and amylopectin forms in the powder. Currently, scientists have cloned genes that directly or indirectly regulate starch synthesis during rice endosperm development, but the understanding of starch synthesis and regulation mechanisms is not very thorough, which requires us to locate and clone more genes for further disclosure.

Disclosure of Invention

The invention aims to disclose a rice endosperm flour related gene OsFLO26, and a coding protein and application thereof.

The gene OsFLO26 provided by the invention is a DNA molecule as described in the following 1) or 2) or 3) or 4):

1) A DNA molecule shown in SEQ ID No. 1;

2) A DNA molecule shown in SEQ ID No. 2;

3) A DNA molecule which hybridizes under stringent conditions to the DNA sequence defined in 1) or 2) and which encodes said protein;

4) A DNA molecule having more than 90% homology with the DNA sequence defined in 1) or 2) or 3) and encoding a plant endosperm development related protein.

The invention also provides a protein encoded by the gene OsFLO26.

Specifically, the protein provided by the invention is selected from any one of the following (a) or (b):

(a) A protein consisting of the amino acid sequence shown in SEQ ID NO. 3;

(b) And (b) a protein which is derived from the SEQ ID NO.3, is related to endosperm development and is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the amino acid sequence of the SEQ ID NO. 3.

The invention also provides a recombinant expression vector, an expression cassette, a transgenic cell line or recombinant bacteria containing the gene OsFLO26. Recombinant expression vectors containing any of the above genes are also within the scope of the present invention.

Recombinant expression vectors containing the genes can be constructed using existing plant expression vectors.

The plant expression vector comprises a binary agrobacterium vector, a vector which can be used for plant microprojectile bombardment and the like. The plant expression vector may also comprise the 3' -untranslated region of a foreign gene, i.e., comprising a polyadenylation signal and any other DNA segments involved in mRNA processing or gene expression. The polyadenylation signal directs the addition of polyadenylation to the 3 'end of the mRNA precursor, and may be similarly functional in the untranslated regions transcribed from the 3' end of, for example, agrobacterium tumefaciens induction (Ti) plasmid genes (e.g., nopaline synthase Nos genes) and plant genes (e.g., soybean storage protein genes).

When the gene is used for constructing a recombinant plant expression vector, any one of an enhanced promoter or a constitutive promoter such as a cauliflower mosaic virus (CAMV) 35S promoter and a Ubiquitin promoter (Ubiquitin) of corn can be added before transcription initiation nucleotide, and the recombinant plant expression vector can be used alone or in combination with other plant promoters; in addition, when the gene of the present invention is used to construct a plant expression vector, enhancers, including translational enhancers or transcriptional enhancers, may be used, and these enhancers may be ATG initiation codon or adjacent region initiation codon, etc., but must be identical to the reading frame of the coding sequence to ensure proper translation of the entire sequence. The sources of the translational control signals and initiation codons are broad, and can be either natural or synthetic. The translation initiation region may be derived from a transcription initiation region or a structural gene.

In order to facilitate the identification and selection of transgenic plant cells or plants, the plant expression vectors used may be processed, for example, by adding genes encoding enzymes or luminescent compounds which produce a color change (GUS gene, luciferase gene, etc.), antibiotic markers with resistance (gentamicin markers, kanamycin markers, etc.), or anti-chemical marker genes (e.g., anti-herbicide genes), etc., which may be expressed in plants. From the safety of transgenic plants, transformed plants can be screened directly in stress without adding any selectable marker gene.

The recombinant overexpression vector can be a recombinant plasmid obtained by inserting the gene (OsFLO 26) into a recombinant site of a restriction enzyme HindIII and BamHI double-enzyme cutting vector pCAMBIA 1390. pCAMBIA1390 containing OsFLO26 was designated pCAMBIA1390-OsFLO26.

Expression cassettes, transgenic cell lines and recombinant bacteria containing any of the above genes (OsFLO 26) are within the scope of the present invention.

Primer pairs that amplify the full length or any fragment of the gene (OsFLO 26), preferably Primer1/Primer2, primer3/Primer4 and Primer5/Primer6, are also within the scope of the present invention.

The positioning primers involved in the fine positioning of this gene (see Table 1), inDel primers were self-designed primers required for this experiment, and these self-designed primers also fall within the scope of the present invention.

The invention also provides application of at least one of the genes, the proteins, the recombinant expression vectors, the expression cassettes, the transgenic cell lines or the recombinant bacteria in plant breeding.

The invention also provides application of the gene, the protein, at least one of the recombinant expression vector, the expression cassette, the transgenic cell line or the recombinant bacterium in cultivating transgenic plants with normal endosperm development.

The invention also provides a method for cultivating the transgenic plant with normal endosperm development, which is to introduce the gene into the plant with abnormal endosperm development to obtain the transgenic plant with normal endosperm development.

In particular, the gene may be introduced into plants with endosperm dysplasia by means of the recombinant expression vector.

The invention also provides a method for cultivating transgenic plants with abnormal endosperm development, which is to knock out or silence genes shown in SEQ ID NO.1 or SEQ ID NO.2 in normal plants to obtain transgenic plants with abnormal starch synthesis; preferably, the plant is rice.

The invention also provides application of the method for cultivating the transgenic plant with abnormal endosperm development in plant heritage improvement or research.

The gene encoding the protein is introduced into plant cells by using any vector capable of guiding the expression of exogenous genes in plants, and a transgenic cell line and a transgenic plant can be obtained. The expression vector carrying the gene may be transformed into plant cells or tissues by using conventional biological methods such as Ti plasmid, ri plasmid, plant viral vector, direct DNA transformation, microinjection, electric conduction, agrobacterium mediation, etc., and the transformed plant tissues are cultivated into plants. The plant host to be transformed may be either a monocot or a dicot, such as: tobacco, radix et rhizoma Baimai, arabidopsis thaliana, rice, wheat, corn, cucumber, tomato, poplar, turf grass, alfalfa, etc.

The beneficial effects are that:

the invention discovers, locates and clones a new plant endosperm flour related protein gene OsFLO26 for the first time. The plant endosperm flour related proteins of the invention affect the endosperm development process of plants. Inhibiting the expression of the protein-encoding gene can cause a disruption in endosperm development in plant seeds, thereby allowing the cultivation of transgenic plants with endosperm variation. The coding gene of the protein is introduced into plants with abnormal endosperm development, so that plants with normal endosperm development can be cultivated. The protein and the coding gene thereof can be applied to plant genetic improvement.

Drawings

FIG. 1 shows the grain phenotype of wild type N22 and mutant k219.

FIG. 2 is a scanning electron microscope observation of wild type N22 and mutant k219 kernels.

FIG. 3 is a thousand kernel weight determination of wild-type N22 and mutant k219.

FIG. 4 shows the starch content determination of wild-type N22 and mutant k219.

FIG. 5 shows the fine localization of mutant genes on chromosome 10.

FIG. 6 shows the T of pCAMBIA1390-OsFLO26 conversion ₁ And (3) a seed phenotype.

Detailed Description

The following examples facilitate a better understanding of the present invention, but are not intended to limit the same. The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the examples described below, unless otherwise specified, were purchased from conventional biochemical reagent stores.

Example 1 discovery of Rice endosperm development related locus and Gene encoding same

1. Phenotypic analysis and genetic analysis of rice endosperm flour mutant k219

One endosperm flour mutant, designated k219, was selected from the offspring of indica rice variety N22 tissue culture.

The left panel of FIG. 1 shows a scan of the whole and cross-section of an N22 mature seed, exhibiting a completely endosperm transparent phenotype, and the right panel shows a scan of the whole and cross-section of a k219 mature seed, exhibiting a whole endosperm opaque phenotype.

Cross sections of wild type and k219 mutant seeds were observed by scanning electron microscopy, and the starch particles of the wild type seeds were closely aligned and uniform in size (fig. 2). Whereas the k219 mutant seed starch particles are loosely arranged, most of the particles being round, scattering occurs as light passes through, resulting in the appearance of the k219 seed exhibiting an opaque phenotype (fig. 2).

Mature k219 mutant seeds had a thousand kernel weight significantly lower than N22 (fig. 3). At the same time, the k219 amylose content was significantly reduced compared to the wild type (fig. 4).

2. Map cloning of mutant Gene loci

1. Localization of mutant genes

First, a hybrid combination F of mutant k219 and another wild-type 9311 was formulated ₁ F is obtained after the first generation of selfing ₂ Seed. Will F ₂ Planting and harvesting seed F ₃ . From F ₃ And selecting 10 seeds with extremely silty and opaque phenotype from the isolated population for preliminary linkage of genes, and determining the target genes on the 10 th chromosome of the rice.

Then from F using the common primers of the laboratory with the primers designed by oneself ₃ The isolated pedigrees continued to pick 269 extremely powdery opaque seeds for fine targeting, and finally the gene of interest was determined to be between markers K10-22 and K10-18, with a segment size of 488kb (FIG. 5).

The method for SSR marker analysis is as follows:

(1) The DNA of the extremely dry seeds is extracted and used as a template, and the specific method is as follows:

(1) the dried seeds were crushed with pliers, placed in a 2.0mL Eppendorf tube, placed in a steel ball, and placed on a 2000-type GENO/GRINDER instrument to crush the sample for 1min.

(2) Add 660. Mu.L of extract (100 mM Tris-HCl (pH 8.0), 20mM EDTA (pH 8.0), 1.4M NaCl,0.2g/mL CTAB solution) and vortex vigorously on a vortexing device for 30min on ice.

(3) Add 40. Mu.L 20% SDS, incubate at 65℃for 10min, gently mix upside down every two minutes.

(4) 100. Mu.L of 5M NaCl was added and gently mixed.

(5) 100. Mu.L of 10 XCTAB was added, the mixture was incubated at 65℃for 10 minutes, and the mixture was gently mixed upside down intermittently.

(6) 900. Mu.L of chloroform was added thereto, and the mixture was thoroughly mixed and centrifuged at 12000rpm for 3 minutes.

(7) The supernatant was transferred to a 1.5mL Eppendorf tube, 600. Mu.L of isopropanol was added, mixed well, and centrifuged at 12000rpm for 5min.

(8) The supernatant was discarded, and the pellet was rinsed once with 70% (volume percent) ethanol and dried at room temperature.

(9) 100. Mu.L of 1 XDE (121 g of Tris in 1 liter of water, pH 8.0 adjusted with hydrochloric acid) was added to dissolve the DNA.

To detect DNA quality by electrophoresis in an amount of 2. Mu.L, and the concentration was measured by a DU800 spectrophotometer (Beckman Instrument Inc. U.S.A.).

(2) Diluting the extracted DNA to about 20 ng/. Mu.L, and performing PCR amplification by using the diluted DNA as a template;

PCR reaction System (10. Mu.L): 1. Mu.L of DNA (20 ng/. Mu.L), 1. Mu.L of upstream primer (2 pmol/. Mu.L), 1. Mu.L of downstream primer (2 pmol/. Mu.L), 10XBuffer (MgCl) ₂ free)1μL，dNTP(10mM)0.2μL，MgCl ₂ (25mM)0.6μL，rTaq(5U/μL)0.1μL，ddH ₂ O5.1. Mu.L, 10. Mu.L total.

PCR reaction procedure: denaturation at 94.0℃for 3min; denaturation at 94.0 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 1min, and total circulation for 35 times; extending at 72 ℃ for 10min; preserving at 10 ℃. The PCR reaction was performed in an MJ Research PTC-225 thermal cycler.

(3) PCR product detection of SSR markers

The amplified products were analyzed by 8% non-denaturing polyacrylamide gel electrophoresis. The molecular weight of the amplified product was compared with that of a 50bp DNA Ladder as a control, and silver staining was performed.

The primer development process is as follows:

(1) SSR marker development

And integrating the SSR markers of the public map with the rice genome sequence, and downloading BAC/PAC cloning sequences near the mutation sites. Searching for potential SSR sequences in clones (number of repetitions > 6) using SSRHENTER (Li Jiang et al, genetics, 2005, 27 (5): 808-810) or SSRIT on-line software (http:// archive. Gram. Org/db/markers/ssrtool); comparing the SSRs and sequences adjacent to 400-500 bp with corresponding 9311 sequences on line at NCBI through BLAST program, and if the number of times of SSR repetition is different, preliminarily deducing that polymorphism exists between N22 and 9311 in PCR products of the SSR primer; and then designing SSR primers by using Primer Premier 5.0 software, and synthesizing by Nanjing Jinsri biotechnology Co. The SSR paired primers designed by self are mixed in equal proportion, polymorphism between 9311 and N22 is detected, and the polymorphism is used as a molecular marker for fine localization. The molecular markers used for fine localization are shown in Table 1.

TABLE 1 molecular markers for Fine localization

2. Acquisition of powdery Gene

Comparing the N22 and k219 resequencing sequences in 488kb segment, it is found that there is 2 base deletion of OsFLO26 gene,

primers were designed based on the sequences published on the network as follows:

Primer1：5'ATGGCGAGCAGCGGGGCGGT 3'；

Primer2：5'TCAGTTGGGCTTGGAGCTTG 3'。

PCR amplification was performed using Primer1 and Primer2 as primers and N22 developing endosperm DNA as a template to obtain the target gene. The amplification reaction was performed on a PTC-200 (MJ Research inc.) PCR instrument: 94 ℃ for 3min;94 ℃ for 30sec,60 ℃ for 30sec,72 ℃ for 4min,35 cycles; and at 72℃for 10min. The PCR product was recovered and purified, then ligated to pMD18-T (Japanese Takara Co., ltd.), E.coli DH 5. Alpha. Competent cells (Beijing Tiangen Co., CB 101) were transformed, and positive clones were selected and sequenced.

The sequence determination result shows that the fragment obtained by PCR reaction has the nucleotide sequence shown as SEQ ID NO.2, and encodes a protein composed of 339 amino acid residues (see SEQ ID NO.3 of the sequence table). The protein shown in SEQ ID NO.3 is named as OsFLO26, and the encoding gene of the protein shown in SEQ ID NO.3 is named as OsFLO26.

Example 2 acquisition and identification of transgenic plants

1. Recombinant expression vector construction

The promoter part of the OsFLO26 gene is obtained by PCR amplification with the genomic DNA of N22 (from a germplasm resource pool of rice of Nanjing university of agriculture) as a template and with Primer3/4 as a Primer. PCR amplification is carried out by taking the cDNA of N22 as a template and Primer5/6 as a Primer to obtain the CDS full length (SEQ ID NO. 1) of the OsFLO26 gene.

PCR amplification is carried out to obtain the OsFLO26 gene, and the PCR primer sequence is as follows:

Primer3：

5'CCGGCGCGCCAAGCTTGGCTAGAGTAAGGCTCTACA3'；

Primer4：

5'CCCCGCTGCTCGCCATTGCCGCCGCCCACCTCGATC 3'；

Primer5：

5'GAGGTGGGCGGCGGCAATGGCGAGCAGCGGGGCGGT 3'；

Primer6：

5'GAATTCCCGGGGATCCTCAGTTGGGCTTGGAGCTTG 3'。

the primers Primer3 and Primer4 were located 2kb upstream of the gene shown in SEQ ID NO.2, and the amplified product was the promoter of the gene, and the PCR product 1 was recovered and purified. The CDS full length of the gene was amplified by primers Primer5 and Primer6, and the PCR product 2 was recovered and purified. The two-stage PCR product was cloned into vector pCAMBIA1390 using INFUSION recombination kit (Japanese Takara). INFUSION recombinant reaction System (10. Mu.L): 1.0. Mu.L of PCR product, 5.0. Mu.L of pCAMBIA1390, 2.0. Mu.L of 5X infusion buffer, infusion enzyme mix. Mu.L. After brief centrifugation, the mixture was subjected to a water bath at 37℃for 15 minutes and then a water bath at 50℃for 15 minutes, and 2.5. Mu.L of the reaction system was used to transform E.coli DH 5. Alpha. Competent cells (Tiangen, beijing; CB 101) by heat shock. All the transformed cells were uniformly plated on LB solid medium containing 50mg/L kanamycin. After 16h incubation at 37℃the clone positive clones were picked and sequenced. As a result of sequencing, it was revealed that a recombinant expression vector containing the gene shown in SEQ ID NO.1 was obtained, pCAMBIA1390 containing OsFLO26 was designated pCAMBIA1390-OsFLO26, and the OsFLO26 gene fragment was inserted between HindIII and BamHI cleavage sites of the vector using INFUSION recombination kit (Takara Co., ltd.).

2. Acquisition of recombinant Agrobacterium

The pCAMBIA1390-OsFLO26 strain was transformed into Agrobacterium EHA105 strain (purchased from the company English, U.S.A.) by electric shock method to obtain recombinant strain, and the plasmid was extracted for PCR and enzyme digestion identification. The correct recombinant strain identified by PCR and restriction enzyme was named EH-pCAMBIA1390-OsFLO26.

The agrobacterium EHA105 strain was transformed using pCAMBIA1390 as control vector, as described above, to obtain a trans-empty vector control strain.

3. Acquisition of transgenic plants

The EH-pCAMBIA1390-OsFLO26 strain is transformed into a rice mutant k219 by the following specific method:

(1) EH-pCAMBIA1390-OsFLO26 (or empty vector control strain) was cultured at 28℃for 16 hours, and the cells were collected and diluted to a concentration of OD 600. Apprxeq.0.5 in N6 liquid medium (Sigma Co., C1416) to obtain a bacterial liquid;

(2) Mixing and infecting the k219 rice mature embryo embryogenic callus cultured for one month with the bacterial liquid in the step (1) for 30min, and transferring the bacterial liquid to a co-culture medium (N6 solid co-culture medium, sigma company) after the filter paper absorbs the bacterial liquid, and co-culturing for 3 days at 24 ℃;

(3) Inoculating the callus of the step (2) on N6 solid screening medium containing 100mg/L hygromycin for the first time (16 days);

(4) Selecting healthy calli, transferring the healthy calli into an N6 solid screening culture medium containing 100mg/L hygromycin for second screening, and carrying out secondary transfer every 15 days;

(5) Selecting healthy calli, transferring the healthy calli into an N6 solid screening culture medium containing 50mg/L hygromycin for third screening, and carrying out secondary once every 15 days;

(6) Selecting the resistant callus, transferring the resistant callus into a differentiation medium for differentiation; t of differentiated seedlings ₀ And (5) replacing positive plants.

4. Identification of transgenic plants

1. PCR molecular characterization

T obtained in the step three ₀ Extracting genome DNA from the plant, and amplifying by using the genome DNA as a template and using a Primer5 and a Primer6 as primers.

PCR reaction system: DNA (20 ng/. Mu.L) 2. Mu.L, primer5 (10 pmoL/. Mu.L) 2. Mu.L, primer6 (10 pmoL/. Mu.L) 2. Mu.L, 10xBuffer (MgCl) ₂ free)2μL，dNTP(10mM)0.4μL，MgCl ₂ (25mM)1.2μL，rTaq(5U/μL)0.4μL，ddH ₂ O10. Mu.L, total volume 20. Mu.L.

The amplification reaction was performed on a PTC-200 (MJ Research inc.) PCR instrument: 94 ℃ for 3min;94℃30sec,55℃30sec,72℃2min,35 cycles; and at 72℃for 10min.

The PCR products were separated by 8% native PAGE gel and stained with silver. And determining transgenic positive plants.

2. Phenotypic identification

Respectively T ₀ Substitution pCAMBIA1390-OsFLO26 positive plant and T ₀ The generation-transferred empty vector control plants, mutants k219 and N22 are planted in the transgenic field of the soil bridge rice breeding base of Nanjing agricultural university. After seed maturation, seeds of each material were harvested and transparence was observed in seeds of pCAMBIA1390-OsFLO26 plantsSeed (fig. 6). I.e., pCAMBIA1390-OsFLO26 can restore the floury endosperm of the k219 strain to a transparent endosperm similar to the wild type. Thus demonstrating that the mutant phenotype in k219 is caused by a mutation in OsFLO26, overexpression can restore it to be similar to wild-type.

Claims (10)

1. A gene, characterized in that: the gene is a DNA molecule shown in the following 1) or 2) or 3) or 4):

1) A DNA molecule shown in SEQ ID No. 1;

2) A DNA molecule shown in SEQ ID No. 2;

3) A DNA molecule which hybridizes under stringent conditions to the DNA sequence defined in 1) or 2) and which codes for a protein according to SEQ ID NO. 3;

4) A DNA molecule which has more than 90% homology with the DNA sequence defined in 1) or 2) or 3) and which encodes a related protein regulating the expression of a gene related to starch synthesis.

2. The protein encoded by the gene of claim 1.

3. A protein selected from any one of the proteins shown in (a) or (b):

(a) A protein consisting of the amino acid sequence shown in SEQ ID NO. 3;

(b) And (b) a protein which is derived from the SEQ ID NO.3, is related to endosperm development and is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the amino acid sequence of the SEQ ID NO. 3.

4. A recombinant expression vector, expression cassette or recombinant bacterium comprising the gene of claim 1.

5. The recombinant expression vector of claim 4, wherein: the recombinant expression vector is a recombinant plasmid obtained by inserting the gene of claim 1 between the multiple cloning sites HindIII and BamHI of pCAMBIA1390 vector.

6. A primer pair for amplifying the full length of the gene of claim 1 or any fragment thereof or a targeting primer involved in fine targeting the gene of claim 1.

The application of the gene shown in SEQ ID NO.1 or SEQ ID NO.2, the protein shown in SEQ ID NO.3, the recombinant expression vector, the expression cassette or the recombinant bacteria containing the gene shown in SEQ ID NO.1 or SEQ ID NO.2 in cultivating rice with normal starch synthesis; preferably, the application is that the gene shown in SEQ ID NO.1 or SEQ ID NO.2 is transferred into rice with the gene defect shown in SEQ ID NO.2 to obtain rice with normal starch synthesis.

8. A method for culturing transgenic plant with normal starch synthesis comprises introducing gene shown in SEQ ID NO.1 or SEQ ID NO.2 into abnormal starch synthesis plant with SEQ ID NO.2 gene defect to obtain transgenic plant with normal starch synthesis; preferably, the method is that the gene shown in SEQ ID NO.1 or SEQ ID NO.2 is introduced into a plant with abnormal starch synthesis through the recombinant expression vector according to claim 4 or 5, and preferably, the plant is rice.

9. A method for cultivating transgenic plants with abnormal starch synthesis comprises knocking out or silencing genes shown in SEQ ID NO.1 or SEQ ID NO.2 to obtain transgenic plants with abnormal starch synthesis; preferably, the plant is rice.

10. Use of the method of claim 9 for plant heritage modification or research.