CN116855511A - Rice endosperm flour related gene OsTML, encoding protein and application thereof - Google Patents

Abstract

The invention discloses a rice endosperm development related gene OsTML, and a coding protein and application thereof, and the gene OsTML provided by the invention is a DNA molecule as described in the following 1) or 2) or 3) or 4): 1) A DNA molecule shown in SEQ ID No. 1; 2) A DNA molecule shown in SEQ ID No. 2; 3) A DNA molecule which hybridizes under stringent conditions to the DNA sequence defined in 1) or 2) and which encodes said protein; 4) A DNA molecule having more than 90% homology with the DNA sequence defined in 1) or 2) or 3) and encoding a plant endosperm development related protein. The invention also provides the protein encoded by the gene, the protein affects the development of plant endosperm, and the encoding gene of the protein is introduced into plants with abnormal endosperm development, so that transgenic plants with normal endosperm development can be cultivated. The protein and the coding gene thereof can be applied to plant genetic improvement.

Description

Rice endosperm flour related gene OsTML, encoding protein and application thereof

Technical Field

The invention belongs to the field of genetic engineering, and in particular relates to a rice endosperm development related gene OsTML, and a coding protein and application thereof.

Background

The rice is taken as one of important ration in China, and the quality of the rice directly influences the daily life of people. In rice kernels, endosperm is the main energy storage organ, stores a large amount of starch, protein and lipid, provides energy for seed germination and seedling development, and is also the main source of human food.

The existing researches show that the development of rice endosperm is commonly regulated and controlled by various metabolic pathways, such as starch synthesis, transportation and metabolism of storage proteins, sugar transportation and metabolism, development of powder production, mitochondrial function and the like. Therefore, the excavation of new regulatory factors has important significance for researching a rice endosperm development regulation network and future rice quality improvement work.

Scientists have found a large number of mutants with a pink phenotype in chemically mutagenized rice seeds with loose arrangement of starch particles in the endosperm of the seed. With the rapid development of molecular biology and molecular genetic methods and techniques, a number of functional genes have been cloned to date that directly or indirectly regulate endosperm development. However, the regulatory network of rice endosperm development remains unclear, requiring us to locate and clone more genes to further reveal the mechanisms of rice endosperm development.

Disclosure of Invention

The invention aims to disclose a rice endosperm flour related gene OsTML and a coding protein and application thereof.

The gene OsTML provided by the invention is a DNA molecule described in the following 1) or 2) or 3) or 4):

1) A DNA molecule shown in SEQ ID No. 1;

2) A DNA molecule shown in SEQ ID No. 2;

3) A DNA molecule which hybridizes under stringent conditions to the DNA sequence defined in 1) or 2) and which encodes said protein;

4) A DNA molecule having more than 90% homology with the DNA sequence defined in 1) or 2) or 3) and encoding a plant endosperm development related protein.

The invention also provides a protein encoded by the gene OsTML.

Specifically, the protein provided by the invention is selected from any one of the following (a) or (b):

(a) A protein consisting of the amino acid sequence shown in SEQ ID NO. 3;

(b) And (b) a protein which is derived from the SEQ ID NO.3, is related to endosperm development and is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the amino acid sequence of the SEQ ID NO. 3.

The invention also provides a recombinant expression vector, an expression cassette, a transgenic cell line or recombinant bacteria containing the gene OsTML. Recombinant expression vectors containing any of the above genes are also within the scope of the present invention.

Recombinant expression vectors containing the genes can be constructed using existing plant expression vectors.

The plant expression vector comprises a binary agrobacterium vector, a vector which can be used for plant microprojectile bombardment and the like. The plant expression vector may also comprise the 3' -untranslated region of a foreign gene, i.e., comprising a polyadenylation signal and any other DNA segments involved in mRNA processing or gene expression. The polyadenylation signal directs the addition of polyadenylation to the 3 'end of the mRNA precursor, and may be similarly functional in the untranslated regions transcribed from the 3' end of, for example, agrobacterium tumefaciens induction (Ti) plasmid genes (e.g., nopaline synthase Nos genes) and plant genes (e.g., soybean storage protein genes).

When the gene is used for constructing a recombinant plant expression vector, any one of an enhanced promoter or a constitutive promoter such as a cauliflower mosaic virus (CAMV) 35S promoter and a Ubiquitin promoter (Ubiquitin) of corn can be added before transcription initiation nucleotide, and the recombinant plant expression vector can be used alone or in combination with other plant promoters; in addition, when the gene of the present invention is used to construct a plant expression vector, enhancers, including translational enhancers or transcriptional enhancers, may be used, and these enhancers may be ATG initiation codon or adjacent region initiation codon, etc., but must be identical to the reading frame of the coding sequence to ensure proper translation of the entire sequence. The sources of the translational control signals and initiation codons are broad, and can be either natural or synthetic. The translation initiation region may be derived from a transcription initiation region or a structural gene.

In order to facilitate the identification and selection of transgenic plant cells or plants, the plant expression vectors used may be processed, for example, by adding genes encoding enzymes or luminescent compounds which produce a color change (GUS gene, luciferase gene, etc.), antibiotic markers with resistance (gentamicin markers, kanamycin markers, etc.), or anti-chemical marker genes (e.g., anti-herbicide genes), etc., which may be expressed in plants. From the safety of transgenic plants, transformed plants can be screened directly in stress without adding any selectable marker gene.

The recombinant over-expression vector can be a recombinant plasmid obtained by inserting the gene and a promoter thereof into a recombinant site of a restriction enzyme HindIII and BamHI double-enzyme cutting vector pCAMBIA 1390. pCAMBIA1390 containing OsTML was designated pOsTML:: osTML.

Expression cassettes, transgenic cell lines and recombinant bacteria containing any of the above genes (OsTML) are within the scope of the invention.

Primer pairs for amplifying the full length or any fragment of the gene (OsTML) are also within the scope of the invention, preferably Primer1/Primer2, primer3/Primer4, primer5/Primer6 and Primer1/Primer7.

The positioning primers involved in the fine positioning of this gene (see Table 1), inDel primers were self-designed primers required for this experiment, and these self-designed primers also fall within the scope of the present invention.

The invention also provides application of at least one of the genes, the proteins, the recombinant expression vectors, the expression cassettes, the transgenic cell lines or the recombinant bacteria in plant breeding.

The invention also provides application of the gene, the protein, at least one of the recombinant expression vector, the expression cassette, the transgenic cell line or the recombinant bacterium in cultivating transgenic plants with normal endosperm development.

The invention also provides a method for cultivating the transgenic plant with normal endosperm development, which is to introduce the gene into the plant with abnormal endosperm development to obtain the transgenic plant with normal endosperm development.

In particular, the gene may be introduced into plants with endosperm dysplasia by means of the recombinant expression vector.

The invention also provides application of the gene shown in SEQ ID NO.1 or SEQ ID NO.2 in cultivating endosperm dysplasia rice varieties, wherein the application is to knock out or silence the gene shown in SEQ ID NO.1 or SEQ ID NO.2 to obtain endosperm dysplasia rice; for example, the CRISPR-Cas9 technology is utilized to carry out site-directed mutation on the gene shown in SEQ ID NO.1 or SEQ ID NO.2 in wild normal plants, so as to obtain the transgenic rice with abnormal endosperm development.

The method for cultivating the rice variety with abnormal endosperm development or the application thereof in plant heritage improvement or research.

The gene encoding the protein is introduced into plant cells by using any vector capable of guiding the expression of exogenous genes in plants, and a transgenic cell line and a transgenic plant can be obtained. The expression vector carrying the gene may be transformed into plant cells or tissues by using conventional biological methods such as Ti plasmid, ri plasmid, plant viral vector, direct DNA transformation, microinjection, electric conduction, agrobacterium mediation, etc., and the transformed plant tissues are cultivated into plants. The plant host to be transformed may be either a monocot or a dicot, such as: tobacco, radix et rhizoma Baimai, arabidopsis thaliana, rice, wheat, corn, cucumber, tomato, poplar, turf grass, alfalfa, etc.

The beneficial effects are that:

the invention discovers, locates and clones a new plant endosperm flour related protein gene OsTML for the first time. The plant endosperm flour related proteins of the invention affect the endosperm development process of plants. Inhibiting the expression of the protein-encoding gene can cause a disruption in endosperm development in plant seeds, thereby allowing the cultivation of transgenic plants with endosperm variation. The coding gene of the protein is introduced into plants with abnormal endosperm development, so that plants with normal endosperm development can be cultivated. The protein and the coding gene thereof can be applied to plant genetic improvement.

Drawings

FIG. 1 shows the grain phenotype of wild type Ningjing No.2 and mutant Ostml.

Fig. 2 is a scanning electron microscope observation of wild Ningjing No.2 and mutant Ostml mature grains.

FIG. 3 shows semi-thin sections of wild Ning Japonica No.2 and mutant Ostml 9 days after flowering.

FIG. 4 shows the fine localization of mutant genes on chromosome 8.

FIG. 5 shows the transformation of pCAMBIA1390-OsTML into T ₀ T of the plant generation ₁ And (3) a seed phenotype.

Detailed Description

The following examples facilitate a better understanding of the present invention, but are not intended to limit the same. The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the examples described below, unless otherwise specified, were purchased from conventional biochemical reagent stores.

Example 1, characterization of Rice endosperm developmental mutant phenotypes and cloning of regulatory genes

1. Phenotype and genetic analysis of rice endosperm flour mutant Ostml

Screening an endosperm flour mutant from the offspring of the japonica rice variety Ning japonica rice No.2 tissue culture, and naming the endosperm flour mutant as Ostml.

FIG. 1 is a scan of the whole and cross-section of mature seeds from Ningjing No.2 and Ostml, with the mutant exhibiting a completely powdery endosperm phenotype as compared to Ningjing No. 2.

Scanning electron microscope observation is carried out on cross sections of Ningjing No.2 and Ostml mutant seeds (figure 2), the starch particles of the wild seeds are closely arranged and uniform in size, the starch particles of the Ostml mutant seeds are loosely arranged, and the particles are mostly round.

During the whole seed development process, the starch granule number of the Ostml mutant is significantly reduced compared with Ningjing No.2, and the phenotype of endosperm retardation is shown (figure 3).

2. Map cloning of mutant Gene loci

1. Localization of mutant genes

First, hybrid combination F of mutant Ostml and Dular was formulated ₁ F is obtained after the first generation of selfing ₂ Seed. Taking 10 extreme individuals with a powdery phenotype, extracting DNA, and then carrying out primary linkage to determine a target gene on a rice 8 th chromosome.

Using the common primers from the laboratory with the primers designed by themselves, the number of extreme individuals was increased to 463, and finally the gene of interest was determined between markers Z21 and Z29, with a segment size of 180kb (FIG. 4).

The method for SSR marker analysis is as follows:

(1) The method for extracting the total DNA of the selected single plant as a template comprises the following steps:

(1) taking about 0.2g of young rice leaves, placing the young rice leaves in a 2.0mLEppendorf tube, placing a steel ball in the tube, freezing the Eppendorf tube filled with the sample in liquid nitrogen for 5min, and placing the Eppendorf tube on a 2000 type GENO/GRINDER instrument for crushing the sample for 1min;

(2) adding 500. Mu.L of the extract (100 mM Tris-HCl (pH 8.0), 20mM EDTA (pH 8.0), 1.4M NaCl,0.2g/mL CTAB solution), and shaking once every 10min in a water bath at 42℃for 30 min;

(3) 500 μl chloroform was added: isoamyl alcohol (24:1), and standing for ten minutes after uniform mixing;

(4) centrifuging at 12000rpm for 5 minutes;

(5) sucking 300 mu L of supernatant, and adding 600 mu L of pre-cooled absolute ethyl alcohol at the temperature of 20 ℃;

(6) centrifuging at 12000rpm for 3min, pouring out supernatant, and air drying at room temperature;

(7) 100. Mu.L of 1 XDE (121 g of Tris in 1 liter of water, pH 8.0 adjusted with hydrochloric acid) was added to dissolve the DNA.

(2) The DNA extracted as described above was diluted to about 20 ng/. Mu.L and subjected to PCR amplification as a template.

PCR reaction System (10. Mu.L): 1. Mu.L of DNA (20 ng/. Mu.L), 1. Mu.L of upstream primer (2 pmol/. Mu.L), 1. Mu.L of downstream primer (2 pmol/. Mu.L), 10XBuffer (MgCl) ₂ free)1μL，dNTP(10mM)0.2μL，MgCl ₂ (25mM)0.6μL，rTaq(5U/μL)0.1μL，ddH ₂ O5.1. Mu.L, 10. Mu.L total.

PCR reaction procedure: denaturation at 94.0℃for 3min; denaturation at 94.0 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 1min, and total circulation for 35 times; extending at 72 ℃ for 10min; preserving at 10 ℃. The PCR reaction was performed in an MJ research hPTC-225 thermocycler.

(3) PCR product detection of SSR markers

The amplified products were analyzed by 8% non-denaturing polyacrylamide gel electrophoresis. The molecular weight of the amplified product was compared with that of a 50bp DNALader as a control, and silver staining was performed.

The primer development process is as follows:

and integrating the SSR markers of the public map with the rice genome sequence, and downloading BAC/PAC cloning sequences near the mutation sites. Searching for potential SSR sequences in clones (number of repetitions > 6) using SSRHENTER (Li Jiang et al, genetics, 2005, 27 (5): 808-810) or SSRIT on-line software (http:// archive. Gram. Org/db/markers/ssrtool); comparing the SSRs and sequences adjacent to 400-500 bp with corresponding indica rice sequences on line at NCBI through BLAST program, and preliminarily deducing that polymorphism exists between indica rice and japonica rice in PCR products of the SSR primers if the SSR repetition times of the SSR sequences are different; and then designing SSR primers by using Primer Premier 5.0 software, and synthesizing by Nanjing Jinsri biotechnology Co. Self-designed SSR pair primers are mixed in equal proportion, the polymorphism between Dular and Nipponbare is detected, and the polymorphism is used as a molecular marker for fine localization. The molecular markers used for fine localization are shown in Table 1.

TABLE 1 molecular markers for Fine localization

2. Cloning of the Pink Gene

Through sequencing within a 180kb interval, the Ostml gene is found to have one base substitution,

primers were designed based on the sequences published on the network as follows:

Primer1：5'AGATCTCACCCAACCACCTC 3'；

Primer2：5'AATCAAGGGTAAAGTAACAA3'。

PCR amplification is carried out by using Primer1 and Primer2 as primers and developing endosperm DNA of Ningjing No.2 as a template to obtain a target gene. The amplification reaction was performed on a PTC-200 (MJ research inc.) PCR instrument: 94 ℃ for 3min;94 ℃ for 30sec,55 ℃ for 30sec,72 ℃ for 4min,35 cycles; and at 72℃for 10min. The PCR product was recovered and purified, then ligated to pMD18-T (Japanese Takara Co., ltd.), E.coli DH 5. Alpha. Competent cells (Beijing Tiangen Co., CB 101) were transformed, and positive clones were selected and sequenced.

The sequence determination result shows that the fragment obtained by PCR reaction has the nucleotide sequence shown as SEQ ID NO.2, and encodes a protein consisting of 641 amino acid residues (see SEQ ID NO.3 of the sequence table). The protein shown in SEQ ID NO.3 is named OsTML, and the encoding gene of the protein shown in SEQ ID NO.3 is named OsTML.

Example 2 acquisition and identification of transgenic plants

1. Recombinant expression vector construction

No intron is found in OsTML by NCBI, so that genome DNA of Ningjing No.2 (from rice germplasm resource library of Nanjing agricultural university) is used as a template, and Primer3/4 is used as a Primer to carry out PCR amplification to obtain a full-length template sequence of a promoter and CDS of an OsTML gene. And (3) carrying out PCR (polymerase chain reaction) amplification by taking the full-length fragment amplified by the Primer3/4 as a template and the Primer5/6 as a Primer to obtain the promoter and CDS full-length (SEQ ID NO. 1) of the OsTML gene.

Carrying out PCR amplification to obtain an OsTML gene, wherein the PCR primer sequence is as follows:

Primer3：

5'ATAATTAAAAGTGGTGATGC 3'；

Primer4：

5'AACAACTACAATACAAAGAA3'；

Primer5：

5'CCGGCGCGCCAAGCTTCTGGGCGTTTCTCACTTGAT 3'；

Primer6：

5'GAATTCCCGGGGATCCTTAGATGCACAGATAACTCC 3'。

the primers Primer3 and Primer4 were located 2kb upstream of the gene shown in SEQ ID NO.2, and the amplified product was the promoter of the gene, and the PCR product 1 was recovered and purified. The CDS full length of the gene was amplified by primers Primer5 and Primer6, and the PCR product 2 was recovered and purified. The two-stage PCR product was cloned into vector pCAMBIA1390 using INFUSION recombination kit (Japanese Takara). INFUSION recombinant reaction System (10. Mu.L): 1.0. Mu.L of PCR product, 2.0. Mu.L of PCR product, 5.0. Mu.L of pCAMBIA1305, 2.0. Mu.L of 5X infusion buffer, infusionenzyme mix. Mu.L. After brief centrifugation, the mixture was subjected to a water bath at 37℃for 15 minutes and then a water bath at 50℃for 15 minutes, and 2.5. Mu.L of the reaction system was used to transform E.coli DH 5. Alpha. Competent cells (Tiangen, beijing; CB 101) by heat shock. All the transformed cells were uniformly plated on LB solid medium containing 50mg/L kanamycin. After 16h incubation at 37℃the clone positive clones were picked and sequenced. As a result of sequencing, it was revealed that a recombinant expression vector containing the gene shown in SEQ ID No.1 was obtained, and pCAMBIA1390 containing OsTML was designated as pOsTML, in which the OsTML gene fragment was inserted between HindIII and BamHI cleavage sites of the vector using INFUSION recombination kit (Japanese Takara).

2. Acquisition of recombinant Agrobacterium

OsTML was transformed into Agrobacterium EHA105 strain (purchased from the company Johnst, USA) by electric shock method to obtain recombinant strain, and the plasmid was extracted for PCR and enzyme digestion identification. The correct recombinant strain identified by PCR and enzyme digestion is named EH-pOsTML.

The agrobacterium EHA105 strain was transformed using pCAMBIA1390 as control vector, as described above, to obtain a trans-empty vector control strain.

3. Acquisition of transgenic plants

OsTML and empty vector transferring control strain are respectively transformed into rice endosperm flour mutant Ostml, and the specific method is as follows:

(1) Culturing EH-pOsTML at 28deg.C for 16 hr, collecting thallus, and diluting into N6 liquid culture medium (Sigma Co., C1416) until the concentration is OD600 ≡0.5 to obtain bacterial liquid;

(2) Mixing and infecting the mature embryo embryogenic callus of the Ostml rice cultivated to one month with the bacterial liquid in the step (1) for 30min, sucking the bacterial liquid by filter paper, transferring into a co-cultivation medium (N6 solid co-cultivation medium, sigma company), and co-cultivating for 3 days at 24 ℃;

(3) Inoculating the callus of the step (2) on N6 solid screening medium containing 100mg/L hygromycin for the first time (16 days);

(4) Selecting healthy calli, transferring the healthy calli into an N6 solid screening culture medium containing 100mg/L hygromycin for second screening, and carrying out secondary transfer every 15 days;

(5) Selecting healthy calli, transferring the healthy calli into an N6 solid screening culture medium containing 50mg/L hygromycin for third screening, and carrying out secondary once every 15 days;

(6) Selecting the resistant callus, transferring the resistant callus into a differentiation medium for differentiation; t of differentiated seedlings ₀ And (5) replacing positive plants.

4. Identification of transgenic plants

1. PCR molecular characterization

T obtained in the step three ₀ Extracting genome DNA from the plant, and amplifying by using the genome DNA as a template and using Primer1 and Primer7 as primers.

PCR reaction system: DNA (20 ng/. Mu.L) 2. Mu.L, primer5 (10 pmoL/. Mu.L) 2. Mu.L, primer6 (10 pmoL/. Mu.L) 2. Mu.L, 10xBuffer (MgCl) ₂ free)2μL，dNTP(10mM)0.4μL，MgCl ₂ (25mM)1.2μL，rTaq(5U/μL)0.4μL，ddH ₂ O10. Mu.L, total volume 20. Mu.L.

The amplification reaction was performed on a PTC-200 (MJ Research inc.) PCR instrument: 94 ℃ for 3min;94℃30sec,55℃30sec,72℃2min,35 cycles; and at 72℃for 10min.

The PCR products were separated by 8% native PAGE gel and stained with silver. And determining transgenic positive plants.

2. Phenotypic identification

Respectively T ₀ Substitution transfer pOsTML is shown in OsTML positive plants, T ₀ The generation-transferred empty vector control plants, mutant Ostml and Ningjing No.2 are planted in a transgenic field of a soil bridge rice breeding base of Nanjing university. After seed maturation, seeds of each material were harvested and pOsTML was observed as the appearance of clear seeds in the seeds of OsTML plants (FIG. 5). Thus, it was demonstrated that phenotypic variation of Ostml mutants was caused by mutation of Ostml. OsTML the pink endosperm of the Ostml mutant can be restored to transparent endosperm similar to wild type.

Claims (10)

1. A gene, characterized in that: the gene is a DNA molecule shown in the following 1) or 2) or 3) or 4):

1) A DNA molecule shown in SEQ ID No. 1;

2) A DNA molecule shown in SEQ ID No. 2;

3) A DNA molecule which hybridizes under stringent conditions to the DNA sequence defined in 1) or 2) and which codes for a protein according to SEQ ID NO. 3;

4) A DNA molecule having more than 90% homology with the DNA sequence defined in 1) or 2) or 3) and encoding an endosperm development related protein.

2. The protein encoded by the gene of claim 1.

3. A protein selected from any one of the proteins shown in (a) or (b):

(a) A protein consisting of the amino acid sequence shown in SEQ ID NO. 3;

(b) And (b) a protein which is derived from the SEQ ID NO.3, is related to endosperm development and is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the amino acid sequence of the SEQ ID NO. 3.

4. A recombinant expression vector, expression cassette or recombinant bacterium comprising the gene of claim 1.

5. The recombinant expression vector of claim 4, wherein: the recombinant expression vector is a recombinant plasmid obtained by inserting the gene of claim 1 between the multiple cloning sites HindIII and BamHI of pCAMBIA1390 vector.

6. A primer pair for amplifying the full length of the gene of claim 1 or any fragment thereof or a targeting primer involved in fine targeting the gene of claim 1.

The application of the gene shown in SEQ ID NO.1 or SEQ ID NO.2, the protein shown in SEQ ID NO.3, the recombinant expression vector containing the gene shown in SEQ ID NO.1 or SEQ ID NO.2, the expression cassette or the recombinant bacteria in cultivating rice with normal endosperm development; preferably, the application is that the gene shown in SEQ ID NO.1 or SEQ ID NO.2 is transferred into rice with the gene defect shown in SEQ ID NO.2, so as to obtain the rice with normal endosperm development.

8. A method for culturing transgenic plant with normal endosperm development comprises introducing gene shown in SEQ ID NO.1 or SEQ ID NO.2 into endosperm dysplasia plant with SEQ ID NO.2 gene defect to obtain transgenic plant with normal endosperm development; preferably, the method is to introduce the gene shown in SEQ ID NO.1 or SEQ ID NO.2 into a plant with endosperm dysplasia, preferably, rice, by using the recombinant expression vector according to claim 4 or 5.

A method for cultivating endosperm dysplasia rice varieties by using a gene shown in SEQ ID NO.1 or SEQ ID NO.2, wherein the method is to knock out or silence the gene shown in SEQ ID NO.1 or SEQ ID NO.2 to obtain endosperm dysplasia rice; preferably, the CRISPR-Cas9 technology is utilized to carry out site-directed mutagenesis on the gene shown in SEQ ID NO.1 or SEQ ID NO.2 in wild normal plants to obtain the transgenic rice with abnormal endosperm development.

10. Use of the method of claim 9 for improvement or research of rice heritage.