CN117025487A - Screening of azotobacter of Coxsackie and application thereof - Google Patents

Screening of azotobacter of Coxsackie and application thereof Download PDF

Info

Publication number
CN117025487A
CN117025487A CN202311277829.1A CN202311277829A CN117025487A CN 117025487 A CN117025487 A CN 117025487A CN 202311277829 A CN202311277829 A CN 202311277829A CN 117025487 A CN117025487 A CN 117025487A
Authority
CN
China
Prior art keywords
lwnf014
microbial agent
coxsackie
strain
corn
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202311277829.1A
Other languages
Chinese (zh)
Other versions
CN117025487B (en
Inventor
金祥
周志强
王吉龙
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Liangwei Biotechnology Research Institute Co ltd
Original Assignee
Beijing Liangwei Biotechnology Research Institute Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Liangwei Biotechnology Research Institute Co ltd filed Critical Beijing Liangwei Biotechnology Research Institute Co ltd
Priority to CN202311277829.1A priority Critical patent/CN117025487B/en
Publication of CN117025487A publication Critical patent/CN117025487A/en
Application granted granted Critical
Publication of CN117025487B publication Critical patent/CN117025487B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C12N1/205—Bacterial isolates
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
    • A01N63/20—Bacteria; Substances produced thereby or obtained therefrom
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01P—BIOCIDAL, PEST REPELLANT, PEST ATTRACTANT OR PLANT GROWTH REGULATORY ACTIVITY OF CHEMICAL COMPOUNDS OR PREPARATIONS
    • A01P21/00—Plant growth regulators
    • C—CHEMISTRY; METALLURGY
    • C05—FERTILISERS; MANUFACTURE THEREOF
    • C05F—ORGANIC FERTILISERS NOT COVERED BY SUBCLASSES C05B, C05C, e.g. FERTILISERS FROM WASTE OR REFUSE
    • C05F11/00—Other organic fertilisers
    • C05F11/08—Organic fertilisers containing added bacterial cultures, mycelia or the like
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/04—Preserving or maintaining viable microorganisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Virology (AREA)
  • Microbiology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Pest Control & Pesticides (AREA)
  • Plant Pathology (AREA)
  • Environmental Sciences (AREA)
  • Agronomy & Crop Science (AREA)
  • Dentistry (AREA)
  • Botany (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Fertilizers (AREA)

Abstract

The invention relates to the technical field of microorganisms, in particular to a strain of Coxsackie LWNF014Kosakonia sacchari) And applications thereof. The LWNF014 sieve is selected from farmland of Jilin princess, and the preservation number is CGMCC No.28352. The strain has nitrogen fixation capability, can form high-efficiency interaction with corn, can accelerate the growth process of corn, and can promote the chlorophyll content of leaves. The strain is used for preparing the efficient microbial agent, and has the advantages of low production cost, simple operation and no secondary effect on soilPollution and the like.

Description

Screening of azotobacter of Coxsackie and application thereof
Technical Field
The invention relates to the technical field of microorganisms, in particular to a strain of CoxsackieKosakonia sacchariIs provided.
Background
The corn is an extremely important grain crop and feed crop, has large production potential and high economic benefit, has multiple purposes of eating, feeding, chemical industry and the like, and has important strategic positions in the aspects of guaranteeing grain safety and the like. In recent years, the corn sowing area and the corn yield in China are generally in a stable growth state. The requirement of the growth and development of the corn on the soil is high, and the soil which is rich, loose, breathable and well drained is favored, and if the soil is insufficient in fertility or contains excessive impurities, the yield and quality of the corn can be directly affected. In some areas, in order to fully utilize limited land resources, wheat and corn rotation planting technology is adopted, but because photo-thermal resources are unevenly distributed along seasons, corn can only be planted with varieties with short growth period, and the problems of relatively low annual yield of wheat and corn, limited variety selection and the like are caused.
Nitrogen is one of the three major nutrients necessary for plant growth and development, and is an important component of not only proteins, nucleic acids, and chlorophyll in plants, but also various enzymes in plants. Meanwhile, it is also a component of some vitamins and alkaloids in plants. A large number of research results prove that the application amount of the nitrogen fertilizer directly influences the growth of crops and the formation of final yield in the growth process of the crops, and simultaneously, the physiological metabolism in the growth process of the crops can be obviously influenced. For the purpose of increasing yield, traditional fertilisation often overuses chemical fertilisers, which have, are and will continue to create a series of negative problems: such as soil hardening, physical and chemical property change, massive death of beneficial bacteria, earthworms and the like in the soil, excessive enrichment of certain elements and the like. The direct impact of these negative problems in short term is the reduced crop yield and increased environmental pollution. In the long term, excessive use of chemical fertilizers reduces self-regeneration and circulation capacity of soil fertility, and further, more chemical fertilizers are required to be used, thereby forming vicious circle. Therefore, the microbial technology is used for exploring other green pollution-free ways to replace the current chemical fertilizer application so as to meet the sustainable development of agriculture and the like, and has important significance. Nitrogen-fixing bacteria naturally exist in nature, especially in soil, and can convert nitrogen elements in simple substance form in air into ammonium ions which can be utilized by plants through self nitrogen fixation function, so that nitrogen fertilizer nutrition is provided for the plants. Attempts have been made to isolate efficient nitrogen-fixing strains which can be symbiotic with crops from soil microbial flora, partially or completely replace industrial nitrogenous fertilizer, and support the growth of crops. However, the known nitrogen-fixing bacteria have the problems of weak nitrogen fixing capability, insignificant growth promotion effect on plants and the like, and are not suitable for being used as the supplement or replacement of industrial nitrogen fertilizer.
In conclusion, the nitrogen-fixing bacterial strain which is originally screened from the soil and has the effect of promoting the growth of the corn is used as a microbial fertilizer to partially or completely replace chemical fertilizer, so that the growth and development of the corn are improved, the stable yield and the yield increase of the corn are realized, the ecological environment of the soil is not destroyed or even improved, and the nitrogen-fixing bacterial strain has great demand potential.
Disclosure of Invention
The invention aims to provide a strain of the LWNF014 with nitrogen fixation functionKosakonia sacchari) And related applications thereof.
Another object of the present invention is to provide a strain of Coxsackie LWNF014 having a growth promoting effect on cornKosakonia sacchari）。
Another object of the present invention is to provide LWNF014 of Coxsackie having one or more of the above-mentioned capabilities simultaneouslyKosakonia sacchari) And related applications thereof.
In order to achieve the above purpose, the present invention provides the following technical solutions:
LWNF014 of Saccharomycetes, which has been deposited at China general microbiological culture Collection center (CGMCC) at 9.04 of 2023, with accession number CGMCC No.28352, the national academy of sciences of China, including North Chen West Lu No. 1, 3 of the Korean region of Beijing, and classified and named asKosakonia sacchari。
The Coxsackie bacteria LWNF014 is obtained from the root week and rhizosphere soil of corn plants in Jilin princess, through multiple screening, can grow in a nitrogen-free culture medium, and has nitrogen fixation capability. The strain is subjected to 16S rDNA sequencing, and the sequence of the strain is shown as SEQ ID NO.1. The strain is identified to belong to genus Coxsackie at molecular level by combining the physiological and biochemical test results, and is classified and named asKosakonia sacchari。
Corn colonization experiments prove that the saxophone strain LWNF 014%Kosakonia sacchari) Has the effects of increasing chlorophyll content of corn, increasing nitrogen content of leaf, and increasing biomass of corn.
The invention provides a strain of Coxsackie LWNF014Kosakonia sacchari) The preservation number of the LWNF014 of the Cola-type bacillus is CGMCC No.28352.
The invention provides a strain of CoxsackieLWNF014（Kosakonia sacchari) As the application of azotobacter, the preservation number of the LWNF014 of the Cola-type bacillus is CGMCC No.28352.
The invention provides a strain of Coxsackie LWNF014Kosakonia sacchari) Use of said Coxsackie bacteria for promoting plant growthThe preservation number of LWNF014 is CGMCC No.28352. The plant may be a crop, preferably maize.
The invention provides an application of a strain of kosakazakii LWNF014, which can improve nitrogen fixation, promote photosynthesis and improve chlorophyll content.
The invention further provides a microbial nitrogen fixation microbial agent, which contains the KlebsiellaLWNF014, said CoxsackieThe preservation number of LWNF014 is CGMCC No.28352. The microbial azotobacter can be applied as a fertilizer to plants, preferably crops, especially corn.
The invention further provides a plant growth-promoting microbial agent, which contains the saxophone bacillusLWNF014, said CoxsackieThe preservation number of LWNF014 is CGMCC No.28352. The microbial growth-promoting agent may be applied as a fertilizer to plants, preferably crops, especially maize.
In the above-mentioned microbial inoculum, the effective viable count of the LWNF014 of the above-mentioned Coxsackie bacteria is preferably 10 10 ～10 11 CFU/g。
The invention provides a microbial agent, which contains a coxsackie LWNF014, wherein the preservation number of the coxsackie LWNF014 is CGMCC No.28352.
The invention provides a preparation method of a microbial agent, which comprises the steps of preparing seed liquid after activating LWNF014 of the kosakazakii, inoculating to a fermentation medium for expanding culture to a stable period, and separating to obtain the microbial agent.
The invention provides a plant photosynthesis improver, a nitrogen nutrition improver and a plant growth promoter, which comprise kex bacillus LWNF014 or a microbial agent comprising kex bacillus LWNF014.
The microbial agent can be prepared by adopting a conventional microbial agent preparation mode in the field, and can be various microbial agents, such as liquid microbial agents or solid microbial agents, preferably solid microbial agents.
The solid microbial inoculum is preferably prepared by adopting a fermentation freeze-drying mode.
The invention provides a method for preparing freeze-dried bacterial manure, which comprises the steps of centrifugally separating fermentation liquor obtained by fermenting LWNF014 of Coxsackie to obtain bacterial precipitate, adding a freeze-drying protective agent, and carrying out freeze-drying treatment under a sterile condition to prepare freeze-dried powder.
The freeze-drying protective agent is prepared from skimmed milk powder, sodium glutamate, glycerol, sucrose and water according to a mass ratio of 75:15:70:10:330 are mixed.
The effective viable count of the LWNF014 freeze-dried powder of the Coxsackie bacteria is 10 10 ～10 11 CFU/g, and can be stored for 6 months at normal temperature without reducing activity.
Drawings
FIG. 1 is a colony PCR-based test on the genome of saxophone LWNF014nifHElectrophoresis diagram of genes
FIG. 2 is a graph showing the effect of treatment with LWNF014 bacteria of Coxsackie on maize seedling growth after 7 days
FIG. 3 is a graph showing the effect of treatment with LWNF014 bacteria of Coxsackie on maize seedling growth after 14 days
FIG. 4 is a graph showing the effect of LWNF014 bacteria of Coxsackie on chlorophyll and nitrogen content of maize seedlings after 7 days of treatment
FIG. 5 is a graph showing the effect of LWNF014 bacteria of Coxsackie on chlorophyll and nitrogen content of maize seedlings after 14 days of treatment
FIG. 6 is a schematic diagram showing the preparation process of LWNF014 bacterial manure of Coxsackie
Detailed Description
The invention will be further illustrated with reference to specific examples. The specific experimental conditions are not specified and are conventional conditions well known to those skilled in the art.
Example 1 screening of azotobacter LWNF014
Soil and corn root samples were collected in Jilin princess corn fields, transported to the laboratory at low temperature, and plated on nitrogen-free media KPM (media formulation see Table 1). The monoclonal strain on the plate is picked up, and the monoclonal strain is drawn on the KPM plate without nitrogen medium again for purification. PCR amplification of 16s rRNA gene and sequencing, and sequence comparison to identify one strain LWNF014 belonging to genus CoxsackieKosakonia sacchariThe 16s rRNA sequence of the strain is shown as SEQ ID NO. 1.
TABLE 1 KPM Nitrogen-free Medium formulation
Example 2 identification of Azotobacter strain LWNF014 Nitrogen-fixing Gene
By nitrogen fixation genesnifHIs a specific primer Ks nifH-F: tcatcaataacaatccctgcgacgc KsnifH-R: agccttcgcaccgcaccggaataac colony PCR of LWNF014 of Klebsiella, the result of electrophoresis of the PCR product (FIG. 1) showed amplification of a specific band of about 2037bp in length, and Klebsiella variabilisnifHThe sizes are consistent, which indicates that the strain carries nitrogen fixation genesnifH(FIG. 1).
Example 3 determination of Azotobacter strain LWNF014 Azotobacter activity
Strains in the logarithmic growth phase were transferred to LB liquid medium and shake cultured overnight at 30℃in a 220RPM shaker. Determination of OD of strains Using a Spectrophotometer 600 After that, 5500RPM and 5mint are centrifugated to collect thalli, thereby facilitatingAfter 3 washes with nitrogen-free KPM liquid medium, suspended in nitrogen-free KPM medium, the od600=0.2 was adjusted. 2 ml of bacterial liquid is added into each anaerobic tube, meanwhile, an anaerobic tube added with 2 ml of nitrogen-free KPM is adopted as a control (without bacteria addition), a plug sealing cover is added to enable the anaerobic tube to be in a sealing state, 2 ml of acetylene gas is injected into the anaerobic tube, and the anaerobic tube is placed into a 30 ℃ incubator for static culture for 16 hours after shaking evenly. 1 ml of gas was extracted from each anaerobic tube by a microsyringe, and the gas chromatograph was used to measure the ethylene content.
TABLE 2 determination of ethylene production in the product of the enzyme activity assay
As can be seen from the measurement results in Table 2, when LWNF014 of Coxsackie bacteria was added to the anaerobic tube, it could catalyze the conversion of acetylene to ethylene, whereas the control group without bacteria did not detect the generation of ethylene, and the activity of the nitrogen fixation enzyme of LWNF014 of Coxsackie bacteria could be calculated to be 0.35 nmol C based on the actual measured concentration/area ratio of acetylene standard gas 2 H 4 And/h via, which fully demonstrates that the kosakazakii LWNF014 has higher nitrogen fixation activity.
Example 4 Effect of Coxsackie LWNF014 on maize growth
Inoculating Coriolus strain LWNF014 into LB medium, culturing at 30deg.C and 220RPM for 16 hr, centrifuging at 5500RPM in a centrifuge for 5mint to collect thallus, pouring supernatant, and adjusting its concentration to 10 with sterile PBS 9 CFU/ml. Corn seeds were seeded in 50ml centrifuge tubes, 200. Mu.l of the prepared bacterial suspension was added to the experimental group, and 10 ml of sterile water was added (right centrifuge tube in FIGS. 2 and 3). 200 microliters of sterile PBS and 10 milliliters of sterile water (left centrifuge tube in FIGS. 2 and 3) were added to the control. Two treatments were each repeated in 4 sets. And then watered 5 ml every other day. After 3 weeks of planting, the chlorophyll content (namely SPAD value) of the corn is measured by a chlorophyll meter to represent the photosynthesis capacity, and the leaf nitrogen content can be calculated because the SPAD value has a specific proportional relation with the plant nitrogen content.
Corn growth was as shown in fig. 2, 3 and table 3, and at 7 days of culture, the corn seedlings of the experimental group to which the LWNF014 strain suspension of kosakes bacteria was applied were 20cm high, while the corn seedlings of the control group to which no bacterial liquid was applied were 15cm high, the experimental group was 33% higher than the control group, and the diameter of the corn seedlings of the experimental group was also significantly thicker than the control group. When the corn seedlings of the experimental group are cultured for 14 days, the corn seedlings of the experimental group enter the 4-leaf period, the corn seedlings of the control group are still in the 3-leaf period, the advantages of the height and the diameter of the corn seedlings of the experimental group relative to the corn seedlings of the control group are continuously expanded, the height of the corn seedlings of the experimental group is 139% of that of the corn seedlings of the control group, and the difference between the two is further expanded relative to the corn seedlings of the control group at 7 days. The above results fully demonstrate that the LWNF014 strain of Coxsackie can accelerate the growth of maize seedlings, make the maize seedlings not only grow higher but also thicker, and shorten the growth cycle of maize.
TABLE 3 height and diameter statistics of maize seedlings grown for 7 days
As is clear from the results shown in FIGS. 4 and 5, the average chlorophyll content of the maize seedlings of the control group to which the bacterial liquid was not applied was 37 SPAD and the average nitrogen content of the leaves was 14 mg/g when cultured for 7 days. Whereas the corn seedlings of the experimental group to which the suspension of the LWNF014 bacteria of the Coxsackie bacteria was applied had a chlorophyll content of 43.8 SPAD and a leaf nitrogen content of 16 mg/g, which were improved by 18% and 14% respectively relative to the control group. When cultured for 14 days, the corn seedlings of the control group without the bacterial liquid have the chlorophyll content of 29 SPAD and the leaf nitrogen content of 12 mg/g. Whereas the corn seedlings of the experimental group to which the suspension of the LWNF014 bacteria of the Coxsackie bacteria was applied had a chlorophyll content of 38.5 SPAD and a leaf nitrogen content of 14 mg/g, which was improved by 32% and 16% respectively compared with the control group. The results show that the application of the LWNF014 strain of the Coxsackie bacteria can promote the storage of chlorophyll and the accumulation of nitrogenous substances in corn seedlings and promote the growth of the corn seedlings.
Example 5 preparation of microbial fertilizer
For convenient storage and transportation, the selected kosakazakii LWNF014 of example 2 was prepared as a lyophilized powder bacterial fertilizer. Specifically (see fig. 6 for preparation flow):
(1) And (3) performing centrifugal separation on the fermentation liquor of the Klebsiella LWNF014 to obtain a bacterial precipitate.
(2) Skimmed milk powder, sodium glutamate, glycerol, sucrose and water according to a mass ratio of 75:15:70:10:330 are mixed to prepare the freeze-drying protective agent.
(3) The freeze-drying protective agent is prepared by the following components in percentage by mass: 1 adding the bacterial precipitate obtained in the step (1) to fully mix and balance the bacterial precipitate and the protective agent for 60min, and freezing at the temperature of minus 20 ℃ overnight.
(4) Freeze-drying under aseptic condition to obtain freeze-dried powder.
The effective viable count of the LWNF014 freeze-dried powder of the kosakazakii is 10 10 ～10 11 CFU/g, and can be stored for 6 months at normal temperature without reducing activity.
While the invention has been described in detail in the foregoing general description and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that modifications and improvements can be made thereto. Accordingly, such modifications or improvements may be made without departing from the spirit of the invention and are intended to be within the scope of the invention as claimed.

Claims (10)

1. A strain of Coxsackie LWNF014, characterized by a classification designated asKosakonia sacchariThe preservation number is CGMCC No.28352.
2. Use of the kesaxoplasma LWNF014 of claim 1 for promoting plant growth.
3. The use according to claim 2, wherein the plant is maize.
4. A use according to claim 2 or 3, wherein the nitrogen content of plants is increased, photosynthesis is promoted, and chlorophyll content is increased.
5. A microbial agent comprising the kea-saxobacteria LWNF014 of claim 1.
6. A method for preparing the microbial agent according to claim 5, wherein the method is characterized in that the microorganism agent is obtained by activating the kesaxophone LWNF014 according to claim 1 to prepare a seed solution, inoculating the seed solution to a fermentation medium, culturing the seed solution in an expanded manner until a stationary phase, and separating the seed solution.
7. The preparation method of the microbial agent as claimed in claim 5, which is characterized in that the microbial agent is prepared into freeze-dried bacterial fertilizer, and specifically comprises the following steps: centrifugally separating fermentation liquor obtained by fermenting the LWNF014 of the Coxsackie bacteria in claim 1 to obtain bacterial precipitate, adding a freeze-drying protective agent, and performing freeze-drying treatment under a sterile condition to prepare freeze-dried powder.
8. A plant photosynthesis improver comprising the kefir LWNF014 according to claim 1, or the microbial agent according to claim 5, or the microbial agent produced by the method according to any one of claims 6 to 7.
9. A plant nitrogen nutrition improver comprising the kefir LWNF014 according to claim 1, or the microbial agent according to claim 5, or the microbial agent prepared by the method of any one of claims 6 to 7.
10. A plant growth promoter comprising the kefir LWNF014 of claim 1, or the microbial agent of claim 5, or the microbial agent prepared by any one of claims 6 to 7.
CN202311277829.1A 2023-10-07 2023-10-07 Screening of azotobacter of Coxsackie and application thereof Active CN117025487B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202311277829.1A CN117025487B (en) 2023-10-07 2023-10-07 Screening of azotobacter of Coxsackie and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202311277829.1A CN117025487B (en) 2023-10-07 2023-10-07 Screening of azotobacter of Coxsackie and application thereof

Publications (2)

Publication Number Publication Date
CN117025487A true CN117025487A (en) 2023-11-10
CN117025487B CN117025487B (en) 2023-12-22

Family

ID=88632124

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202311277829.1A Active CN117025487B (en) 2023-10-07 2023-10-07 Screening of azotobacter of Coxsackie and application thereof

Country Status (1)

Country Link
CN (1) CN117025487B (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018132774A1 (en) * 2017-01-12 2018-07-19 Pivot Bio, Inc. Methods and compositions for improving plant traits
WO2021221690A1 (en) * 2020-05-01 2021-11-04 Pivot Bio, Inc. Modified bacterial strains for improved fixation of nitrogen
CN116144529A (en) * 2022-11-01 2023-05-23 云南大学 Rice saxophone OOR3-1 strain and application thereof
WO2023154805A2 (en) * 2022-02-09 2023-08-17 Pivot Bio, Inc. Dry formulated nitrogen-fixing microbe packaged in water-soluble film for rapid and safe dispersal in aqueous mixtures

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018132774A1 (en) * 2017-01-12 2018-07-19 Pivot Bio, Inc. Methods and compositions for improving plant traits
WO2021221690A1 (en) * 2020-05-01 2021-11-04 Pivot Bio, Inc. Modified bacterial strains for improved fixation of nitrogen
WO2023154805A2 (en) * 2022-02-09 2023-08-17 Pivot Bio, Inc. Dry formulated nitrogen-fixing microbe packaged in water-soluble film for rapid and safe dispersal in aqueous mixtures
CN116144529A (en) * 2022-11-01 2023-05-23 云南大学 Rice saxophone OOR3-1 strain and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
朱宇锟等: ""植物根际促生菌的促生机理与影响因素"", 《四川农业科技》, vol. 2023, no. 07, pages 80 - 84 *

Also Published As

Publication number Publication date
CN117025487B (en) 2023-12-22

Similar Documents

Publication Publication Date Title
EP1248754B1 (en) Biological addition to organic-mineral fertilizers
CN111073839B (en) Siam bacillus, microbial inoculum and application thereof
CN102199050A (en) Composite microbial fertilizer and preparation method thereof
CN104003804A (en) Moisture-retaining and nitrogen-fixing compound microbial fertilizer and preparation method thereof
CN112501072B (en) Crop rhizosphere soil conditioner and preparation method and application thereof
CN100569704C (en) A kind of K3 bacterial strain and microorganism organic fertilizer thereof that can dissolve soil calcium phosphate
CN113980854B (en) Microbial agent for promoting leguminous crops to increase root nodule number and root nodule nitrogen fixation enzyme activity and application thereof
CN103444981A (en) Method for Aspergillus oryzae to degrade edible and medicinal fungus dregs to produce protein feed
CN103951486A (en) Plant nutrition regulation liquid fertilizer and its production method
CN111533586B (en) Chicken manure bio-organic fertilizer and preparation method thereof
CN116396888A (en) Microbial composite microbial agent suitable for livestock and poultry manure and straw fermentation and preparation method thereof
WO2011099019A1 (en) Composition and method of preparation of bacterial based product that fix atmospheric nitrogen from air and makes available to plant
CN113278553B (en) Enhanced efficient nitrogen fixation composite bacterial system added with non-nitrogen fixation bacteria and application thereof
CN114250164B (en) Acinetobacter 1502IPR-05 with nitrogen fixation and phosphorus dissolution capabilities and application thereof
CN117486655A (en) Microbial fertilizer for improving photosynthetic efficiency of hybrid seed production rice and preparation method thereof
CN117025487B (en) Screening of azotobacter of Coxsackie and application thereof
CN114045247B (en) Bacillus seawater and application thereof in salinized farmland production
CN108192843B (en) Nitrogen fixation strain and microecological preparation thereof
CN112680373B (en) Bacillus mucilaginosus and method for preparing bio-organic fertilizer by using same through solid state fermentation
CN117004540B (en) Screening and application of Klebsiella variabilis azotobacter
CN112745151A (en) Composite biological organic fertilizer containing bacillus and trichoderma and preparation method thereof
CN117568198B (en) Jerusalem artichoke straw fermentation product of chrysobacterium, chrysobacterium and trichoderma and application of jerusalem artichoke straw fermentation product in promoting plant growth
CN113831167B (en) Microorganism rooting agent prepared from biogas slurry and preparation method thereof
RU2738726C1 (en) Strain of nodule bacteria mesorhizobium rcam02723-stimulator of chickpea yielding capacity and method of obtaining inoculum for chickpea
CN114409446B (en) Low-water solid-state fermentation method of drought-tolerant bacteria and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant