CN116891857A

CN116891857A - Rice endosperm flour related gene OsORTH2, encoding protein and application thereof

Info

Publication number: CN116891857A
Application number: CN202310921411.3A
Authority: CN
Inventors: 万建民; 段二超; 王益华; 董慧; 滕烜; 马文玉; 刘世家; 刘喜; 田云录; 杨雪; 江玲; 赵志刚
Original assignee: Nanjing Agricultural University
Current assignee: Nanjing Agricultural University
Priority date: 2023-07-26
Filing date: 2023-07-26
Publication date: 2023-10-17

Abstract

The invention discloses a rice endosperm flour related gene OsORTH2, a coded protein and application thereof, and the gene OsORTH2 provided by the invention is a DNA molecule described in the following 1) or 2) or 3): 1) A DNA molecule shown in SEQ ID No. 1; 2) A DNA molecule shown in SEQ ID No. 2; 3) A DNA molecule which hybridizes under stringent conditions to the DNA sequence defined in 1) or 2) and which encodes said protein. The invention also provides a protein coded by the gene, the protein influences development of plant endosperm, and the protein and the coding gene thereof can be applied to genetic improvement of plants.

Description

Rice endosperm flour related gene OsORTH2, encoding protein and application thereof

Technical Field

The invention belongs to the field of genetic engineering, and in particular relates to a rice endosperm flour related gene OsORTH2, and a coding protein and application thereof.

Background

The rice is the largest rice producing country and rice consuming country in the world, more than 65% of population takes rice as main food, and the rice yield increase plays an important role in guaranteeing the national grain safety. Due to the wide application of the "green revolution" gene, rice yield has been greatly improved in the past decades. In recent years, the demand for rice has changed from "full of eating" to "good of eating". High quality rice requires good taste quality, high nutritive value, good appearance quality, and easy processing, and high quality rice satisfying these conditions is popular with consumers. To meet the demands of people and improve the market competitiveness, breeders begin to strive to cultivate high-quality rice varieties.

In rice kernels, endosperm is the main energy storage organ, stores a large amount of starch, protein and lipid, provides energy for seed germination and seedling development, and is also the main source of human food. The development of endosperm not only affects the size of the seed, but also determines the quality of rice, including appearance quality, processing quality, taste quality, and nutritional quality. Abnormal development of rice endosperm not only causes poor phenotypes such as kernel shrinkage, endosperm flour quality and the like to influence the appearance quality of rice, but also causes the starch content and morphological structure to change to seriously influence the taste quality of rice. Thus, research on development of endosperm of rice is of great importance for improving yield and quality of rice.

Previous studies have shown that development of rice endosperm is commonly regulated by various metabolic pathways such as starch biosynthesis, storage protein transport, powder development, aleurone layer development, carbon nitrogen metabolism, sugar metabolism, mitochondrial function, and the like. Therefore, the excavation of new regulatory factors has important significance for researching a rice endosperm development regulation network and future rice quality improvement work.

Scientists have found in long-term studies of rice a large number of floury endosperm mutants that manifest themselves in a loose arrangement of endosperm starch granules, which exhibit an opaque phenotype. With the rapid development of molecular biology and molecular genetics methods and techniques, many researchers have conducted gene cloning and functional studies on the rice flour endosperm trait. To date, a number of functional factors have been cloned that directly or indirectly regulate endosperm development, but the regulatory network for rice endosperm development is not clear, which requires us to locate and clone more genes to further reveal the mechanisms of rice endosperm development.

Disclosure of Invention

The invention aims to disclose a rice endosperm flour related gene OsORTH2, and a coding protein and application thereof.

The gene OsORTH2 provided by the invention is a DNA molecule as described in the following 1) or 2) or 3):

1) A DNA molecule shown in SEQ ID No. 1;

2) A DNA molecule shown in SEQ ID No. 2;

3) A DNA molecule which hybridizes under stringent conditions to the DNA sequence defined in 1) or 2) and which encodes said protein;

the invention also provides a protein encoded by the gene OsORTH2.

Specifically, the protein provided by the invention is selected from any one of the following (a) or (b):

(a) A protein consisting of the amino acid sequence shown in SEQ ID NO. 3;

(b) And (b) a protein which is derived from the SEQ ID NO.3, is related to endosperm development and is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the amino acid sequence of the SEQ ID NO. 3.

The invention also provides a recombinant knockout vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing the gene OsORTH2. Recombinant expression vectors containing any of the above genes are also within the scope of the present invention.

Recombinant knockout vectors containing the genes can be constructed using existing plant expression vectors.

The plant expression vector comprises a CRISPR-Cas9 knockout vector and the like.

In order to facilitate the identification and selection of transgenic plant cells or plants, the plant knockout vector used may be processed, for example, for antibiotic markers (gentamicin markers, kanamycin markers, etc.) or for chemical resistance marker genes (e.g., herbicide resistance genes), etc. From the safety of transgenic plants, transformed plants can be screened directly in stress without adding any selectable marker gene.

The recombinant knockout vector is constructed using CRISPR-Cas9 technology. The knockout vector of OsORTH2 was designated as CRISPR-OsORTH2.

Transgenic cell lines and recombinant bacteria containing any of the above genes (OsORTH 2) are within the scope of the present invention.

Primer pairs for amplifying the full length or any fragment of the gene (OsORTH 2), preferably Primer1/Primer2, are also within the scope of the present invention.

Primer pairs for knocking out the gene (OsORTH 2), preferably Primer3/Primer4 and Primer5/Primer6, are also within the scope of the present invention.

The positioning primers involved in the fine positioning of this gene (see Table 1), all of which are self-designed primers required for this experiment, are also within the scope of the present invention.

The invention also provides application of the gene, the protein, at least one of the recombinant knockout vector, the expression cassette, the transgenic cell line or the recombinant bacterium in plant breeding.

The invention also provides a method for targeted knockout verification of a target gene by utilizing GRISPR-Cas9 technology, which is to subject the gene to targeted knockout to obtain a transgenic plant consistent with the powdery phenotype of mutant endosperm.

Specifically, the gene OsORTH2 can be knocked out at a fixed point by introducing the recombinant knockdown vector into a wild type plant with normal endosperm development.

The invention also provides application of the gene shown in SEQ ID NO.1 or SEQ ID NO.2 in cultivating endosperm dysplasia rice varieties, wherein the application is to knock out or silence the gene shown in SEQ ID NO.1 or SEQ ID NO.2 to obtain endosperm dysplasia rice; for example, the CRISPR-Cas9 technology is utilized to carry out site-directed mutation on the gene shown in SEQ ID NO.1 or SEQ ID NO.2 in wild normal plants, so as to obtain the transgenic rice with abnormal endosperm development.

The method for cultivating the rice variety with abnormal endosperm development or the application thereof in plant heritage improvement or research.

The invention also provides a gene shown as SEQ ID NO.1 or SEQ ID NO.2, a protein shown as SEQ ID NO.3, and application of a recombinant expression vector, an expression cassette or recombinant bacteria containing the gene shown as SEQ ID NO.1 or SEQ ID NO.2 in cultivating rice with normal endosperm development. In some embodiments, the application is to transfer the gene shown in SEQ ID NO.1 or SEQ ID NO.2 into rice with the gene defect shown in SEQ ID NO.1 or SEQ ID NO.2 to obtain rice with normal endosperm development. The transfer method may be a conventional method in the art.

The invention also provides a method for cultivating the transgenic plant with normal endosperm development, which is to introduce the gene shown in SEQ ID NO.1 or SEQ ID NO.2 into the endosperm dysplasia plant with the gene defect of SEQ ID NO.1 or SEQ ID NO.2 to obtain the transgenic plant with normal endosperm development. The method of introduction may be a method conventional in the art, and for example, the gene represented by SEQ ID NO.1 or SEQ ID NO.2 may be introduced into a plant having endosperm dysplasia by means of a recombinant expression vector. Preferably, the plant is rice.

The beneficial effects are that:

the invention discovers, positions and clones a new gene OsORTH2 of plant floury endosperm regulating protein for the first time. The plant floury endosperm-related proteins of the invention affect the endosperm development process of plants. Inhibiting the expression of the protein-encoding gene can cause a disruption in endosperm development in plant seeds, thereby allowing the cultivation of transgenic plants with endosperm variation. The protein and the coding gene thereof can be applied to plant genetic improvement.

Drawings

FIG. 1 shows the grain phenotype of wild type Ningjing No.2 and orth2 mutants.

Fig. 2 is a scanning electron microscope observation of wild Ningjing No.2 and orth2 mutant grains.

FIG. 3 is a grouting rate measurement of wild type Ningjing No.2 and orth2 mutants.

FIG. 4 shows thousand seed weight determinations of wild type Ningjing No.2 and orth2 mutants.

FIG. 5 shows the starch content measurement of wild type Ningjing No.2 and orth2 mutants.

FIG. 6 shows the fine localization and cloning of OsORTH2 gene.

FIG. 7 shows the knockout mutation site and T of CRISPR-OsORTH2 ₁ And (3) a seed phenotype.

FIG. 8 is a T of 35S: osORTH2-GFP ₁ And (3) a seed phenotype.

Detailed Description

The following examples facilitate a better understanding of the present invention, but are not intended to limit the same. The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the examples described below, unless otherwise specified, were purchased from conventional biochemical reagent stores.

Example 1 discovery of Rice endosperm development related locus and Gene encoding same

1. Phenotype and genetic analysis of rice flour endosperm orth2 mutant

Screening a floury endosperm mutant from offspring of japonica rice variety Ning japonica No.2 tissue culture, and naming the floury endosperm mutant as orth2.

The left image of FIG. 1 shows a scan of the whole and cross-section of mature Ningjing No.2 seed, which is indicative of a completely endosperm transparent phenotype, and the right image shows a scan of the whole and cross-section of orth2 mature seed, which is indicative of an endosperm opaque phenotype.

Scanning electron microscope observation was performed on the cross sections of the wild type and orth2 mutant seeds (fig. 2), the wild type seed starch particles were closely arranged and uniform in size, and the orth2 mutant seed starch particles were loosely arranged and mostly circular. Therefore, light is scattered as it passes through, resulting in an opaque phenotype of the orth2 grain appearance.

The level of dry matter accumulation was significantly reduced in the orth2 mutant compared to the wild type throughout endosperm development, with a more pronounced difference after 15 days (fig. 3). At the same time, the thousand kernel weight of mature kernels was significantly reduced by about 36.3% compared to the wild type (FIG. 4). At the same time, the starch content was significantly reduced compared to the wild type (fig. 5).

2. Map cloning of mutant Gene loci

1. Localization of mutant genes

The orth2 mutant and indica rice variety R498 are mixed and combined, and the mutant genes are positioned by selecting the extreme individuals which have the same powdery endosperm phenotype as the orth2 mutant from F2 seeds harvested on F1 plants. First, the mutant gene was initially linked in the short arm proximal segment of the 5 th chromosome of rice by 10 extreme individuals.

Using the common primers of the laboratory with the primers designed by themselves, the population of the mapping was then continued to be expanded, and finally the mutant gene was mapped to an interval of about 510kb from the marker R5-36 to the end of the chromosome using a total of 137 extreme individuals (FIG. 6).

Sampling seedlings of wild Ningjing No.2 and orth2 mutant, sending the samples to a sequencing company (Nostoc source organism limited company) for whole genome sequencing, comparing the mutant with the wild sequence in a fine positioning interval after the sequencing result is obtained, screening out homozygous sites with mutation in the interval, taking genes with the mutation sites as candidate genes, and sequencing and verifying the mutation sites.

The method for SSR marker analysis is as follows:

(1) The method for extracting the total DNA of the selected single plant as a template comprises the following steps:

(1) about 0.2g of young rice leaves are taken, placed in a 2.0mL Eppendorf tube, a steel ball is placed in the tube, the Eppendorf tube filled with the sample is frozen in liquid nitrogen for 5min, and the sample is crushed for 1min on a 2000 type GENO/GRINDER instrument.

(2) Add 660. Mu.L of extract (100 mM Tris-HCl (pH 8.0), 20mM EDTA (pH 8.0), 1.4M NaCl,0.2g/mL CTAB solution) and vortex vigorously on a vortexing device for 30min on ice.

(3) Add 40. Mu.L 20% SDS, incubate at 65℃for 10min, gently mix upside down every two minutes.

(4) 100. Mu.L of 5M NaCl was added and gently mixed.

(5) 100. Mu.L of 10 XCTAB was added, the mixture was incubated at 65℃for 10 minutes, and the mixture was gently mixed upside down intermittently.

(6) 900. Mu.L of chloroform was added thereto, and the mixture was thoroughly mixed and centrifuged at 12000rpm for 3 minutes.

(7) The supernatant was transferred to a 1.5mL Eppendorf tube, 600. Mu.L of isopropanol was added, mixed well, and centrifuged at 12000rpm for 5min.

(8) The supernatant was discarded, and the pellet was rinsed once with 70% (volume percent) ethanol and dried at room temperature.

(9) 100. Mu.L of 1 XDE (121 g of Tris in 1 liter of water, pH 8.0 adjusted with hydrochloric acid) was added to dissolve the DNA.

To detect DNA quality by electrophoresis in an amount of 2. Mu.L, and the concentration was measured by a DU800 spectrophotometer (Beckman Instrument Inc. U.S.A.).

(2) Diluting the extracted DNA to about 20 ng/. Mu.L, and performing PCR amplification by using the diluted DNA as a template;

PCR reaction System (10. Mu.L): 1. Mu.L of DNA (20 ng/. Mu.L), 1. Mu.L of upstream primer (2 pmol/. Mu.L), 1. Mu.L of downstream primer (2 pmol/. Mu.L), 10XBuffer (MgCl) ₂ free)1μL，dNTP(10mM)0.2μL，MgCl ₂ (25mM)0.6μL，rTaq(5U/μL)0.1μL，ddH ₂ O5.1. Mu.L, 10. Mu.L total.

PCR reaction procedure: denaturation at 94.0℃for 3min; denaturation at 94.0 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 1min, and total circulation for 35 times; extending at 72 ℃ for 10min; preserving at 10 ℃. The PCR reaction was performed in an MJ Research PTC-225 thermal cycler.

(3) PCR product detection of SSR markers

The amplified products were analyzed by 8% non-denaturing polyacrylamide gel electrophoresis. The molecular weight of the amplified product was compared with that of a 50bp DNA Ladder as a control, and silver staining was performed.

The primer development process is as follows:

(1) SSR marker development

Continuing to develop and design new marks on the chromosome section where the marker is positioned, and further reducing the positioning interval; new markers were developed using NCBI (http:// www.ncbi.nlm.nih.gpv /), riceVarMap (http:// Ricevarmap. Ncpgr. Cn /) and the like websites and synthesized by Nanjing Jinsrui Biotechnology Co. The SSR paired primers which are designed by self are mixed in equal proportion, the polymorphism between Ningjing No.2 and R498 is detected, and the polymorphism is used as a molecular marker for fine localization. The molecular markers used for fine localization are shown in Table 1.

TABLE 1 molecular markers for Fine localization

2. Acquisition of the Pink endosperm regulatory Gene

Wild Ningjing No.2 and orth2 mutant seeds were sampled and sent to sequencing company for whole genome sequencing, base sequences in the fine localization interval were aligned, and a homozygous C to T mutation site was identified at 1508709bp position on chromosome five (FIG. 6). Site query was performed in the rice database (http:// rice. Plant biology. Msu. Edu /), and the mutation site was found to be located on the seventh exon of gene OsORTH2, resulting in tryptophan to proline substitution (FIG. 6).

Primers were designed based on the sequences published on the network as follows:

Primer1：5'ATGCCTGATCTCCCCTGCGA 3'；

Primer2：5'CAGGCTTCAGCGCGGGTAG 3'。

PCR amplification is carried out by taking Primer1 and Primer2 as primers and taking development endosperm DNA of Ningjing No.2 as a template to obtain a target gene. The amplification reaction was performed on a PTC-200 (MJ Research inc.) PCR instrument: 94 ℃ for 3min;94 ℃ for 30sec,55 ℃ for 30sec,72 ℃ for 4min,35 cycles; and at 72℃for 10min. The PCR product was recovered and purified, then ligated to pMD18-T (Japanese Takara Co., ltd.), E.coli DH 5. Alpha. Competent cells (Beijing Tiangen Co., CB 101) were transformed, and positive clones were selected and sequenced.

The sequence determination result shows that the gene sequence of the endosperm flour gene OsORTH2 is shown as SEQ ID NO. 1; the fragment obtained by PCR reaction, namely the CDS sequence of the gene OsORTH2 has a nucleotide sequence shown as SEQ ID NO.2, and codes a protein consisting of 789 amino acid residues (see SEQ ID NO.3 of a sequence table). The protein shown in SEQ ID NO.3 is named OsORTH2, and the encoding gene of the protein shown in SEQ ID NO.3 is named OsORTH2.

Example 2 acquisition and identification of transgenic plants

1. Knock-out vector construction

1. Knockout primer design

(1) Selecting Oryza sativa (RAP-DB) from the target genome options of the CRISPR-P website (http:// cbi. Hzau. Edu. Cn/cgi-bin/CRISPR);

(2) Inputting a gene login number into the Locus Tag;

(3) Clicking a subset, running a program, and waiting for a result to appear;

(4) Selecting a primer which is positioned on the CDS, is close to the ATG initial site and has higher score, and is 20bp before replication; performing blast analysis, and selecting a primer with high specificity;

(5) Primer synthesis: the rear primer needs to add AAAC at the 5 'end after reverse complementation of 20bp, and the front primer directly adds GGCA at the 5' end of the 20bp sequence;

after the primer design and synthesis are completed, a knockout vector is constructed.

The sequence of the knockout primer is as follows:

Primer3：

5'GGCAAATGACCCCAAGAGAAGCAT 3'；

Primer4：

5'AAACATGCTTCTCTTGGGGTCATT 3'；

the knockout site detection primers are as follows:

Primer5：

5'TGATCCATGCATTGTAGGTAGGT 3'；

Primer6：

5'ACTGAATGATGGCAAATGGTCA3'；

2. knock-out vector construction

(1) 1. Mu.L each of left and right primer mother solutions (100. Mu.M) was added to a 200. Mu.L PCR tube, and 8. Mu.L ddH was added thereto ₂ O; naturally cooling to room temperature at 95 ℃ for 5min;

(2) Preparing a reaction system: ATP 1. Mu.L, vector 1. Mu.L, buffer 1. Mu.L, oligo 0.2. Mu.L, aar I0.2. Mu.L, T4ase 0.2. Mu.L, ddH ₂ O5.5. Mu.L, 1. Mu.L of the mixture of (1);

(3) The reaction procedure: 5min at 37 ℃;20 ℃ for 5min; 30min at 4℃for 1X 10 cycles.

3. Complementary vector construction

Amplifying the full-length sequence of the OsORTH2 gene coding region, and recovering and purifying the PCR product. The OsORTH2 coding region sequence was cloned into the binary vector pCAMBIA1305-GFP using INFUSION recombination kit (TaKaRa, japan). The INFUSION recombination reaction system was (10. Mu.L): PCR product 2.0. Mu.L, pCAMBIA1305-GFP 2.0. Mu.L, 5X fusion buffer 2.0. Mu.L, ddH ₂ O4. Mu.L, after brief centrifugation, was subjected to a water bath at 50℃for 15 minutes.

The complementary vector detection primers were as follows:

Primer7：

5'ATGGCAAAGTGGTCAAGGCT 3'；

Primer8：

5'CGTAGGTGAAGGTGGTCACG 3'；

competent transformation of E.coli: adding 10 mu L of connecting carrier, lightly blowing and mixing, and ice-bathing for 30min; water bath at 42 ℃ for 45s, and ice bath for 2min immediately; adding 700 μl of LB liquid medium (without antibiotics), placing at 37deg.C, shaking at 220rpm for 45min; uniformly coating the bacterial liquid on an LB culture medium (containing corresponding antibiotics), placing the LB culture medium on an ultra-clean bench for about 30min, drying the bacterial liquid in the culture medium thoroughly, and then inverting the culture medium in a 37 ℃ incubator for overnight culture; after colonies were obtained, colony PCR was detected. 1-2 positive colonies were selected for sequencing. And after successful sequencing and comparison, plasmid extraction is performed.

2. Acquisition of recombinant Agrobacterium

The agrobacteria EHA105 strain is transformed by freeze thawing transformation method with CRISPR-OsORTH2 and 35S: osORTH2-GFP recombinant vector. Commercial agro-bacterial sensations (EHA 105) were removed and thawed on ice; adding 2-3 mu L of transformation plasmid, blowing and mixing uniformly by using a pipetting gun, and quick-freezing in liquid nitrogen for 5min; immediately placing in a water bath kettle at 37 ℃ for heat shock for 5min; taking out and inserting on ice, adding 1mL antibiotic-free LB culture solution, and placing on a shaking table at 28 ℃ for 3-4h; the bacterial liquid is evenly coated on LB culture medium (containing corresponding resistance), naturally dried in an ultra clean bench, and then is inversely cultured in a 28 ℃ incubator for 2-3 days.

3. Acquisition of transgenic plants

CRISPR-OsORTH2 and 35S: osORTH2-GFP strains are transformed into wild Ningjing No.2 and orth2 mutants, and the specific method is as follows:

(1) Culturing CRISPR-OsORTH2 and 35S: osORTH2-GFP strain (or trans-empty vector control strain) at 28deg.C for 16 hr, collecting thallus, and diluting into N6 liquid culture medium (Sigma Co., C1416) until the concentration is OD600 ≡0.5 to obtain bacterial liquid;

(2) Mixing and infecting rice Ning japonica No.2 and orth2 mutant mature embryogenic callus cultured for one month with the bacterial liquid in the step (1) for 30min, drying the bacterial liquid by filter paper, transferring into a co-culture medium (N6 solid co-culture medium, sigma company) and co-culturing for 3 days at 24 ℃;

(3) Inoculating the callus of the step (2) on N6 solid screening medium containing 100mg/L hygromycin for the first time (16 days);

(4) Selecting healthy calli, transferring the healthy calli into an N6 solid screening culture medium containing 100mg/L hygromycin for second screening, and carrying out secondary transfer every 15 days;

(5) Selecting healthy calli, transferring the healthy calli into an N6 solid screening culture medium containing 50mg/L hygromycin for third screening, and carrying out secondary once every 15 days;

(6) Selecting the resistant callus, transferring the resistant callus into a differentiation medium for differentiation; t of differentiated seedlings ₀ And (5) replacing positive plants.

4. Identification of transgenic plants

1. PCR molecular characterization

T obtained in the step three ₀ Extracting genome DNA from the generation plant, using the genome DNA as a template, and using a Primer5 and a Primer6 as primers for amplification, and identifying the CRISPR-OsORTH2 knockout plant; amplification was performed using Primer7 and Primer8 as primers, and 35S:OsORTH2-GFP complementary plants were identified.

PCR reaction system: DNA (20 ng/. Mu.L) 2. Mu.L, primer5 (10 pmoL/. Mu.L) 2. Mu.L, primer6 (10 pmoL/. Mu.L) 2. Mu.L, 10xBuffer (MgCl) ₂ free)2μL，dNTP(10mM)0.4μL，MgCl ₂ (25mM)1.2μL，rTaq(5U/μL)0.4μL，ddH ₂ O10. Mu.L, total volume 20. Mu.L.

The amplification reaction was performed on a PTC-200 (MJ Research inc.) PCR instrument: 94 ℃ for 3min;94℃30sec,55℃30sec,72℃2min,35 cycles; and at 72℃for 10min.

The PCR products were separated by 8% native PAGE gel and stained with silver. And determining transgenic positive plants.

2. Phenotypic identification

Ningjing No.2, orth2 mutant and T respectively ₀ The generation CRISPR-OsORTH2 knockout and 35S: osORTH2-GFP complementary transgenic positive plants are planted in the transgenic field of the soil bridge rice breeding base of Nanjing university of agriculture. After seed maturation, various material seeds were harvested and seeds with a floury endosperm similar to the orth2 mutant were observed in CRISPR-OsORTH2 knockout plants (fig. 7). In addition, 35S OsORTH2-GFP complementation plants (COM-1/2/3) matured kernels restored the wild type clear kernel phenotype (FIG. 8). Thus, it was demonstrated that the mutant phenotype in orth2 was caused by the mutation in OsORTH2, and that the transgene was able to restore it to normal.

Claims

1. A gene, characterized in that: the gene is a DNA molecule shown in the following 1), 2) or 3):

1) A DNA molecule shown in SEQ ID No. 1;

2) A DNA molecule shown in SEQ ID No. 2;

3) A DNA molecule which hybridizes under stringent conditions to the DNA sequence defined in 1) or 2) and which codes for a protein according to SEQ ID NO. 3.

2. The protein encoded by the gene of claim 1.

3. A protein selected from any one of the proteins shown in (a) or (b):

(a) A protein consisting of the amino acid sequence shown in SEQ ID NO. 3;

4. A recombinant expression vector, expression cassette or recombinant bacterium comprising the gene of claim 1.

5. A primer pair for amplifying the full length of the gene of claim 1 or any fragment thereof or a targeting primer involved in fine targeting the gene of claim 1.

6. A primer pair for knocking out the gene of claim 1; preferably, the primer pair is:

Primer3：

5'GGCAAATGACCCCAAGAGAAGCAT 3'；

Primer4：

5'AAACATGCTTCTCTTGGGGTCATT 3'；

Primer5：

5'TGATCCATGCATTGTAGGTAGGT 3'；

Primer6：

5'ACTGAATGATGGCAAATGGTCA 3'。

the application of the gene shown in SEQ ID NO.1 or SEQ ID NO.2, the protein shown in SEQ ID NO.3, the recombinant expression vector containing the gene shown in SEQ ID NO.1 or SEQ ID NO.2, the expression cassette or the recombinant bacteria in cultivating rice with normal endosperm development; preferably, the application is that the gene shown in SEQ ID NO.1 or SEQ ID NO.2 is transferred into rice with the gene defect shown in SEQ ID NO.1 or SEQ ID NO.2 to obtain rice with normal endosperm development.

8. A method for culturing transgenic plant with normal endosperm development comprises introducing gene shown in SEQ ID NO.1 or SEQ ID NO.2 into endosperm dysplasia plant with SEQ ID NO.1 or SEQ ID NO.2 gene defect to obtain transgenic plant with normal endosperm development; preferably, the method is that the gene shown in SEQ ID NO.1 or SEQ ID NO.2 is introduced into a plant with endosperm dysplasia, preferably the plant is rice, by the recombinant expression vector of claim 4.

A method for cultivating endosperm dysplasia rice varieties by using a gene shown in SEQ ID NO.1 or SEQ ID NO.2, wherein the method is to knock out or silence the gene shown in SEQ ID NO.1 or SEQ ID NO.2 to obtain endosperm dysplasia rice; preferably, the CRISPR-Cas9 technology is utilized to carry out site-directed mutagenesis on the gene shown in SEQ ID NO.1 or SEQ ID NO.2 in wild normal plants to obtain the transgenic rice with abnormal endosperm development.

10. Use of the method of claim 9 for improvement or research of rice heritage.