CN116536285A - Radix stephaniae tetrandrae linderae basic nitrogen methyltransferase CNMT and application thereof - Google Patents

Radix stephaniae tetrandrae linderae basic nitrogen methyltransferase CNMT and application thereof Download PDF

Info

Publication number
CN116536285A
CN116536285A CN202310605993.4A CN202310605993A CN116536285A CN 116536285 A CN116536285 A CN 116536285A CN 202310605993 A CN202310605993 A CN 202310605993A CN 116536285 A CN116536285 A CN 116536285A
Authority
CN
China
Prior art keywords
methyltransferase
nitrogen
tetrandrine
stephania
linderane
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310605993.4A
Other languages
Chinese (zh)
Inventor
杨博涵
开国银
李坤伦
冯岳
张剑波
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhejiang Chinese Medicine University ZCMU
Original Assignee
Zhejiang Chinese Medicine University ZCMU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang Chinese Medicine University ZCMU filed Critical Zhejiang Chinese Medicine University ZCMU
Priority to CN202310605993.4A priority Critical patent/CN116536285A/en
Publication of CN116536285A publication Critical patent/CN116536285A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1003—Transferases (2.) transferring one-carbon groups (2.1)
    • C12N9/1007—Methyltransferases (general) (2.1.1.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/10—Nitrogen as only ring hetero atom
    • C12P17/12—Nitrogen as only ring hetero atom containing a six-membered hetero ring
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y201/00—Transferases transferring one-carbon groups (2.1)
    • C12Y201/01—Methyltransferases (2.1.1)
    • C12Y201/01115—(RS)-1-Benzyl-1,2,3,4-tetrahydroisoquinoline N-methyltransferase (2.1.1.115)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/101—Plasmid DNA for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/185—Escherichia
    • C12R2001/19—Escherichia coli

Abstract

The invention discloses a stephania tetrandrine nitrogen methyltransferase CNMT and application thereof, which separates and identifies a new stephania tetrandrine nitrogen methyltransferase from medicinal plant stephania tetrandrine, and uses escherichia coli to carry out heterologous recombinant expression protein on the gene, wherein key enzyme genes in the medicinal plant participate in regulating and controlling synthesis of benzyl isoquinoline alkaloid, thereby laying a certain research foundation. Compared with the lindera root alkaline nitrogen methyltransferase from other plant sources, the lindera root alkaline nitrogen methyltransferase StCNMT has higher substrate specificity and higher catalytic efficiency, and therefore has certain application value.

Description

Radix stephaniae tetrandrae linderae basic nitrogen methyltransferase CNMT and application thereof
Technical Field
The invention relates to clone expression and application of stephania tetrandrine nitrogen methyltransferase CNMT, and discloses a nucleotide sequence, an amino acid sequence and enzymatic properties thereof, belonging to the technical field of bioengineering.
Background
The benzylisoquinoline alkaloid has structural and activity diversity and is one of hot spots for research in the field of natural products. Pharmacological studies have shown that benzylisoquinoline is mostly excellent in activity, such as papaverine obtained from poppy has spasmolytic effect; tetrandrine in radix Stephaniae Tetrandrae has effects in preventing and treating liver fibrosis and resisting ebola virus; the plumula Nelumbinis alkali has broad-spectrum antiarrhythmic effect. In addition, morphine and codeine, small base with antibacterial activity, sanguinarine, noscapine, etc. as analgesic drugs have become the first-line clinical drugs. At present, the acquisition mode of the medicinal benzylisoquinoline alkaloid mainly comprises plant extraction, but the problems of low benzylisoquinoline alkaloid content, environmental pollution caused by extracted waste, high cost and the like exist.
Although the structure is complex and various, the initial steps of the benzylisoquinoline alkaloid biosynthesis pathway are quite similar. The metabolite dopamine of tyrosine and 4-hydroxy-phenylacetaldehyde are used as substrates, and the common intermediate of benzyl isoquinoline alkaloid, namely the azomethine, is catalyzed and synthesized by a plurality of enzymes such as norlindrine synthase, norlindrine 6-oxymethyl transferase, lindrine azomethine transferase and the like. And then through reactions such as isomerism, coupling, rearrangement, methylation, demethylation and the like, benzyl isoquinoline alkaloids with different skeleton types, such as tetrandrine, morphine, codeine, liensinine, berberine, sanguinarine, papaverine and the like are formed.
Linderane nitrogen methyltransferase (EC 2.1.1.115, CNMT) can catalyze linderane to form N-methyl linderane, and is a key rate-limiting enzyme in the synthesis process of benzyl isoquinoline alkaloid. Therefore, the linderane nitrogen methyltransferase with high catalytic activity and high substrate specificity is an urgent real need for improving the content of benzyl isoquinoline alkaloid.
Disclosure of Invention
The invention aims to separate and identify a new lindera root alkali nitrogen methyltransferase gene from medicinal plant stephania tetrandra, and name the gene as StCNMT, and uses escherichia coli to carry out heterologous recombinant expression protein on the gene, and discloses the enzymatic property and application thereof.
The technical scheme adopted by the invention is as follows:
a radix Stephaniae Japonicae alkaline nitrogen methyltransferase CNMT has an amino acid sequence shown in SEQ ID NO. 2.
The coding gene of the stephania tetrandrine nitrogen methyltransferase CNMT has a nucleotide sequence shown as SEQ ID NO. 1.
A recombinant plasmid of radix stephaniae tetrandrae alkaline nitrogen methyltransferase, wherein the recombinant plasmid comprises a coding gene of the radix stephaniae tetrandrae alkaline nitrogen methyltransferase.
Further, the prokaryotic expression vector in the recombinant plasmid is pET28a. The sequence of the recombinant plasmid pET28a-StCNMT is shown as SEQ ID NO.4, and the sequence of the prokaryotic expression vector pET28a is shown as SEQ ID NO. 3. Wherein, when constructing recombinant plasmid pET28a-StCNMT, the tetrandra RNA is firstly extracted and reversely transcribed to obtain the whole genome cDNA. Designing a specific primer of the lindera root basic nitrogen methyl transferase gene StCNMT, amplifying to obtain a full-length coding frame sequence of the lindera root basic nitrogen methyl transferase gene StCNMT, and carrying out homologous recombination connection on the amplified full-length coding frame sequence of the lindera root basic nitrogen methyl transferase gene StCNMT and a double-digested pET28a plasmid fragment to construct a recombinant expression plasmid pET28a-StCNMT.
Further, the specific primers of the linderane nitrogen methyl transferase gene StCNMT are shown as SEQ ID NO.5 and SEQ ID NO. 6.
A recombinant strain of stephania tetrandrine nitrogen methyltransferase, said recombinant strain comprising said recombinant plasmid.
Further, the method is constructed by the following steps:
the recombinant plasmid pET28a-StCNMT is obtained by constructing the lindera root basic nitrogen methyl transferase gene StCNMT into a prokaryotic expression vector pET28a, and the positive recombinant plasmid pET28a-StCNMT is transferred into BL21 (DE 3) competent cells to form a recombinant strain. The recombinant strain expresses soluble protein-linderane nitrogen methyltransferase StCNMT under the induction of an inducer IPTG.
The application of the stephania tetrandrine nitrogen methyltransferase or the stephania tetrandrine nitrogen methyltransferase recombinant strain in benzyl isoquinoline alkaloid catalytic reaction.
The application is specifically as follows: catalyzing the reaction of the linderane to synthesize the nitrogen methyl linderane.
Further, the reaction system also contains a cofactor S-adenosylmethionine, the concentration is preferably 0.1 mmol.L -1 。
Further, the temperature of the catalytic reaction is 16-45 ℃, and the pH is 4.0-10.0.
Further, the optimum temperature of the catalytic reaction is 30 ℃, and the optimum pH is 8.0.
Furthermore, the recombinant strain of the tetrandrine nitrogen methyltransferase carries out induction expression under the condition of IPTG solution before catalyzing the reaction of the linderane to synthesize the nitrogen methyl linderane. The concentration of IPTG solution is preferably 0.4 mmol.L -1 。
The beneficial effects of the invention are as follows: a new lindera root alkali nitrogen methyltransferase StCNMT is identified from the stephania tetrandra, which lays a certain research foundation for further analyzing and controlling the synthesis of benzyl isoquinoline alkaloid by the participation of key enzyme genes in the medicinal plant. Compared with the lindera root alkaline nitrogen methyltransferase from other plant sources, the lindera root alkaline nitrogen methyltransferase StCNMT has higher substrate specificity and higher catalytic efficiency, and therefore has certain application value.
Drawings
Fig. 1: recombinant vector profile of pET28 a-StCNMT;
fig. 2: SDS-PAGE analysis recombinant engineering bacteria E.coil BL21 IPTG induction expression condition result diagram: m is Marker;1, intracellular soluble expression of a strain containing pET28 a; 2: intracellular soluble expression of pET28a-StCNMT strain; 3: precipitating and expressing the strain containing pET28 a-StCNMT;
fig. 3: SDS-PAGE analysis recombinant engineering bacterium E.coil BL21 intracellular soluble protein purification condition result diagram: m: a Marker;1, intracellular soluble expression of a strain containing pET28 a; 2. 3: intracellular soluble expression of pET28a-StCNMT strain; 4, flowing through liquid; 5: the first Elution of the solution buffer; 6: the second Elution of the solution buffer; 7: eluting for the third time by using an absorption buffer; 8: and the fourth Elution by the solution buffer.
Fig. 4: HPLC analysis chart of standard nitrogen methyl linderane; HPLC analysis chart of purified pET28a-StCNMT protein (inactivated) catalytic reaction product; c: HPLC analysis of the purified pET28a-StCNMT protein (not inactivated) catalytic reaction product (peak 1: azomethine; peak 2: linderane);
fig. 5: results of the effect of different temperatures on the activity of linderane nitrogen methyltransferase are shown;
fig. 6: the influence of different pH values on the activity of the linderane nitrogen methyltransferase is shown in the figure, wherein solid square squares correspond to pH 4-6, solid diamond squares correspond to pH 6-8, and solid triangles correspond to pH 8-10;
fig. 7: taking linderane as a substrate to study a catalytic kinetic parameter fitting result graph of the linderane nitrogen methyltransferase;
fig. 8: and (3) researching a substrate specificity comparison chart of the linderane nitrogen methyltransferase by taking different isoquinoline alkaloids as substrates.
Detailed Description
Example 1
This example shows the cloning of the linderane nitrogen methyltransferase gene and the construction of engineering bacteria of E.coli
Total RNA extraction and reverse transcription of tetrandra root whole plant
1. Cleaning radix Stephaniae Tetrandrae whole plant, quick freezing in liquid nitrogen, grinding with the processed mortar, and extracting RNA with 50-100mg powder. And obtaining full-plant cDNA for standby by using an RNA extraction kit and a reverse transcription kit.
2. Preparation of E.coli competence
E.coli JM109 and BL21 (DE 3) single colonies were picked from LB plates, respectively, inoculated into 20mL of LB medium, and shake-cultured overnight at 37℃until the middle and late logarithmic growth phases. Then inoculating the bacterial liquid into 50mL LB culture medium according to the proportion of 1:50 (v/v), shake culturing at 37 ℃ for about 3h to OD 600 ＝0And 5, obtaining a culture bacterial liquid. Centrifugation is carried out for 5min at 5000r/min at 4 ℃, the thalli is collected and added into 5mL of Solution A (competent kit) precooled on ice, and the centrifuge tube is gently rocked to enable the thalli to be fully suspended. Centrifuging at 4deg.C at 5000r/min for 5min, collecting thallus, adding 5mL of pre-cooled solutionB on ice, gently shaking the centrifuge tube to make thallus fully suspended, and sub-packaging according to 100 μL per tube. JM109 and BL21 competent cells were obtained after completion of the production. Competent cells can be stored in-80℃refrigerator for subsequent DNA transformation experiments.
PCR amplification of lindera root alkaline nitrogen methyltransferase Gene
1) Primer design
The primer is designed according to the sequence of the lindera root basic nitrogen methyl transferase gene StCNMT, the primer directly has a homology arm (underlined mark), and the specific primer is designed as follows:
F：GCAAATGGGTCGCGGATCCATGGCGGTCGGAGCGGGAGA(SEQ ID NO.5)
R：CGAGTGCGGCCGCAAGCTTTCACTGCTTCTTGAAGAGAACATGA (SEQ ID NO.6)
2) PCR amplification
The amplification reaction system is as follows: 1. Mu.L of template, 1. Mu.L of upstream and downstream primers, 4. Mu.L of dNTP Mix, 10. Mu.L of 5 XprimeSTAR Buffer, 32.5. Mu.L of sterilized double distilled water, and 0.5. Mu.L of primeSTAR DNA polymerase.
Conditions of PCR reaction: 98℃30s,56℃30s,72℃2min,35 cycles, the PCR product was finally stored at 4 ℃.
The PCR product is recovered by a gel recovery kit and sent to Zhejiang Shang Ya biological limited company for sequencing, and the sequence of the lindera root basic nitrogen methyl transferase gene StCNMT gene obtained by sequencing is shown as SEQ ID NO. 1.
3) Double cleavage and ligation
The pET28a plasmid (sequence shown in SEQ ID NO. 3) was digested simultaneously with restriction enzymes BamH I and HindIII in a 10X Fast Digest Buffer. Mu.L system, 30. Mu.L of pET28a plasmid, 2.5. Mu.L of restriction enzymes BamH I and HindIII each, and 10. Mu.L of sterile distilled water. The reaction is carried out for 1h at 37 ℃ and then is carried out with a gel recovery kit for gel recovery, and then is connected with a PCR recovery product.
The connection system is as follows:MultiS 1. Mu.L, 5 XCE MultiS Buffer 2. Mu.L, pET28a gel recovery product 1. Mu.L, PCR recovery product 1. Mu.L, sterile distilled water 5. Mu.L.
The above reaction was carried out at 37℃for 30min and then ice-bath for 5min, and transformation was prepared.
4) Transformation
1.1 tube of JM109 prepared previously was placed in ice for thawing.
2. All ligation reactions were transferred to JM109 competence and blown down uniformly.
3. After 30min of ice bath, heat was applied for 90s in a water bath at 42℃and then 2min of ice bath.
4. 600. Mu.L of LB medium was added thereto and the mixture was cultured at 37℃for 45 minutes.
5.5000 r/min for 2min, 500. Mu.L of supernatant was discarded, and the remaining cells and culture medium were blown down evenly and plated with kanamycin resistance.
Inverted culture was performed at 6.37℃overnight.
7. 5 monoclonal recombinant plasmids were selected for colony PCR positive identification and the positive clones were sent to the Zhejiang Shang Ya organism for sequencing. The positive recombinant plasmid with correct sequencing was named pET28a-StCNMT (shown as SEQ ID NO. 4). The map is shown in figure 1.
8. And (3) transferring the positive recombinant plasmid into BL21 (DE 3) competence to obtain a recombinant strain for later use.
Example 2
This example is the inducible expression of the recombinant strain according to the invention
1. 100. Mu.L of the recombinant strain obtained in example 1 was added to 20mL of LB medium, 20. Mu.L of kanamycin solution (final concentration: 100. Mu.g/mL) was added, and the mixture was cultured overnight at 37℃and 220rpm with the empty strain (pET 28a plasmid was transferred to BL21 (DE 3)) as a control.
2. 200 mu L of the seed bacterial liquid in the previous step is transferred into a triangular flask containing 20mL of LB culture medium, 20 mu L of kanamycin solution (the final concentration is 100 mu g/mL) is added, and the culture is carried out until the OD 600 ＝0.5。
3. In each triangular flaskmu.L of IPTG solution (final concentration: 0.4 mmol.L) was added -1 ) The culture was induced overnight at 25℃and 220 rpm.
4. Taking 1mL of the empty plasmid bacterial liquid induced in the step 3 and 1mL of the recombinant plasmid bacterial liquid with the target gene, centrifuging at 8000rpm for 5min, discarding the supernatant, adding 1mL of phosphate buffer (pH=8.0) to resuspend the bacterial body, and carrying out ultrasonic crushing for 5min.
Centrifuging at 8000rpm for 5min at 5.4deg.C, collecting supernatant, and verifying with pepsin, as shown in figure 2, to obtain recombinant protein soluble expression.
6. Protein purification and enzyme Activity characterization
Through the method, the residual pET28a-StCNMT fermentation liquor is subjected to thallus enrichment and crushing to obtain crude enzyme liquor. Ni-column purification is carried out by an AKTA pure protein purification system, the target protein is eluted by an Elutation buffer solution, as shown in figure 3, and the protein adsorbed on the column is eluted to obtain the linderane nitrogen methyltransferase for standby.
Example 3
Taking 20 mmol.L -1 88. Mu.L of potassium dihydrogen phosphate and dipotassium hydrogen phosphate buffer (pH=8.0) was added with 10. Mu.L of pure enzyme (final concentration 5. Mu.g.ml) -1 ) Preheating at 30deg.C for 5min, adding 1 μL of linderamine (final concentration of 2 mM), adding 1 μ L S-adenosylmethionine (final concentration of 0.1 mmol.L) -1 ) The reaction was terminated by adding 50. Mu.L of methanol for 15min, and the characteristic peak at a wavelength of 280nm was detected by HPLC. HPLC results are shown in FIG. 4, and the pure enzyme StCNMT obtained by the invention can catalyze the methylation reaction of linderane when the pure enzyme StCNMT is active.
Examples 4-7 are enzymatic property studies of purified proteins. The reaction system is 100 mu L, wherein the concentration of the substrate mother solution is 10 mmol.L -1 The cofactor is S-adenosylmethionine, and the concentration of the linderane nitrogen methyltransferase is 0.58 mg.ml -1 After 15min of reaction, 50. Mu.L of methanol was added to terminate the reaction, and quantitative HPLC analysis was performed.
Example 4
This example is the optimum temperature value for the study of the enzymatic reaction of lindera root base nitrogen methyltransferase according to the present invention. Linderane is used as substrate, and the concentration of cofactor is 0.1mmol at pH=8.0·L -1 The yields of azomethine at different temperature values (4, 16, 20, 25, 30, 40, 45, 50 ℃) were determined separately. As shown in FIG. 5, the optimal temperature value for the enzymatic reaction of linderane nitrogen methyltransferase was 30 ℃.
Example 5
This example is the optimum pH for the study of the enzymatic reaction of lindera root base nitrogen methyltransferase according to the present invention. Linderane is used as substrate, and the concentration of cofactor is 0.1 mmol.L at 30deg.C -1 Under the conditions of (1) respectively measuring different pH (20 mmol.L) - 1 Acetic acid-Sodium acetate，pH 4.0-6.0；20mmol·L -1 KH 2 PO 4 -K 2 HPO 4 ，pH 6.0-8.0；20mmol·L -1 Yield of azomethine under Tris-HCl, pH 8.0-10.0). As shown in FIG. 6, the optimal pH for the enzymatic reaction of linderane nitrogen methyltransferase was found to be 6.0.
Example 6
The example is to study the catalytic kinetic parameters of the linderane nitrogen methyltransferase by using the linderane as a substrate.
The reaction rate of the linderane nitrogen methyltransferase for catalyzing the linderane with different concentrations is measured under the optimal reaction pH and the reaction temperature, and the reaction system contains 0.1 mmol.L -1 Cofactor S-adenosylmethionine, by reference to the Linewear-Burk double reciprocal mapping method, the values of Vmax and Km were calculated, and k was calculated cat /K m The value of K is shown in FIG. 7 m ＝53.90μM，Vmax＝3.66μM·min -1 ·mg -1 ，k cat ＝0.008S -1 ，k cat /K m ＝0.00016μM -1 ·S -1 。
Example 7
In the embodiment, 3' hydroxyl N-methyl linderane, norlinderane, linderane, N-methyl linderane and tetrandrine with the final concentration of 2mM are taken as substrates, and the catalytic reaction of the linderane nitrogen methyltransferase is studied under the optimal reaction pH and reaction temperature. As shown in figure 8, the results show that the linderane nitrogen methyltransferase only catalyzes linderane and has excellent substrate specificity.
The foregoing is merely a preferred embodiment of the present invention, and it should be noted that it will be apparent to those skilled in the art that several optimization modifications and additions can be made without departing from the method of the present invention, and these modifications and additions should also be considered as being within the scope of the present invention.

Claims (8)

1. The radix stephaniae tetrandrae alkaline nitrogen methyltransferase CNMT is characterized by having an amino acid sequence shown as SEQ ID NO. 2.
2. The coding gene of the stephania tetrandrine nitrogen methyltransferase CNMT according to claim 1, wherein the coding gene has a nucleotide sequence shown as SEQ ID No. 1.
3. A recombinant plasmid of stephania tetrandrine nitrogen methyltransferase, which is characterized in that the recombinant plasmid comprises the coding gene of stephania tetrandrine nitrogen methyltransferase according to claim 2.
4. A recombinant strain of stephania tetrandrine nitrogen methyltransferase, wherein the recombinant strain comprises the recombinant plasmid of claim 3.
5. Use of the stephania tetrandrine nitrogen methyltransferase of claim 1 or the stephania tetrandrine nitrogen methyltransferase recombinant strain of claim 4 in benzyl isoquinoline alkaloid catalytic reaction.
6. The use according to claim 5, characterized in that it is in particular: catalyzing the reaction of the linderane to synthesize the nitrogen methyl linderane.
7. The method according to claim 6, wherein the catalytic reaction is carried out at a temperature of 16 to 45℃and a pH of 4.0 to 10.0.
8. The use according to claim 6, wherein the recombinant strain of stephanine nitrogen methyltransferase is induced under IPTG solution conditions before catalyzing the reaction of linderane to synthesize azamethine.
CN202310605993.4A 2023-05-26 2023-05-26 Radix stephaniae tetrandrae linderae basic nitrogen methyltransferase CNMT and application thereof Pending CN116536285A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310605993.4A CN116536285A (en) 2023-05-26 2023-05-26 Radix stephaniae tetrandrae linderae basic nitrogen methyltransferase CNMT and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310605993.4A CN116536285A (en) 2023-05-26 2023-05-26 Radix stephaniae tetrandrae linderae basic nitrogen methyltransferase CNMT and application thereof

Publications (1)

Publication Number Publication Date
CN116536285A true CN116536285A (en) 2023-08-04

Family

ID=87446948

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310605993.4A Pending CN116536285A (en) 2023-05-26 2023-05-26 Radix stephaniae tetrandrae linderae basic nitrogen methyltransferase CNMT and application thereof

Country Status (1)

Country Link
CN (1) CN116536285A (en)

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015164960A1 (en) * 2014-04-29 2015-11-05 Epimeron Inc. Improved methods for making and using polynucleotide sequences in the synthesis of alkaloid compounds
CN106085981A (en) * 2016-06-30 2016-11-09 湖南美可达生物资源有限公司 Herba Macleayae Cordatae participates in methyl transferase gene and application thereof that Sanguinarine synthesizes with chelerythrine
US20160340704A1 (en) * 2014-01-13 2016-11-24 Valorbec Société en Commandite Method of making a benzylisoquinoline alkaloid (bia) metabolite, enzymes therefore
US20180163241A1 (en) * 2015-05-08 2018-06-14 The Board Of Trustees Of The Leland Stanford Junior University Methods of producing epimerases and benzylisoquinoline alkaloids
CN112996902A (en) * 2018-10-30 2021-06-18 国立大学法人神户大学 Recombinant host cells for the production of benzylisoquinoline alkaloids (BIA) and novel methods for the production of benzylisoquinoline alkaloids (BIA)
CN115896058A (en) * 2022-08-10 2023-04-04 中国中医科学院中药研究所 O-methyltransferase protein with high specific catalytic function on multiple BIAS mother nuclei and coding gene and application thereof
CN116121213A (en) * 2022-10-24 2023-05-16 复旦大学 Coupling enzyme participating in biosynthesis of dibenzyl isoquinoline alkaloid and application thereof

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160340704A1 (en) * 2014-01-13 2016-11-24 Valorbec Société en Commandite Method of making a benzylisoquinoline alkaloid (bia) metabolite, enzymes therefore
WO2015164960A1 (en) * 2014-04-29 2015-11-05 Epimeron Inc. Improved methods for making and using polynucleotide sequences in the synthesis of alkaloid compounds
US20180163241A1 (en) * 2015-05-08 2018-06-14 The Board Of Trustees Of The Leland Stanford Junior University Methods of producing epimerases and benzylisoquinoline alkaloids
CN106085981A (en) * 2016-06-30 2016-11-09 湖南美可达生物资源有限公司 Herba Macleayae Cordatae participates in methyl transferase gene and application thereof that Sanguinarine synthesizes with chelerythrine
CN112996902A (en) * 2018-10-30 2021-06-18 国立大学法人神户大学 Recombinant host cells for the production of benzylisoquinoline alkaloids (BIA) and novel methods for the production of benzylisoquinoline alkaloids (BIA)
CN115896058A (en) * 2022-08-10 2023-04-04 中国中医科学院中药研究所 O-methyltransferase protein with high specific catalytic function on multiple BIAS mother nuclei and coding gene and application thereof
CN116121213A (en) * 2022-10-24 2023-05-16 复旦大学 Coupling enzyme participating in biosynthesis of dibenzyl isoquinoline alkaloid and application thereof

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
KUNLIN LI 等: "Transcriptome Analysis of Stephania tetrandra and Characterization of Norcoclaurine-6-O-Methyltransferase Involved in Benzylisoquinoline Alkaloid Biosynthesis", FRONTINERS IN PLANT SCIENCE, vol. 13, 31 March 2022 (2022-03-31), pages 1 - 13 *
WANLI ZHAO 等: "Identification and characterization of methyltransferases involved in benzylisoquinoline alkaloids biosynthesis from Stephania intermedia", BIOTECHNOLOGY LETTERS, vol. 42, no. 3, 21 December 2019 (2019-12-21), pages 461 - 469 *
YANGYANG ZHANG 等: "Comparative Transcriptome Analysis Reveals Candidate Genes Involved in Isoquinoline Alkaloid Biosynthesis in Stephania tetrandra", PLANTA MEDICA, vol. 86, no. 17, 5 August 2020 (2020-08-05), pages 1258 - 1268 *
李琦爽: "粉防己碱生物合成途径候选功能基因筛选及去甲乌药碱-6-O-甲基转移酶的功能研究", 中国优秀硕士学位论文全文数据库（电子期刊）农业科技辑, no. 2, 15 February 2021 (2021-02-15), pages 047 - 490 *

Similar Documents

Publication Publication Date Title
CN105980563B (en) Compositions and methods for preparing (R) -reticuline and precursors thereof
US10889806B2 (en) Engineered pantothenate kinase variant enzymes
CN105505846A (en) Recombined spore with surface displaying glutamate dehydrogenase and construction method and application thereof
CN113151198B (en) Gamma-glutamine synthetase mutant, coding gene, amino acid sequence and application thereof
JPH0286779A (en) Improved type recombinant dna, transformant containing the same and production of heat-resistant glucose dehydrogenase therewith
CN106119180A (en) A kind of mycobacteria recombination engineering bacteria and application thereof
CN113088501B (en) Glutamic acid dehydrogenase mutant for producing L-glufosinate-ammonium and L-glufosinate-ammonium production method
CN109694892B (en) Method and kit for preparing salidroside
CN116536285A (en) Radix stephaniae tetrandrae linderae basic nitrogen methyltransferase CNMT and application thereof
CN115433721B (en) Carbonyl reductase mutant and application thereof
CN116463310A (en) Tetrandra root 4 '-oxymethyl transferase 4' -OMT and application thereof
CN115960879A (en) High-throughput screening method of D-psicose 3-epimerase mutant library and obtained mutant
CN116144622A (en) Cyclodextrin glucosyltransferase with improved solvent tolerance and preparation thereof
CN109609522B (en) Macleaya cordata dihydrobenzophenanthridine oxidase gene optimization sequence and application thereof
CN110004121B (en) Cholesterol oxidase and application thereof
US20220251523A1 (en) Engineered acetate kinase variant enzymes
CN107955827B (en) A kind of 9 Alpha-hydroxy androstane-4-alkene-3s of enzymatic conversion method production, the method for 17- diketone
CN107287256A (en) The method that whole-cell catalytic synthesizes L-2- piperidine carboxylic acids
CN110846289A (en) Acinetobacter baumannii xanthine dehydrogenase mutant and application thereof
CN112410353A (en) fkbS gene, genetic engineering bacterium containing fkbS gene, and preparation method and application of fkbS gene
CN115261343B (en) Aspergillus niger ester synthetase An3131, coding gene and application thereof
CN115261396B (en) Aspergillus niger ester synthetase An605, coding gene and application thereof
CN112522231B (en) Acyltransferase, and coding gene and application thereof
WO1999027115A1 (en) A thermophilic alkaline phosphoesterase and its expression
CN110452899B (en) Glucose isomerase, mutant and application of mutant in preparation of D-fructose

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination