CN109694892B

CN109694892B - Method and kit for preparing salidroside

Info

Publication number: CN109694892B
Application number: CN201811425601.1A
Authority: CN
Inventors: 王洪钟; 董银卯; 黄爱清; 何聪芬; 张贵友
Original assignee: Tsinghua University; Beijing Technology and Business University
Current assignee: Tsinghua University; Beijing Technology and Business University
Priority date: 2018-11-27
Filing date: 2018-11-27
Publication date: 2021-03-23
Anticipated expiration: 2038-11-27
Also published as: CN109694892A

Abstract

The invention discloses a method and a kit for preparing salidroside. The method for preparing salidroside comprises the steps of mixing the recombinant heat-resistant sucrose phosphorylase, the recombinant heat-resistant cellobiose phosphorylase, sucrose, tyrosol and phosphoric acid to obtain a reaction mixture, and then converting the reaction mixture at 40-55 ℃ to generate salidroside. The preparation method of salidroside has the advantages of simple process, low cost and high yield.

Description

Method and kit for preparing salidroside

Technical Field

The invention relates to a method for preparing salidroside through enzyme catalysis, in particular to a method and a kit for preparing salidroside through enzyme catalysis of sucrose phosphorylase and cellobiose phosphorylase.

Background

Salidroside is the main active ingredient of radix Rhodiolae. The content of salidroside in wild rhodiola plant is about 0.1% to 1.0%. Rhodiola belongs to precious traditional Chinese medicines and Tibetan medicines, and has various effects of resisting fatigue, resisting anoxia, resisting radiation, improving human body functions and the like.

Conventionally, salidroside can be obtained by the following three methods: rhodiola extraction, chemical synthesis and biological catalysis. However, for rhodiola extraction, firstly, rhodiola belongs to plateau plants, resources are limited, and the content of salidroside in rhodiola is low, only about 0.1% to 1.0%. Secondly, the extraction process is complex and the purification cost is high. For chemical synthesis, group protection is required, and conditions of high temperature and high pressure, various organic solvents, and the like are required. In particular, the chemically synthesized product is not a single β -configuration and needs further refinement. As for the biological catalysis method, the method has the advantages of mild reaction, high efficiency, environmental friendliness and the like, and is paid more attention.

However, the currently reported biocatalytic method mainly uses glucose and tyrosol as substrates, and uses glucosidase, including purified enzyme, cell disruption solution containing glucosidase, and bacterial cells, or glycosyltransferase, including purified enzyme, cell disruption solution containing glycosyltransferase, and bacterial cells as biocatalyst to carry out biocatalytic synthesis of salidroside under certain conditions. Weishenghua et al reported that beta-glucosidase nanogel synthesized salidroside in a non-aqueous phase (chemical development, 2018, 37 (2): 694) 701), prepared almond beta-glucosidase nanogel by an aqueous phase in-situ polymerization method, and used as a catalyst, and a water-organic solvent system as a reaction medium for catalyzing glucose and tyrosol to synthesize salidroside, wherein the yield reaches 23.7%. YU HL et al (Journal of Biotechnology, 2008, 133 (4): 469-477) use apple seed powder as biocatalyst to synthesize salidroside, and the yield of 120 hours of reaction in a system with the volume ratio of water to tertiary butanol of 1:9 can reach 20.7%. Hiroyuki Akita et al (Journal of Molecular Catalysis B: Enzymatic, 2006, 40(1-2):8-15) used beta-glucosidase enzyme extracted from almond to catalyze and synthesize salidroside with a yield of 11%. Tong et al (Bioorganic Medicinal Chemistry Letter, 2004, 14 (9): 2095-2097) used enzymes extracted from apple seeds to catalytically synthesize salidroside in a dioxane and water mixed system with a yield of 15.8%. Zhang et al (Process Biochemistry, 2005, 40(9): 3143-. Wangmenliang et al (biotechnology, 2009, 19 (1): 68-70) utilize sodium alginate and chitosan to immobilize beta-glucosidase, and catalyze and synthesize salidroside, with the conversion rate reaching 71.9% and the yield of 7.8 g/L. Patent CN104774815 discloses a method for preparing salidroside by using glycosyltransferase, but the yield is 114 mg/L.

The main disadvantages of the above-reported biocatalytic methods are the complex catalyst preparation process and the large amount of organic solvent required to achieve the micro-aqueous phase conditions. The micro-aqueous phase has a limited concentration of dissolved substrate and therefore a low concentration of product. In addition, the most commonly used is β -glucosidase, a hydrolase whose hydrolysis is often greater than synthesis, and therefore conversion is not high and yield is low. Therefore, a biological catalysis method which has simple exploration process, low cost and high yield and is suitable for industrial production of salidroside is needed.

Disclosure of Invention

The invention overcomes the defects of the biological catalysis method and provides the biological catalysis method for preparing the salidroside, which has simple process, low cost and high yield.

In one aspect, the present invention provides a method for preparing salidroside, comprising:

sucrose phosphorylase, cellobiose phosphorylase, sucrose, tyrosol and phosphoric acid are mixed to obtain a reaction mixture, and then, the reaction mixture is transformed at a temperature of 40 to 55 ℃ to produce salidroside.

The method for preparing salidroside uses cheap sucrose as raw material, thereby greatly reducing the production cost. Meanwhile, the process flow of the invention which uses the sucrose phosphorylase and the cellobiose phosphorylase for combined catalysis saves production steps and improves production efficiency. Wherein, the phosphoric acid generated by the catalysis of the cellobiose phosphorylase can be used as a reactant for catalyzing sucrose by the catalysis of the sucrose phosphorylase to generate glucose-1-phosphate and fructose, thereby further increasing the production efficiency.

Preferably, the sucrose phosphorylase is recombinant heat-resistant sucrose phosphorylase, and the DNA sequence and the amino acid sequence of the sucrose phosphorylase are respectively shown as SEQ ID No. 1 and SEQ ID No. 2; and the cellobiose phosphorylase is recombinant heat-resistant cellobiose phosphorylase, and the DNA sequence and the amino acid sequence of the cellobiose phosphorylase are respectively shown as SEQ ID No. 3 and SEQ ID No. 4.

Since both sucrose phosphorylase and cellobiose phosphorylase are recombinant thermostable enzymes, a large amount of hetero proteins present in the reaction system can be removed by simple heating without affecting the activities of sucrose phosphorylase and cellobiose phosphorylase without requiring fine purification in the production of these enzymes. Therefore, the production cost of the sucrose phosphorylase and the cellobiose phosphorylase is greatly reduced, and the production cost of the salidroside is reduced from the aspect of raw materials.

Further, the enzyme activity concentration of the recombinant thermostable sucrose phosphorylase in the reaction mixture is 250U/L to 600U/L, and the enzyme activity concentration of the recombinant thermostable cellobiose phosphorylase is 1200U/L to 1600U/L.

When the enzyme activity concentrations of the recombinant heat-resistant sucrose phosphorylase and the recombinant heat-resistant cellobiose phosphorylase are in the above ranges, the reaction efficiency is improved, the reaction time is shortened, and the production efficiency of the salidroside is optimized.

Preferably, the enzyme activity concentration of the recombinant thermostable sucrose phosphorylase is 500U/L, and the enzyme activity concentration of the recombinant thermostable cellobiose phosphorylase is 1500U/L.

Further, the concentration of sucrose in the reaction mixture is 20g/L to 150g/L, preferably 110g/L, the concentration of tyrosol in the reaction mixture is 20g/L to 50g/L, preferably 42g/L, and the concentration of phosphoric acid is 20mmol/L to 60mmol/L, preferably 50 mmol/L.

When the concentrations of sucrose, tyrosol and phosphoric acid are within the above ranges, the production efficiency of salidroside is optimized. The sucrose, tyrosol and phosphoric acid with the concentrations are combined with the recombinant thermostable sucrose phosphorylase and the recombinant thermostable cellobiose phosphorylase, so that the yield of the product salidroside is maximized.

Further, the reaction mixture further comprises a citric acid buffer of 20mmol/L to 100mmol/L, preferably 40mmol/L, pH 6.0 to 9.0, preferably 7.0.

The buffer solution is used, so that the reaction process is accelerated, and the process time is shortened.

Further, the conversion temperature is 40 ℃ to 55 ℃, preferably 50 ℃.

At temperatures in this range, the time required to convert the starting material to the product salidroside is greatly reduced, with conversion times ranging from only 10 hours to 36 hours, preferably 24 hours.

In another aspect, the present invention provides a kit for preparing salidroside, comprising sucrose phosphorylase, cellobiose phosphorylase, sucrose, tyrosol and phosphoric acid.

The sucrose phosphorylase is recombinant heat-resistant sucrose phosphorylase, the DNA sequence and the amino acid sequence of which are respectively shown by SEQ ID No. 1 and SEQ ID No. 2, and the cellobiose phosphorylase is recombinant heat-resistant cellobiose phosphorylase, and the DNA sequence and the amino acid sequence of which are respectively shown by SEQ ID No. 3 and SEQ ID No. 4.

The biocatalysis method and the kit for preparing the salidroside realize the high-yield synthesis of the salidroside by taking cheap sucrose as a raw material under mild conditions.

Drawings

Specific embodiments of the present invention will be explained in detail below with reference to the accompanying drawings, in which:

fig. 1 is a flow chart showing an exemplary method for synthesizing salidroside, according to an embodiment of the present invention.

Detailed Description

The invention provides a method for preparing salidroside, aiming at overcoming the defects of a biocatalysis method in the prior art, and the method comprises the following steps: sucrose phosphorylase, cellobiose phosphorylase, sucrose, tyrosol and phosphoric acid are mixed to obtain a reaction mixture, and then, the reaction mixture is transformed at a temperature of 40 to 55 ℃ to produce salidroside.

As shown in FIG. 1, sucrose phosphorylase phosphorylates sucrose to produce fructose and glucose-1-phosphate, and then glucose-1-phosphate and tyrosol are catalyzed by cellobiose phosphorylase to produce salidroside and phosphate in the same reaction system. Meanwhile, in the same reaction system, the phosphoric acid generated by catalyzing glucose-1-phosphate and tyrosol by cellobiose phosphorylase can be used as a raw material for phosphorylating sucrose by phosphorylase. Therefore, the cost of raw materials is greatly reduced.

The present invention is described in further detail below with reference to specific embodiments to assist those skilled in the art in further understanding the present invention.

Example 1 preparation of recombinant thermostable sucrose phosphorylase and recombinant thermostable cellobiose phosphorylase

Unless otherwise specified, the methods used in the following examples are conventional methods, and all reagents used are commercially available.

A. Construction of sucrose phosphorylase escherichia coli recombinant bacteria

Extracting genome from thermophilic saccharolyticum (Thermoanaerobacterium thermosaccharolyticum) as template, and performing PCR amplification to obtain PCR product. PCR conditions were 94 ℃ pre-denaturation for 2 min; denaturation at 94 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, extension at 72 ℃ for 1.5 minutes, 30 cycles; the temperature is kept at 72 ℃ for 10 minutes.

An upstream primer: CGCGGATCCATGGCTCTGAAAAATAAAGTGCAACTG, the cleavage site BamHI is underlined.

A downstream primer: CCGCTCGAGCACCAGGTATTTCACTTCTTCGCCGT, the cleavage site XhoI is underlined.

The PCR product and plasmid pET-28A were then double-digested with BamHI and XhoI enzymes and purified using a DNA purification kit, and then ligated with plasmid pET-28A using T4 ligase to give a ligated product. And transferring the ligation product into an escherichia coli competent cell BL21(DE3) to obtain a recombinant bacterium E.coli BL 21/pET-Spase.

B. Construction of cellobiose phosphorylase escherichia coli recombinant bacteria

Extracting genome from Clostridium thermophilum (Clostridium thermocellum) as template, performing PCR amplification to obtain PCR product, and obtaining PCR product. PCR conditions were 94 ℃ pre-denaturation for 2 min; denaturation at 94 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, extension at 72 ℃ for 2.5 minutes, 30 cycles; the temperature is kept at 72 ℃ for 10 minutes.

An upstream primer: CGCGGATCCATGAAGTTCGGTTTTTTTGATGATGC, the cleavage site BamHI is underlined.

A downstream primer: CCGCTCGAGTCCCATAATTACTTCAACTTTGTGAG, the cleavage site XhoI is underlined.

The PCR product and plasmid pET-28A were then double-digested with BamHI and XhoI enzymes and purified using a DNA purification kit, and then ligated with plasmid pET-28A using T4 ligase to give a ligated product. And transferring the ligation product into an escherichia coli competent cell BL21(DE3) to obtain a recombinant bacterium E.coli BL 21/pET-Cpase.

C. Coli BL21/pET-Spase

Recombinant strain E.coli BL21/pET-Spase of sucrose phosphorylase was inoculated into LB medium (composition: tryptone 10g/L, yeast extract 5g/L, sodium chloride 5g/L, pH7.0) containing 5mg/L kanamycin and cultured at 37 ℃ for 8 hours at 200 rpm. Then, the culture was inoculated into the self-induction medium at an inoculum size of 2%. The self-induction medium is a deionized water solution comprising: 30g/L of yeast extract powder, 20g/L of peptone, 2g/L of dipotassium phosphate, 4.0g/L of sodium chloride, 2.5g/L of magnesium sulfate, 4.0g/L of lactose and 5g/L of glycerol, and the pH value is 7.0. The cells were cultured at 32 ℃ and 200 rpm for 24 hours to induce expression, and the cultures were obtained. The thalli culture containing the recombinant heat-resistant sucrose phosphorylase is centrifuged for 5 minutes at the rotating speed of 4000 r/min to obtain thalli, and the thalli are washed by deionized water and then centrifuged, and repeated for three times. Centrifuging to obtain thallus, resuspending the thallus into thallus suspension with 50mmol/L citric acid buffer solution (pH7.0), treating with cell ultrasonication instrument for 5 min, centrifuging at 6000 rpm for 5 min, removing the centrifuged thallus debris solid at the lower layer, and collecting the centrifuged supernatant. The obtained centrifugal supernatant is enzyme solution containing recombinant heat-resistant sucrose phosphorylase, and the enzyme activity of the enzyme solution is 5000U/L by the measurement of a commercial sucrose phosphorylase kit.

D. Induced expression of recombinant strain E.coli BL21/pET-Cpase of cellobiose phosphorylase

The recombinant strain E.coli BL21/pET-Cpase of cellobiose phosphorylase was inoculated into LB medium containing kanamycin (as described in the above-mentioned example C), and cultured at 37 ℃ and 200 rpm for 8 hours. Then, the culture was inoculated into the self-induction medium at an inoculum size of 2%. The self-induction medium is a deionized water solution comprising: 30g/L of yeast extract powder, 20g/L of peptone, 2g/L of dipotassium phosphate, 4.0g/L of sodium chloride, 2.5g/L of magnesium sulfate, 4.0g/L of lactose and 5g/L of glycerol, and the pH value is 7.0. The cells were cultured at 32 ℃ and 200 rpm for 24 hours to induce expression, and the cultures were obtained. The thalli culture containing the recombinant heat-resistant cellobiose phosphorylase is centrifuged for 5 minutes at the rotating speed of 4000 r/min to obtain thalli, and the thalli is washed by deionized water and then centrifuged, and the operation is repeated for three times. Centrifuging to obtain thallus, resuspending the thallus into thallus suspension with 50mmol/L citric acid buffer solution (pH7.0), treating with cell ultrasonication instrument for 5 min, centrifuging at 6000 rpm for 5 min, removing the centrifuged thallus debris solid at the lower layer, and collecting the centrifuged supernatant. The obtained centrifugal supernatant fluid is enzyme solution containing recombinant heat-resistant cellobiose phosphorylase, and the enzyme activity of the enzyme solution is 12000U/L by measuring with a commercial cellobiose phosphorylase kit.

Example 2 Synthesis of Salidroside

1.10g of sucrose, 0.42g of tyrosol and 57. mu.L of phosphoric acid (concentration 85%) were sequentially added to a reaction flask (volume specification 25ml) containing 6ml of a citric acid buffer (50mmol/L, pH7.0) in accordance with the concentrations of sucrose 110g/L, tyrosol 42g/L and phosphoric acid 50mmol/L, the reaction materials were dissolved by stirring, 0.5ml of the recombinant thermostable sucrose phosphatase enzyme solution prepared in example 1 was added in accordance with the concentration of 250U/L, 1ml of the recombinant thermostable cellobiose phosphatase solution prepared in example 1 was added in accordance with the concentration of 1200U/L, and finally the volume of the reaction solution was made to 10ml with the same citric acid buffer and the pH of the reaction solution was adjusted to 7.0. Then placing the mixture in a constant temperature oscillator for biological reaction to prepare salidroside, wherein the reaction conditions are that the temperature is 50 ℃, the rotating speed is 50 r/min, and the reaction time is 24 hours. After the reaction is finished, the concentration of salidroside in the reaction solution is measured by an HPLC method. The HPLC method of salidroside comprises the following steps: a chromatographic column: diamonsil C₁₈5um, 150x 4.6 mm; mobile phase: methanol and water 35: 65; column temperature: 30 ℃; flow rate: 1.0 ml/min; detection wavelength: 280 nm.

Examples 3-18 were completed by preparing salidroside in the same manner as in example 2 above, except that the concentration of sucrose phosphorylase, cellobiose phosphorylase, sucrose, tyrosol, phosphoric acid, buffer, pH, temperature and conversion time were different from those used in example 2.

In examples 2 to 18, the concentrations of the respective raw materials used, the conversion conditions, and the yields of salidroside are shown in Table 1 below.

TABLE 1

Comparative example 1 Synthesis of Salidroside

In the following, salidroside was prepared in the same manner as in example 2 above, except that the sucrose phosphorylase concentration, cellobiose phosphorylase concentration, sucrose concentration, tyrosol concentration, phosphoric acid concentration, buffer concentration, pH, temperature and conversion time as in example 2 were used, and comparative examples 1 and 2 were completed.

In comparative examples 1 and 2, the concentrations of the raw materials used, the conversion conditions, and the yields of salidroside are shown in Table 2 below.

TABLE 2

As can be seen from Table 1, when sucrose phosphorylase was used at a concentration in the range of 250U/L to 600U/L, cellobiose phosphorylase was used at a concentration in the range of 1200U/L to 1600U/L, sucrose was used at a concentration in the range of 20g/L to 150g/L, tyrosol was used at a concentration in the range of 20g/L to 50g/L, and phosphoric acid was used at a concentration in the range of 20mmol/L to 60mmol/L, a temperature in the range of 40 ℃ to 55 ℃, a citric acid buffer was used at a concentration in the range of 20mmol/L to 100mmol/L, and a pH of 6.0 to 9.0, the yield of salidroside was high and the time required for conversion was short.

As can be seen from Table 2, when the concentration of sucrose phosphorylase, cellobiose phosphorylase, sucrose, tyrosol, phosphoric acid and pH and temperature of the reaction are out of the above-mentioned ranges, the yield of salidroside as a reaction product is low.

The salidroside is synthesized by using the sucrose phosphorylase and the cellobiose phosphorylase, the reaction process is realized in a full water phase, and higher conversion rate is obtained. In addition, the all-water phase system can dissolve more substrate, thereby effectively increasing the product concentration, i.e., yield. The reaction system does not use organic solvent, so that the inhibition effect on the enzyme is avoided, and the two enzymes are heat-resistant enzymes, so that the hybrid protein can be inactivated by heating without influencing the activity of the enzyme. Therefore, the process steps for obtaining the enzyme are greatly simplified, and the production cost is reduced.

Sequence listing

<110> Beijing university of Industrial and commercial

Qinghua university

<120> method and kit for preparing salidroside

<130> DF10-181147

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1464

<212> DNA

<213> Thermoanaerobacterium thermosaccharolyticum (Thermoanaerobacterium thermosaccharolyticum)

<400> 1

atggctctga aaaataaagt gcaactgatt acctacccgg atagcctggg cggtgacctg 60

aaaaccctga acgatgtgct agaaaaatac ttcagcgacg tttttggcgg tgtccatatt 120

ctgccgccgt tcccgagctc tggtgatcgt ggttttgcgc cgattaccta ctctgaaatc 180

gaaccgaaat tcggcacgtg gtacgatatt aagaaaatgg ccgaaaactt cgacatactg 240

ctagatctaa tggtcaatca cgtgagtcgt cgctccattt actttcagga ttttctgaag 300

aaaggccgca aaagtgaata tgcggatatg tttattaccc tggacaaact gtggaaagat 360

ggcaaaccgg tgaaaggtga tatcgaaaaa atgttcctgc gtcgcaccct gccgtactcc 420

acgtttaaaa ttgaagaaac cggcgaagaa gaaaaagttt ggaccacgtt cggtaaaacg 480

gatccgtcag aacagatcga cctggatgtg aactcgcatc tggcaaaaga atttctgctg 540

ggcgttttca aaaccttctc aaacttcggt gttaatatag tcagactaga tgctgtgggc 600

tatgttatta agaaaattgg cacgtcgtgc tttttcgtgg aaccggaaat ttacgaattt 660

ctggattgga tcaaaggcca ggcggccagt tatggtatag aactactgct agaagtccac 720

tcccagttcg aagtgcaata taaactggcc gaacgtggct ttctgattta cgacttcatc 780

ctgccgttta ccgttctgta tacgctgatc aacaaaagta acgaaatgct gtacgattac 840

ctgaaaaacc gcccgattaa tcagtttacc atgctggact gccatgatgg cattccggtc 900

aaaccggacc tggatggtct gatcgacacc aagaaagcga aagaagtggt tgatatttgt 960

gttcagcgtg gcgccaacct gagcctgatc tatggtgata aatacaaatc tgaagacggc 1020

ttcgatgtgc accaaatcgg ttgcacctat tacagcgcgc tgaattgtga tgacgatgcg 1080

tatctggcag ctcgcgccat tcagtttttc acgccgggca tcccgcaagt ctattacgtg 1140

ggcctgctgg caggtgttaa tgattttgaa gctgtcaaac gtaccaaaga aggccgtgaa 1200

attaaccgcc ataattacgg tctgaaagaa atcgaagaat ctgtgcagaa gaaagcggtt 1260

caacgcctgc tgaaactgat tcgtttccgc aacgaatatg aagctttcaa tggtgaattt 1320

atggtgcagg actgccaaaa agatgaaatt cgtctgacct ggaagaaaga tgataaacgc 1380

tgtagcctgt ttatcgatct gaaaacctac aaaacgacga ttgactacat taacgaaaac 1440

ggcgaagaag tgaaatacct ggtg 1464

<210> 2

<211> 488

<212> PRT

<400> 2

Met Ala Leu Lys Asn Lys Val Gln Leu Ile Thr Tyr Pro Asp Ser Leu

1 5 10 15

Gly Gly Asp Leu Lys Thr Leu Asn Asp Val Leu Glu Lys Tyr Phe Ser

20 25 30

Asp Val Phe Gly Gly Val His Ile Leu Pro Pro Phe Pro Ser Ser Gly

35 40 45

Asp Arg Gly Phe Ala Pro Ile Thr Tyr Ser Glu Ile Glu Pro Lys Phe

50 55 60

Gly Thr Trp Tyr Asp Ile Lys Lys Met Ala Glu Asn Phe Asp Ile Leu

65 70 75 80

Leu Asp Leu Met Val Asn His Val Ser Arg Arg Ser Ile Tyr Phe Gln

85 90 95

Asp Phe Leu Lys Lys Gly Arg Lys Ser Glu Tyr Ala Asp Met Phe Ile

100 105 110

Thr Leu Asp Lys Leu Trp Lys Asp Gly Lys Pro Val Lys Gly Asp Ile

115 120 125

Glu Lys Met Phe Leu Arg Arg Thr Leu Pro Tyr Ser Thr Phe Lys Ile

130 135 140

Glu Glu Thr Gly Glu Glu Glu Lys Val Trp Thr Thr Phe Gly Lys Thr

145 150 155 160

Asp Pro Ser Glu Gln Ile Asp Leu Asp Val Asn Ser His Leu Ala Lys

165 170 175

Glu Phe Leu Leu Gly Val Phe Lys Thr Phe Ser Asn Phe Gly Val Asn

180 185 190

Ile Val Arg Leu Asp Ala Val Gly Tyr Val Ile Lys Lys Ile Gly Thr

195 200 205

Ser Cys Phe Phe Val Glu Pro Glu Ile Tyr Glu Phe Leu Asp Trp Ile

210 215 220

Lys Gly Gln Ala Ala Ser Tyr Gly Ile Glu Leu Leu Leu Glu Val His

225 230 235 240

Ser Gln Phe Glu Val Gln Tyr Lys Leu Ala Glu Arg Gly Phe Leu Ile

245 250 255

Tyr Asp Phe Ile Leu Pro Phe Thr Val Leu Tyr Thr Leu Ile Asn Lys

260 265 270

Ser Asn Glu Met Leu Tyr Asp Tyr Leu Lys Asn Arg Pro Ile Asn Gln

275 280 285

Phe Thr Met Leu Asp Cys His Asp Gly Ile Pro Val Lys Pro Asp Leu

290 295 300

Asp Gly Leu Ile Asp Thr Lys Lys Ala Lys Glu Val Val Asp Ile Cys

305 310 315 320

Val Gln Arg Gly Ala Asn Leu Ser Leu Ile Tyr Gly Asp Lys Tyr Lys

325 330 335

Ser Glu Asp Gly Phe Asp Val His Gln Ile Gly Cys Thr Tyr Tyr Ser

340 345 350

Ala Leu Asn Cys Asp Asp Asp Ala Tyr Leu Ala Ala Arg Ala Ile Gln

355 360 365

Phe Phe Thr Pro Gly Ile Pro Gln Val Tyr Tyr Val Gly Leu Leu Ala

370 375 380

Gly Val Asn Asp Phe Glu Ala Val Lys Arg Thr Lys Glu Gly Arg Glu

385 390 395 400

Ile Asn Arg His Asn Tyr Gly Leu Lys Glu Ile Glu Glu Ser Val Gln

405 410 415

Lys Lys Ala Val Gln Arg Leu Leu Lys Leu Ile Arg Phe Arg Asn Glu

420 425 430

Tyr Glu Ala Phe Asn Gly Glu Phe Met Val Gln Asp Cys Gln Lys Asp

435 440 445

Glu Ile Arg Leu Thr Trp Lys Lys Asp Asp Lys Arg Cys Ser Leu Phe

450 455 460

Ile Asp Leu Lys Thr Tyr Lys Thr Thr Ile Asp Tyr Ile Asn Glu Asn

465 470 475 480

Gly Glu Glu Val Lys Tyr Leu Val

485

<210> 3

<211> 2433

<212> DNA

<213> Clostridium thermophilum (Clostridium thermocellum)

<400> 3

atgaagttcg gtttttttga tgatgcaaac aaagagtacg ttattaccgt gcccaggaca 60

ccgtatccgt ggataaacta cctgggtaca gagaatttct tctcactcat ttcgaatacc 120

gcaggcggat attgctttta cagggatgca aggcttagac gtataacaag atacagatac 180

aacaatgttc ctattgacat gggaggacgt tatttctaca tatatgacaa cggtgatttc 240

tggtcgccgg gatggtctcc ggtaaaaagg gagcttgaaa gctatgaatg cagacatgga 300

ctgggatata caaaaattgc cggtaaaaga aacggaataa aagcggaggt cactttcttc 360

gttccgttaa actacaatgg tgaagtccaa aagcttatat tgaagaatga aggacaggac 420

aaaaagaaaa taactctctt ctcttttatt gagttctgct tgtggaatgc ttatgatgat 480

atgaccaact tccagagaaa cttcagcacc ggtgaagttg agattgaagg ctcggttatc 540

tatcacaaga cagagtacag agagcgcaga aaccattacg cattctattc tgtaaatgca 600

aaaatcagcg gatttgacag tgacagagac agcttcatag gactttacaa cggttttgac 660

gctcctcagg ctgtagtgaa cggcaagtca aacaattccg ttgcggacgg atgggcaccg 720

attgcgtccc acagcattga aattgaattg aatcccgggg agcaaaagga atatgtattt 780

attataggtt atgtggagaa caaagatgaa gaaaaatggg agtcaaaagg tgtcatcaac 840

aagaaaaaag cttatgaaat gatagagcag ttcaacactg ttgaaaaggt tgacaaagca 900

tttgaagaac tcaagagcta ttggaatgct cttctttcaa aatactttct tgaaagccac 960

gatgaaaaac tcaaccgtat ggttaatata tggaatcagt accagtgtat ggttacattc 1020

aacatgtcaa gaagcgcttc atactttgaa tccggtatcg gaagaggtat gggtttcaga 1080

gattcaaacc aggacttgct gggatttgta caccagatac ccgaaagagc aagagaaagg 1140

cttcttgacc tggctgcaac tcagcttgaa gatggcggtg cgtaccatca gtatcagcct 1200

cttaccaaaa aaggtaacaa tgaaatcgga agcaacttca acgatgaccc gttgtggctg 1260

attcttgcaa ctgctgcata tattaaggaa accggtgatt attcaatact gaaggagcaa 1320

gttccgttca acaatgatcc gtccaaagcc gacaccatgt ttgaacattt gacccgttcc 1380

ttctaccatg tggtaaacaa ccttggacct cacggattgc cgcttatagg tagggcggac 1440

tggaatgact gccttaactt aaactgcttc tccaccgttc cggatgagtc gttccagacc 1500

acaacaagca aagacggaaa agtggcagag tcagttatga ttgccggaat gtttgtgttc 1560

atcggaaaag actatgtgaa gctttgcgaa tacatgggcc ttgaagagga agccaggaaa 1620

gctcagcagc atattgacgc aatgaaggaa gcaattctca aatacggtta tgacggtgag 1680

tggttcttaa gagcttacga cgactttgga agaaaagtcg gaagcaaaga aaacgaagag 1740

ggtaagattt tcattgagtc tcagggattc tgtgtaatgg ctgaaatcgg gcttgaagac 1800

ggcaaggctt tgaaggctct ggattctgtc aagaaatatc ttgacactcc atatggtctt 1860

gtacttcaaa atcccgcgtt tacaagatac tatattgagt acggagaaat ttcaacatat 1920

ccaccgggat acaaagaaaa tgccggtata ttctgccaca acaatgcatg gataatctgt 1980

gctgaaacgg ttgtcggaag aggagacatg gcgtttgatt actatagaaa aatagcacct 2040

gcttatattg aagatgtaag tgacatccac aagcttgagc cttatgttta tgcacagatg 2100

gttgccggaa aagacgcaaa acgccatgga gaagctaaga actcatggct gaccggtact 2160

gcggcgtgga actttgtggc gatttcacag tggatactgg gtgtaaaacc tgactatgac 2220

ggattgaaga ttgatccatg catacccaag gcatgggacg gatacaaagt taccagatat 2280

ttcagaggct caacttatga aatcactgtg aagaatccga accatgtatc aaaaggtgtg 2340

gctaaaatta ctgttgacgg caatgaaatc agcggaaata ttcttccggt gttcaatgac 2400

ggaaagactc acaaagttga agtaattatg gga 2433

<210> 4

<211> 811

<212> PRT

<213> Clostridium thermophilum (Clostridium thermocellum)

<400> 4

Met Lys Phe Gly Phe Phe Asp Asp Ala Asn Lys Glu Tyr Val Ile Thr

1 5 10 15

Val Pro Arg Thr Pro Tyr Pro Trp Ile Asn Tyr Leu Gly Thr Glu Asn

20 25 30

Phe Phe Ser Leu Ile Ser Asn Thr Ala Gly Gly Tyr Cys Phe Tyr Arg

35 40 45

Asp Ala Arg Leu Arg Arg Ile Thr Arg Tyr Arg Tyr Asn Asn Val Pro

50 55 60

Ile Asp Met Gly Gly Arg Tyr Phe Tyr Ile Tyr Asp Asn Gly Asp Phe

65 70 75 80

Trp Ser Pro Gly Trp Ser Pro Val Lys Arg Glu Leu Glu Ser Tyr Glu

85 90 95

Cys Arg His Gly Leu Gly Tyr Thr Lys Ile Ala Gly Lys Arg Asn Gly

100 105 110

Ile Lys Ala Glu Val Thr Phe Phe Val Pro Leu Asn Tyr Asn Gly Glu

115 120 125

Val Gln Lys Leu Ile Leu Lys Asn Glu Gly Gln Asp Lys Lys Lys Ile

130 135 140

Thr Leu Phe Ser Phe Ile Glu Phe Cys Leu Trp Asn Ala Tyr Asp Asp

145 150 155 160

Met Thr Asn Phe Gln Arg Asn Phe Ser Thr Gly Glu Val Glu Ile Glu

165 170 175

Gly Ser Val Ile Tyr His Lys Thr Glu Tyr Arg Glu Arg Arg Asn His

180 185 190

Tyr Ala Phe Tyr Ser Val Asn Ala Lys Ile Ser Gly Phe Asp Ser Asp

195 200 205

Arg Asp Ser Phe Ile Gly Leu Tyr Asn Gly Phe Asp Ala Pro Gln Ala

210 215 220

Val Val Asn Gly Lys Ser Asn Asn Ser Val Ala Asp Gly Trp Ala Pro

225 230 235 240

Ile Ala Ser His Ser Ile Glu Ile Glu Leu Asn Pro Gly Glu Gln Lys

245 250 255

Glu Tyr Val Phe Ile Ile Gly Tyr Val Glu Asn Lys Asp Glu Glu Lys

260 265 270

Trp Glu Ser Lys Gly Val Ile Asn Lys Lys Lys Ala Tyr Glu Met Ile

275 280 285

Glu Gln Phe Asn Thr Val Glu Lys Val Asp Lys Ala Phe Glu Glu Leu

290 295 300

Lys Ser Tyr Trp Asn Ala Leu Leu Ser Lys Tyr Phe Leu Glu Ser His

305 310 315 320

Asp Glu Lys Leu Asn Arg Met Val Asn Ile Trp Asn Gln Tyr Gln Cys

325 330 335

Met Val Thr Phe Asn Met Ser Arg Ser Ala Ser Tyr Phe Glu Ser Gly

340 345 350

Ile Gly Arg Gly Met Gly Phe Arg Asp Ser Asn Gln Asp Leu Leu Gly

355 360 365

Phe Val His Gln Ile Pro Glu Arg Ala Arg Glu Arg Leu Leu Asp Leu

370 375 380

Ala Ala Thr Gln Leu Glu Asp Gly Gly Ala Tyr His Gln Tyr Gln Pro

385 390 395 400

Leu Thr Lys Lys Gly Asn Asn Glu Ile Gly Ser Asn Phe Asn Asp Asp

405 410 415

Pro Leu Trp Leu Ile Leu Ala Thr Ala Ala Tyr Ile Lys Glu Thr Gly

420 425 430

Asp Tyr Ser Ile Leu Lys Glu Gln Val Pro Phe Asn Asn Asp Pro Ser

435 440 445

Lys Ala Asp Thr Met Phe Glu His Leu Thr Arg Ser Phe Tyr His Val

450 455 460

Val Asn Asn Leu Gly Pro His Gly Leu Pro Leu Ile Gly Arg Ala Asp

465 470 475 480

Trp Asn Asp Cys Leu Asn Leu Asn Cys Phe Ser Thr Val Pro Asp Glu

485 490 495

Ser Phe Gln Thr Thr Thr Ser Lys Asp Gly Lys Val Ala Glu Ser Val

500 505 510

Met Ile Ala Gly Met Phe Val Phe Ile Gly Lys Asp Tyr Val Lys Leu

515 520 525

Cys Glu Tyr Met Gly Leu Glu Glu Glu Ala Arg Lys Ala Gln Gln His

530 535 540

Ile Asp Ala Met Lys Glu Ala Ile Leu Lys Tyr Gly Tyr Asp Gly Glu

545 550 555 560

Trp Phe Leu Arg Ala Tyr Asp Asp Phe Gly Arg Lys Val Gly Ser Lys

565 570 575

Glu Asn Glu Glu Gly Lys Ile Phe Ile Glu Ser Gln Gly Phe Cys Val

580 585 590

Met Ala Glu Ile Gly Leu Glu Asp Gly Lys Ala Leu Lys Ala Leu Asp

595 600 605

Ser Val Lys Lys Tyr Leu Asp Thr Pro Tyr Gly Leu Val Leu Gln Asn

610 615 620

Pro Ala Phe Thr Arg Tyr Tyr Ile Glu Tyr Gly Glu Ile Ser Thr Tyr

625 630 635 640

Pro Pro Gly Tyr Lys Glu Asn Ala Gly Ile Phe Cys His Asn Asn Ala

645 650 655

Trp Ile Ile Cys Ala Glu Thr Val Val Gly Arg Gly Asp Met Ala Phe

660 665 670

Asp Tyr Tyr Arg Lys Ile Ala Pro Ala Tyr Ile Glu Asp Val Ser Asp

675 680 685

Ile His Lys Leu Glu Pro Tyr Val Tyr Ala Gln Met Val Ala Gly Lys

690 695 700

Asp Ala Lys Arg His Gly Glu Ala Lys Asn Ser Trp Leu Thr Gly Thr

705 710 715 720

Ala Ala Trp Asn Phe Val Ala Ile Ser Gln Trp Ile Leu Gly Val Lys

725 730 735

Pro Asp Tyr Asp Gly Leu Lys Ile Asp Pro Cys Ile Pro Lys Ala Trp

740 745 750

Asp Gly Tyr Lys Val Thr Arg Tyr Phe Arg Gly Ser Thr Tyr Glu Ile

755 760 765

Thr Val Lys Asn Pro Asn His Val Ser Lys Gly Val Ala Lys Ile Thr

770 775 780

Val Asp Gly Asn Glu Ile Ser Gly Asn Ile Leu Pro Val Phe Asn Asp

785 790 795 800

Gly Lys Thr His Lys Val Glu Val Ile Met Gly

805 810

Claims

1. A method for preparing salidroside, comprising:

2. The method of claim 1, wherein the temperature is 50 ℃.

3. The method of claim 1, wherein the sucrose phosphorylase is a recombinant thermostable sucrose phosphorylase.

4. The method according to claim 3, wherein the DNA sequence and the amino acid sequence of the recombinant thermostable sucrose phosphorylase are shown in SEQ ID No. 1 and SEQ ID No. 2, respectively.

5. The method of claim 4, wherein the cellobiose phosphorylase is a recombinant thermostable cellobiose phosphorylase.

6. The method according to claim 5, wherein the DNA sequence and the amino acid sequence of the recombinant thermostable cellobiose phosphorylase are shown in SEQ ID No. 3 and SEQ ID No. 4, respectively.

7. The method of claim 6, wherein the enzymatic activity concentration of the recombinant thermostable sucrose phosphorylase in the reaction mixture is 250 to 600U/L and the enzymatic activity concentration of the recombinant thermostable cellobiose phosphorylase is 1200 to 1600U/L.

8. The method of claim 7, wherein the enzymatic activity concentration of the recombinant thermostable sucrose phosphorylase is 500U/L and the enzymatic activity concentration of the recombinant thermostable cellobiose phosphorylase is 1500U/L.

9. The method of claim 1, wherein the concentration of sucrose in the reaction mixture is 20 to 150 g/L.

10. The method of claim 1, wherein the sucrose concentration is 110 g/L.

11. The process of claim 1, wherein the concentration of tyrosol in the reaction mixture is from 20g/L to 50 g/L.

12. The process of claim 1, wherein the concentration of tyrosol in the reaction mixture is 42 g/L.

13. The process of claim 1, wherein the concentration of phosphoric acid in the reaction mixture is 20 to 60 mmol/L.

14. The process of claim 1, wherein the concentration of phosphoric acid in the reaction mixture is 50 mmol/L.

15. The method of claim 1, wherein the reaction mixture further comprises 20 to 100mmol/L of a citric acid buffer at a pH of 6.0 to 9.0.

16. The method of claim 1, wherein the reaction mixture further comprises 40mmol/L of a citrate buffer at pH 7.0.

17. The method of claim 1, wherein the time for the conversion is from 10 hours to 36 hours.

18. The method of claim 1, wherein the time for the conversion is 24 hours.

19. A kit for preparing salidroside comprising sucrose phosphorylase, cellobiose phosphorylase, sucrose, tyrosol and phosphoric acid, for use in the preparation of salidroside according to the method of any one of claims 1 to 18.