CN116144563A - Method for enhancing transcription level of expressed glycoside hydrolase encoding gene APASM_6114 to improve yield of ansamitocins - Google Patents
Method for enhancing transcription level of expressed glycoside hydrolase encoding gene APASM_6114 to improve yield of ansamitocins Download PDFInfo
- Publication number
- CN116144563A CN116144563A CN202211301760.7A CN202211301760A CN116144563A CN 116144563 A CN116144563 A CN 116144563A CN 202211301760 A CN202211301760 A CN 202211301760A CN 116144563 A CN116144563 A CN 116144563A
- Authority
- CN
- China
- Prior art keywords
- apasm
- glycoside hydrolase
- ansamitocin
- encoding gene
- yield
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/18—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms containing at least two hetero rings condensed among themselves or condensed with a common carbocyclic ring system, e.g. rifamycin
- C12P17/188—Heterocyclic compound containing in the condensed system at least one hetero ring having nitrogen atoms and oxygen atoms as the only ring heteroatoms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01113—Mannosyl-oligosaccharide 1,2-alpha-mannosidase (3.2.1.113), i.e. alpha-1,2-mannosidase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a method for enhancing the transcription level of an expressed glycoside hydrolase encoding gene APASM_6114 to improve the yield of ansamitocins. Specifically, by using a strong promoter kasOp to enhance and express an endogenous glycoside hydrolase encoding gene APASM_6114 of actinomycetes treponifiensis in actinomycetes treponifiensis ATCC31280, the sucrose consumption of actinomycetes treponifiensis is promoted, the carbon source utilization rate is improved, and finally the yield of ansamitocins can be obviously improved. The final ansamitocin yield reaches 63.7mg/L at the laboratory shake flask fermentation level, which is 36.9% higher than that of the control strain. The invention can obviously improve the fermentation yield of the ansamitocin and simultaneously reduce the fermentation cost.
Description
Technical Field
The invention belongs to the technical field of biological medicine, and relates to a method for improving the yield of ansamitocins by enhancing the transcription level of an extracellular glycoside hydrolase encoding gene APASM_6114 of hydrolyzed sucrose; in particular to a method for improving the carbon source utilization rate and finally improving the ansamitocin fermentation level by enhancing the transcription level of an extracellular glycoside hydrolase encoding gene of hydrolyzed sucrose and improving the consumption of thalli sucrose.
Background
Ansamitocin (Ansamitocin) is a macrocyclic lactam antibiotic produced by actinomycetes (Actinosynnema pretiosum) that binds to the beta subunit of tubulin, blocking microtubule assembly and thus inhibiting tumor cell division. Chari et al from ImmunoGen, inc. formed a DM1 molecule by linking a disulfide bond to the C-3 ester group, which was reduced by DTT and then linked to a different antibody to form an antibody-drug conjugate (ADC). Currently, a number of ADC drugs derived from ansamitocins have entered different clinical stages of assays, where Trastuzumab Emtansine (i.e., T-DM 1) developed by roche for the treatment of human breast cancer has been marketed as a drug. Besides antitumor activity, ansamitocins also inhibit the growth and reproduction of fungi, yeasts, insects and other eukaryotic organisms.
During fermentation of ansamitocin-producing strain ATCC31280, sucrose can be effectively utilized as a carbon source by the strain, and a certain concentration of sucrose can provide a carbon skeleton for the growth of the strain, can provide reducing power, energy and promote the production of secondary metabolite synthesis precursors for primary and secondary metabolic pathways. The invention combines protein fractionation and activity tracking, and finds an extracellular glycoside hydrolase for hydrolyzing and utilizing sucrose and a coding gene thereof: apasm_6114. The consumption of the saccharose in the thalli can be increased by enhancing the transcription level of the extracellular glycoside hydrolase encoding gene of the hydrolyzed saccharose, so that the utilization rate of a carbon source is increased, and finally, the yield of the ansamitocins can be obviously increased.
Disclosure of Invention
The invention aims to provide a method for enhancing the transcription level of an expressed glycoside hydrolase encoding gene APASM_6114 so as to improve the yield of ansamitocins; in particular to a method for improving the fermentation level of ansamitocins by enhancing the transcription level of an extracellular glycoside hydrolase encoding gene APASM_6114 of hydrolyzed sucrose; the mutant strain (ARE-11) for high-yield ansamitocin is obtained by enhancing the extracellular glycoside hydrolase encoding gene APASM_6114 for expressing endogenous hydrolyzed sucrose in actinomycetes with precious beam ATCC31280, and the yield of ansamitocin is finally improved by improving the utilization efficiency of a thallus carbon source.
In order to achieve the above purpose, the present invention adopts the following technical scheme:
in a first aspect, the invention relates to a high-producing strain of ansamitocin, in which the expression of the extracellular glycoside hydrolase encoding gene for sucrose hydrolysis is enhanced in actinomycetes.
As one embodiment of the invention, the extracellular glycoside hydrolase encoding gene is APASM_6114, and the sequence of the extracellular glycoside hydrolase encoding gene is shown in SEQ ID NO.1. The coding gene is a coding gene of an endogenous extracellular glycoside hydrolase of actinomycetes tenuifolia responsible for sucrose hydrolysis.
As one embodiment of the invention, the actinomycetes treponifiensis is Actinosynnema pretiosum subsp.presum ATCC 31280. At the moment, the ansamitocin high-yield strain is obtained by enhancing expression of an extracellular glycoside hydrolase encoding gene APASM_6114 of endogenous hydrolyzed sucrose in actinomycetes precious beam ATCC31280, and the obtained mutant strain is based on enhancing expression of the glycoside hydrolase encoding gene APASM_6114 of the endogenous responsible sucrose hydrolysis, so that the yield of the ansamitocin is improved by promoting the consumption of sucrose and improving the utilization efficiency of a bacterial carbon source.
In a second aspect, the present invention relates to an integrated vector for enhancing expression of a glycoside hydrolase encoding gene for hydrolyzing sucrose, said vector comprising an extracellular glycoside hydrolase encoding gene APASM_6114 (derived from actinomycetes treponinium) having the sequence as shown in SEQ ID NO.1.
As one embodiment of the present invention, the extracellular glycoside hydrolase encoding gene is derived from actinomycetes cereus ATCC 31280.
In a third aspect, the present invention relates to a method for constructing an integrative vector for enhancing expression of a glycoside hydrolase encoding gene of hydrolyzed sucrose, wherein the integrative plasmid is specifically constructed by obtaining an (4281 bp) APASM_6114 gene fragment from an ATCC31280 genome by a PCR amplification method, and connecting the fragment to an NdeI/EcoRI site in the integrative plasmid pLQ648 downstream of an artificial strong promoter KasOp by an enzyme digestion connection method. The resulting integrative vector was designated pLQ2013.
As one embodiment of the present invention, the APASM_6114 gene was amplified by PCR using the primer APASM_6114-F/R.
In a fourth aspect, the invention relates to an ansamitocin high-yield strain, which is obtained by transferring the integrated plasmid vector or the integrated plasmid vector constructed by the method into actinomycetes with precious bundles for recombination.
As one embodiment of the invention, the invention provides a mutant strain ARE-11 of the rare bundle wire actinomycetes with high yield of ansamitocins, which is obtained by introducing the integrated plasmid vector or the integrated plasmid vector constructed by the method into a recipient strain ATCC31280 through conjugal transfer.
In a fifth aspect, the invention relates to a construction method of an ansamitocin high-yield strain, and the gene enhanced expression mutant strain is obtained by transferring and introducing an integrated plasmid vector obtained by the construction method into actinomycetes with rare bundles for recombination.
As an embodiment of the present invention, the construction method comprises the steps of:
s1, designing and constructing an integrated plasmid for enhancing expression of an extracellular glycoside hydrolase encoding gene APASM_6114;
s2, introducing the integrated plasmid into a receptor strain through conjugal transfer, then carrying out enramycin resistance verification on the mutant strain, and selecting mycelium to obtain a gene enhanced expression mutant strain through the difference of the sizes of PCR product fragments.
As one embodiment of the invention, the obtained mutant ARE-11 is based on enhancing expression of an endogenously hydrolyzed sucrose glycoside hydrolase encoding gene APASM_6114, so that the sucrose consumption is promoted, the utilization efficiency of a bacterial carbon source is improved, and the yield of ansamitocins is improved.
In a sixth aspect, the present invention relates to a method for increasing the yield (fermentation level) of ansamitocins, by enhancing the expression of the extracellular glycoside hydrolase encoding gene that hydrolyzes sucrose in actinomycetes, while in actinomycetes, ATCC31280, obtaining a high yield strain of ansamitocins; fermenting to obtain ansamitocin.
As one embodiment of the present invention, the enhanced expression mutant strain is obtained by enhancing the transcription level of the extracellular glycoside hydrolase encoding gene APASM_6114 of sucrose hydrolysis, and the ansamitocin is obtained by fermentation. As a specific example, the extracellular glycoside hydrolase encoding gene apasm_6114 expressing endogenous hydrolyzed sucrose is enhanced in actinomycetes treponensis ATCC31280 by using an artificial strong promoter KasOp, so that the sucrose consumption is promoted, the carbon source utilization efficiency of the thalli is improved, and the yield of ansamitocins is improved.
As an embodiment of the invention, the fermentation comprises the steps of: activating the encoding gene enhanced expression mutant strain (ARE-11) of the extracellular glycoside hydrolase for hydrolyzing sucrose on a solid culture medium, and then culturing the activated mycelium in a first-stage seed culture medium at 30 ℃ and 220rpm for 24 hours; transferring the seed into a secondary seed culture medium according to the inoculation amount of 3.3% -6.6%, and culturing for 24 hours at 30 ℃ and a rotating speed of 220 rpm; transferring into fermentation medium according to 10% inoculum size, fermenting at 25deg.C and 220rpm for 7 days, collecting fermentation broth, and extracting.
As a specific example, an ansamitocin high-producing strain is activated on a solid medium, and then the activated mycelium is cultured in a first seed medium for 24 hours at 30 ℃ and 220 rpm; transferring the seed into a secondary seed culture medium according to the inoculation amount of 6.6%, and culturing for 24 hours at the temperature of 30 ℃ and the rotating speed of 220 rpm; transferring into fermentation medium according to 10% inoculum size, fermenting at 25deg.C and 220rpm for 7 days, collecting fermentation broth, and extracting. As a specific comparative example, wild-type ATCC31280 and a mutant strain with enhanced gene expression were activated on a solid medium, and then the activated mycelium was cultured in a primary seed medium at 30 ℃ and 220rpm for 24 hours; transferring the seed into a secondary seed culture medium according to the inoculation amount of 6.6%, and culturing for 24 hours at the temperature of 30 ℃ and the rotating speed of 220 rpm; transferring into fermentation medium according to 10% inoculum size, fermenting at 25deg.C and 220rpm for 7 days, collecting fermentation broth, and extracting.
As one embodiment of the present invention, the solid medium comprises 0.4w/v% yeast extract, 1w/v% malt extract, 0.4w/v% glucose, 1.6-2% agar powder.
As one embodiment of the invention, the primary seed medium comprises TSB 3w/v%, yeast extract 0.5w/v%, sucrose 7.0w/v%. The secondary seed culture medium comprises TSB 3w/v%, yeast extract 0.6-0.8w/v%, sucrose 7.0w/v%, isobutanol 0.05v/v% and isopropanol 0.05v/v%.
As one embodiment of the present invention, the fermentation medium comprises 3.3-6.6w/v% yeast extract, 1w/v% malt extract, 7.0w/v% sucrose, 40mmol/L valine, 0.5v/v% isobutanol, 1.2v/v% isopropanol, mgCl 2 2mmol/L。
Compared with the prior art, the invention has the following beneficial effects:
1) The extracellular glycoside hydrolase coding gene APASM_6114 for hydrolyzing the sucrose is enhanced in the actinomycetes with the precious beam, so that the sucrose consumption is promoted, the utilization efficiency of a thallus carbon source is improved, and the yield of the ansamitocins is improved.
2) The invention obtains a high-yield strain by enhancing an extracellular glycoside hydrolase encoding gene APASM_6114 of hydrolyzed sucrose in actinomycetes with precious beam wires; the fermentation yield of the high-yield strain ARE-11 ansamitocin reaches 63.7mg/L under the laboratory shake flask fermentation level, and is improved by 36.9% compared with a control strain.
Drawings
Other features, objects and advantages of the present invention will become more apparent upon reading of the detailed description of non-limiting embodiments, given with reference to the accompanying drawings in which:
FIG. 1 is a schematic diagram of plasmid construction for enhancing expression of the gene APASM_6114;
FIG. 2 is a schematic diagram showing the fermentation yield of ansamitocin of pSET152, showing the gene encoding extracellular glycoside hydrolase for sucrose, which enhances expression of mutant ARE-11, and control strain ATCC 31280.
Detailed Description
The invention is further illustrated by the following examples. The present embodiment is implemented on the premise of the technical solution of the present invention, and detailed implementation manners and processes are given, but the protection scope of the present invention is not limited to the following embodiments. The experimental methods without specific conditions noted in the following examples were conducted under conventional conditions or under manufacturer's recommended conditions.
The plasmid pLQ648 to which the present invention relates is already in SCI database document Liu, x; wu, y; zhang, x.; kang, q.; yan, y; bai, l.complex transitome-Based Mining of Genes Involved in the Export of Polyether Antibiotics for Titer improvement.antibodies 2022,11,600.
The strain actinomycetes with precious beam ATCC31280 is described in the literature Wenqin Pan, qianjin Kang, lei Wang, linquan Bai & Zixin Deng: asm8, a specific LAL-type activator of-amino-5-hydroxybenzoate biosynthesis in ansamitocin production.science China Life Sciences 2013 (7): 601-608).
Examples
This example shows a specific procedure for obtaining the enhanced expression mutant ARE-11 of the gene APASM_6114 encoding the extracellular glycoside hydrolase responsible for sucrose hydrolysis. The specific operation steps are as follows:
step one: construction of plasmid pLQ2013
The APASM_6114 gene fragment (4281 bp) was amplified by PCR using the genomic DNA of actinomycetes treponensis ATCC31280 (GenBank assembly accession:CP 029607.1) as a template and the primers APASM_6114-F/R having NdeI/EcoRI cleavage sites introduced at both ends. An amplified fragment (NdeI/EcoRI) was inserted into the plasmid pLQ-648 at the NdeI/EcoRI site downstream of the strong promoter kasOp, resulting in plasmid pLQ2013, as shown in FIG. 1.
Step two: the plasmid pLQ2013 for gene enhanced expression constructed in the first step was introduced into the recipient bacterium ATCC31280 by conjugative transfer, and the correct gene enhanced expression zygote was verified by PCR and resistance verification methods. The method specifically comprises the following steps:
the constructed gene-enhanced expression plasmid pLQ2013 was transformed into the host e.coli ET12567 (containing the puc 8002 plasmid). E.coli ET12567 (pUZ 8002) was taken and incubated overnight at 37℃in LB containing 30. Mu.g/mL apramycin, 50. Mu.g/mL kanamycin and 25. Mu.g/mL chloramphenicol, with the same medium,the overnight cultures were transferred at 1% and incubated for 4-5 hours to OD 600 Reaching 0.6-0.8, and then rinsing the cells with fresh LB solution to remove antibiotics from the culture. At the same time, fresh mycelia of ATCC31280 (about 16 hours culture) were prepared, rinsed 2 to 3 times with LB solution, mixed with host bacteria ET12567 (pUZ 8002) prepared previously (ratio of recipient bacteria cells to donor bacteria: about 1:10) uniformly, spread on a solid medium containing 10mM magnesium ions, and cultured upside down in a 37℃incubator. After 16 hours, the plates were removed, two antibiotics, namely apramycin (final concentration 100. Mu.g/mL) and nalidixic acid (final concentration 100. Mu.g/mL), were added to 1.5mL of sterile water, mixed well, and covered on YMG solid medium, and the solid medium was air-dried and transferred to a 30℃incubator for inversion culture. The zygote grows out on a common plate after 3-5 days, and the zygote is transferred to a solid culture medium containing two antibiotics of apramycin (the final concentration is 100 mug/mL) and nalidixic acid (the final concentration is 100 mug/mL) for expansion culture, mycelium is selected, and the zygote is verified by using kasOp-F and APASM_6114-ver-R as primers and a PCR and resistance verification method to obtain the correct gene enhanced expression mutant ARE-11.
The recognition sites (cleavage sites) of the endonucleases involved in the above step one are shown in Table 1 below:
TABLE 1
The primer sequences used in the first and second steps are shown in Table 2:
TABLE 2
PCR system and conditions adopted for preparing the gene fragments in the first and second steps:
PCR reaction system: 30ng of DNA template, 30pmol of primer, 3. Mu.L of 50% DMSO, 25mM Mg 2+ 2. Mu.L of buffer 3. Mu.L, KOD polymerase 1 unit, and added with pure water to make up to 30. Mu.L;
PCR conditions: 95 ℃ for 5min;95 ℃ for 30s,64 ℃ for 30s,72 ℃ for 4min for 20s; cycling for 30 times; and at 72℃for 5min.
The primer sequences are as follows:
APASM_6114-F:CCCATATGATGGGGCACATGCGGGGCAGGCGGAG SEQ ID NO.2
APASM_6114-R CGGAATTCCTACAACCCCGTGCACTGCCCCGAC SEQ ID NO.3 PCR System and conditions used in screening mutant strains by PCR verification in the second step:
PCR reaction system: 10-100 ng of DNA template, 10pmol of primer, 2 mu L of 50% DMSO, 10 mu L of 2 Xmix buffer solution, and adding pure water to fill to 20 mu L;
PCR conditions: 95 ℃ for 10min;95 ℃ for 15s; 15s at 64 ℃;72 ℃ for 1min; cycling for 30 times; and at 72℃for 5min.
The primer sequences are as follows:
kasOp-F:GACAACATGCTGTGCGGTGTTGT SEQ ID NO.4
APASM_6114-ver-R：GGTAGGTGCCGTCGGAGAACGC SEQ ID NO.5
step three, detecting fermentation yield of ansamitocins by utilizing HPLC
Chromatographic analysis was performed using Agilent 1200 series HPLC from Agilent corporation and the chromatographic absorption peak at 254nm was measured using a DAD UV absorption detector.
Wherein, HPLC parameters are as follows:
chromatographic column: agilent ZORBAX SB-C18, 2.1X105 mm,3.5 μm;
mobile phase flow rate: 1mL/min;
mobile phase: pure acetonitrile solution and 1%o HPLC grade methanol gradient elution.
Column temperature: room temperature.
FIG. 2 shows the results of detecting the fermentation level of ansamitocins of mutant ARE-11, which is a gene encoding APASM_6114, for enhancing expression of extracellular glycoside hydrolase of sucrose. The result shows that after the genes ARE enhanced and expressed, the fermentation level of ansamitocin is obviously improved, compared with the original strain, the yield of the high-yield strain ARE-11 ansamitocin obtained by the invention reaches 63.7mg/L at the laboratory shake flask fermentation level, and is improved by 36.9% compared with the control strain.
In summary, the mutant strain ARE-11 of high-yield ansamitocin is obtained by using the strong promoter kasOp to enhance and express the endogenous glycoside hydrolase coding gene APASM_6114 of the actinomycetes with the rare bundle in the actinomycetes ATCC31280, so that the sucrose consumption of the actinomycetes with the rare bundle is promoted, the carbon source utilization rate is improved, and finally, the yield of the ansamitocin can be obviously improved. The invention can obviously improve the fermentation yield of the ansamitocin and simultaneously reduce the fermentation cost.
The foregoing describes specific embodiments of the present invention. It is to be understood that the invention is not limited to the particular embodiments described above, and that various changes and modifications may be made by one skilled in the art within the scope of the claims without affecting the spirit of the invention.
Claims (10)
1. An ansamitocin high-producing strain, characterized in that the extracellular glycoside hydrolase encoding gene expressing hydrolyzed sucrose is enhanced in actinomycetes rarefaciens Actinosynnema pretiosum subsp.presum ATCC 31280; the encoding gene of the extracellular glycoside hydrolase is APASM_6114, and the sequence of the encoding gene is SEQ ID NO.1.
2. An integrated plasmid vector for enhancing expression of a gene encoding an extracellular glycoside hydrolase enzyme that hydrolyzes sucrose, wherein the vector comprises an extracellular glycoside hydrolase encoding gene apasm_6114, the sequence of which is SEQ ID No.1.
3. An integrative plasmid construction method according to claim 2, characterized in that the apasm_6114 gene fragments are obtained from ATCC31280 genome by means of PCR amplification, respectively, and are ligated into the NdeI/EcoRI site of integrative plasmid pLQ648 by means of a restriction ligation.
4. A method for constructing an ansamitocin high-yield strain, characterized in that the integrated plasmid vector according to claim 2 or the integrated plasmid vector obtained by the construction method according to claim 3 is transferred into actinomycetes with a rare bundle for recombination to obtain the gene enhanced expression mutant strain.
5. The method for constructing an ansamitocin high-yield strain according to claim 4, wherein the method comprises the steps of:
s1, designing and constructing an integrated plasmid for enhancing expression of an extracellular glycoside hydrolase encoding gene APASM_6114;
s2, introducing the integrated plasmid into a receptor strain through conjugal transfer, then carrying out enramycin resistance verification on the mutant strain, and selecting mycelium to obtain a gene enhanced expression mutant strain through the difference of the sizes of PCR product fragments.
6. A method for improving the fermentation level of ansamitocins, which is characterized in that an extracellular glycoside hydrolase encoding gene for expressing hydrolyzed sucrose is enhanced in actinomycetes bargain ATCC31280 to obtain a high-yield strain of the ansamitocins; fermenting to obtain ansamitocin.
7. The method of claim 6, wherein the fermenting comprises the steps of: inoculating the activated ansamitocin high-yield strain into a primary seed culture medium, and culturing for 24 hours at 30 ℃ and 220 rpm; transferring the seed into a secondary seed culture medium according to the inoculation amount of 3.3% -6.6%, and culturing for 24 hours at 30 ℃ and a rotating speed of 220 rpm; transferring into fermentation medium according to 10% inoculum size, fermenting at 25deg.C and 220rpm for 7 days, collecting fermentation liquid, extracting, and detecting ansamitocin yield.
8. The method of claim 7, wherein the primary seed medium comprises TSB 3w/v%, yeast extract 0.5w/v%, sucrose 7.0w/v%.
9. The method of claim 7, wherein the secondary seed medium comprises TSB 3w/v%, yeast extract 0.6-0.8w/v%, sucrose 7.0w/v%, isobutanol 0.05v/v%, isopropanol 0.05v/v%.
10. The method of claim 7, wherein the fermentation medium comprises yeast extract 3.3-6.6w/v%, malt extract 1w/v%, sucrose 7.0w/v%, valine 40mmol/L, isobutanol 0.5v/v%, isopropanol 1.2v/v%, mgCl 2 2mmol/L。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211301760.7A CN116144563A (en) | 2022-10-24 | 2022-10-24 | Method for enhancing transcription level of expressed glycoside hydrolase encoding gene APASM_6114 to improve yield of ansamitocins |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211301760.7A CN116144563A (en) | 2022-10-24 | 2022-10-24 | Method for enhancing transcription level of expressed glycoside hydrolase encoding gene APASM_6114 to improve yield of ansamitocins |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN116144563A true CN116144563A (en) | 2023-05-23 |
Family
ID=86355129
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211301760.7A Pending CN116144563A (en) | 2022-10-24 | 2022-10-24 | Method for enhancing transcription level of expressed glycoside hydrolase encoding gene APASM_6114 to improve yield of ansamitocins |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116144563A (en) |
-
2022
- 2022-10-24 CN CN202211301760.7A patent/CN116144563A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111712570B (en) | Engineering strain for producing psicose and derivatives thereof, construction method and application thereof | |
| CN112094797B (en) | Genetically engineered bacterium and application thereof in preparation of 9 alpha, 22-dihydroxy-23, 24-bis-cholesta-4-en-3-one | |
| CN112029701B (en) | Genetically engineered bacterium and application thereof in preparation of 22-hydroxy-23, 24-bis-cholesta-4-en-3-one | |
| Li et al. | Improved AP-3 production through combined ARTP mutagenesis, fermentation optimization, and subsequent genome shuffling | |
| CN116144563A (en) | Method for enhancing transcription level of expressed glycoside hydrolase encoding gene APASM_6114 to improve yield of ansamitocins | |
| CN112625925B (en) | High-yield strain of dalbavancin precursor A40926B0 and application thereof | |
| CN113980982B (en) | High-yield ansamitocin method for enhancing expression of ansamitocin in-vivo target protein gene | |
| CN107541481B (en) | Genetic engineering bacterium for producing epirubicin and application thereof | |
| CN106191156B (en) | The method for improving Ge Erdeng element fermentation level | |
| CN112522174B (en) | Method for improving acarbose fermentation level by knocking out negative regulatory protein gene | |
| CN112410353A (en) | fkbS gene, genetic engineering bacterium containing fkbS gene, and preparation method and application of fkbS gene | |
| CN113846041B (en) | Method for enhancing expression of transporter genes to increase salinomycin fermentation levels | |
| CN112852647B (en) | Overexpression vector suitable for phomopsis FS508 and construction method and application thereof | |
| CN112410274B (en) | Genetic engineering bacterium for producing ascomycin and preparation method and application thereof | |
| CN112592878B (en) | Method for enhancing expression of positive regulatory protein gene to improve acarbose fermentation level | |
| CN117106836B (en) | Application of phosphatidyl glycerol phosphatase coding gene in fermentation production of cytidine | |
| CN114350688B (en) | Application of guaA gene, plasmid and strain in expression of azotobacter ferrite | |
| CN110713940B (en) | High-yield heavy oil aureobasidium pullulans strain and construction method and application thereof | |
| CN116121162A (en) | Recombinant streptomyces node for eliminating byproducts, construction method and application | |
| CN116716233A (en) | Genetically engineered bacterium for producing staurosporine and preparation method thereof | |
| CN118028202A (en) | Construction method and application of recombinant Escherichia coli for efficiently synthesizing lactoyl-N-disaccharide | |
| CN117305211A (en) | Construction and application of genetic engineering bacteria for efficiently synthesizing 2' -fucosyllactose | |
| CN116426452A (en) | Recombinant escherichia coli strain for synthesizing 2' -fucosyllactose and application thereof | |
| CN117660378A (en) | Cytochrome P450 oxidase, genetic engineering strain thereof and application thereof | |
| CN116064345A (en) | Non-antibiotic genetic engineering bacteria for efficiently producing fucosyllactose and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |