CN117660378A

CN117660378A - Cytochrome P450 oxidase, genetic engineering strain thereof and application thereof

Info

Publication number: CN117660378A
Application number: CN202311706077.6A
Authority: CN
Inventors: 邹雷; 常尚风; 黎雪
Original assignee: Shenyang Botai Biopharmaceutical Co ltd
Current assignee: Shenyang Botai Biopharmaceutical Co ltd
Priority date: 2023-12-11
Filing date: 2023-12-11
Publication date: 2024-03-08

Abstract

The invention provides a cytochrome P450 oxidase, a genetically engineered strain thereof and application thereof. The amino acid sequence of cytochrome P450 oxidase with steroid 16-position hydroxylation activity: (1) is shown as SEQ ID NO. 1; (2) Is an amino acid sequence obtained by deleting, substituting or adding 1, 2, 3, 4 or 5 amino acids from the amino acid sequence shown in SEQ ID NO. 1; or (3) an amino acid sequence having a homology of 73.60% or more with the amino acid sequence shown in SEQ ID NO. 1. The invention provides a method for producing 16-oxo-TS and 16 alpha OH-TS, and engineering strains over-expressing the P450 oxidase genes can produce high-yield 16-oxo-TS and 16 alpha OH-TS, and have potential industrial application values.

Description

Cytochrome P450 oxidase, genetic engineering strain thereof and application thereof

Technical Field

The invention belongs to the fields of genetic engineering, enzyme engineering and biotechnology, and in particular relates to cytochrome P450 oxidase derived from new mycobacterium aurum, a genetic engineering strain thereof and application thereof in biological transformation of steroid compounds.

Background

Steroid drugs are the second most general drugs worldwide, which are second only to antibiotics, and their physiological activities are various, so that they are widely used in real life. There is a huge demand for steroid drugs worldwide each year, and research on steroid drug synthesis can produce huge economic benefits. In the early years, the synthesis of steroid medicines mostly adopts a chemical method, and has the advantages of complex process, high cost, low yield and large pollution; in recent years, most of the steroid drugs are obtained by using cheap and easily available plant sterols as substrates and adopting a microbial conversion method with specific and efficient reaction, low cost, mild reaction conditions and small pollution.

Hydroxylation of steroids is very important for clinical applications, as this particular modification enhances the biological activity of the steroid drug. The hydroxylation reaction used in industrial production at the earliest time was the conversion of progesterone to 11 alpha-hydroxy derivatives using rhizopus nigricans. Since then, microbial hydroxylation has been widely used in the industrial production of steroid drugs, and most of the steroid hydroxylation carried out by microorganisms in the early industry is carried out by growing cells or resting cells of fungi, so that it has been found that not only can the fungi carry out hydroxylation of the steroid, but also the hydroxylation of the microorganism can be carried out in bacteria, such as mycobacteria, arthrobacter similis, escherichia coli, etc., and the prokaryotes have wider application value in the field of steroid drug synthesis.

Microbial conversion of steroids by cytochrome P450 oxidase can be considered as a process of detoxification of exogenous steroids by microorganisms. Cytochrome P450 oxidase represents a large family of self-oxidizable heme proteins, belonging to the class of monooxygenases, which are known for their specific absorption peak at 450 nm, and which catalyze a variety of reactions in vivo, principally monooxygenases. The main function of cytochrome P450 oxidase is to catalyze the hydroxylation of the inactive group R-H. They are a kind of Heme (Heme) -containing monooxygenases, which are commonly found in animals, higher plants, algae, fungi and bacteria.

Among species that can completely metabolize phytosterols or cholesterol, such as mycobacterium neogolden, mycobacterium smegmatis, mycobacterium fortuitum, nocardia, and rhodococcus, there are several cytochrome P450 oxidase genes in addition to CYP125, CYP124, and CYP142, but their role in steroid metabolism is poorly understood.

Disclosure of Invention

Aiming at the problems in the prior art, the invention obtains the P450 enzyme with steroid 16-hydroxylation activity and the gene thereof through a gene cloning expression method, and uses the P450 enzyme and the gene for preparing novel steroid intermediates.

In particular, the invention provides a P450 oxidase from novel Mycobacterium aurum, and an amino acid sequence and a nucleotide sequence thereof, and an expression strain containing a gene of the P450 oxidase. The expression strain can be used for effectively converting phytosterol, cholesterol, androstane-4-alkene-3, 17-dione (AD), androstenedione (ADD), androsterone, androstane, dehydroepiandrosterone, baodarone or Testosterone (TS, testeterone) and the like.

The P450 oxidase was found to belong to the CYP105 family by alignment in the Cytochrome P450 Homepage (http:// drnelson. Uthsc. Edu/Cytochrome P450. Html), so the protein was named CYP105X-1 and the encoding gene was CYP105X-1. The acquisition of the enzyme and the gene thereof lays a theoretical and practical foundation for 16-site hydroxylation of steroid substances by bacterial P450 oxidase.

In one aspect, the invention provides a cytochrome P450 oxidase with steroid 16-position hydroxylation activity, the amino acid sequence of which is as follows:

(1) As shown in SEQ ID NO. 1;

(2) Is an amino acid sequence obtained by deleting, substituting or adding 1, 2, 3, 4 or more amino acids from the amino acid sequence shown in SEQ ID NO. 1; or (b)

(3) Is an amino acid sequence with the homology of 73.60% or more with the amino acid sequence shown in SEQ ID NO. 1.

According to some embodiments of the invention, the steroid may be selected from one or more of phytosterol, cholesterol, androsta-4-ene-3, 17-dione (AD), androstenedione (ADD), 9-hydroxy androstenedione (9-OHAD), androsterone, dehydroepiandrosterone, badanone, and Testosterone (TS).

According to some embodiments of the invention, the 73.60% or more homology may be 73.60%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology.

According to some embodiments of the invention, the amino acid sequence having a homology of 73.60% or more with the amino acid sequence shown in SEQ ID NO.1 may be as shown in SEQ ID NO.3 or 5.

In another aspect, the invention provides a gene encoding a cytochrome P450 oxidase according to the invention.

According to some embodiments of the invention, the nucleotide sequence of the gene may be a nucleotide sequence encoding an amino acid sequence of a cytochrome P450 oxidase according to the invention or a nucleotide sequence comprising a partial amino acid sequence encoding a cytochrome P450 oxidase according to the invention.

According to some embodiments of the invention, the nucleotide sequence of the gene may be a nucleotide sequence encoding a cytochrome P450 oxidase having the amino acid sequence shown in SEQ ID No.1, 3 or 5.

According to some embodiments of the invention, the nucleotide sequence of the gene:

(1) As shown in SEQ ID NO.2, 4 or 6;

(2) A nucleotide sequence which hybridizes with the nucleotide sequence shown in SEQ ID NO.2, 4 or 6; or (b)

(3) Nucleotide sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to the nucleotide sequence shown in SEQ ID NO. 2.

Preferably, the nucleotide sequence of the gene is shown as SEQ ID NO. 2.

In yet another aspect, the present invention provides a genetically engineered strain which is a strain comprising or expressing a gene encoding a cytochrome P450 oxidase according to the present invention or a cytochrome P450 oxidase according to the present invention.

The present invention is not particularly limited with respect to the host strain into which the cytochrome P450 oxidase gene according to the present invention is introduced, and includes, but is not limited to, strains derived from Streptomyces, bacillus, pseudomonas, corynebacterium, arthrobacter, rhodococcus, mycobacterium, escherichia coli or Saccharomyces, and the like.

Preferably, the genetically engineered strain is a mycobacterium that expresses the cytochrome P450 oxidase gene according to the invention.

Preferably, the 16-position hydroxylation activity of the steroid compound obtained by the genetically engineered strain according to the present invention is capable of producing a 16-position ketosteroid compound and/or a 16-position hydroxysteroid compound with high efficiency.

Preferably, the genome of the genetically engineered strain is introduced with a cytochrome P450 oxidase gene according to the invention. Further preferably, the cytochrome P450 oxidase gene according to the present invention is introduced into the genome of the genetically engineered strain by means of an expression plasmid or genomic insertion. More preferably, the genetically engineered strain overexpresses the cytochrome P450 oxidase gene according to the invention.

Preferably, the genetically engineered strain is Mycobacterium vaccae (BTAD-16 a) with a collection number of CGMCC No.25582.

In a further aspect, the invention also provides the use of a cytochrome P450 oxidase according to the invention or of a genetically engineered bacterium according to the invention for the preparation of a 16-ketosteroid and/or a 16-hydroxysteroid.

According to some embodiments of the invention, the 16-position ketosteroid may be 16-oxo-testosterone (16-oxo-TS).

According to some embodiments of the invention, the 16-hydroxy steroid may be 16- β -hydroxyandrosta-4-ene-3, 17-dione (16βoh-AD) and/or 16- α -hydroxytestosterone (16αoh-TS).

In a further aspect, the invention also provides a process for the preparation of a 16-ketosteroid and/or a 16-hydroxysteroid, which comprises catalysing the conversion of the steroid into a 16-ketosteroid and/or a 16-hydroxysteroid using a cytochrome P450 oxidase according to the invention, or converting the steroid into a 16-ketosteroid and/or a 16-hydroxysteroid using a genetically engineered bacterium according to the invention.

According to some embodiments of the invention, the steroid may be selected from one or more of phytosterols, cholesterol, androsta-4-ene-3, 17-dione, androstenedione, 9-hydroxy androstenedione, androsterone, dehydroepiandrosterone, badanone, and testosterone.

According to some embodiments of the invention, the 16-position ketosteroid may be 16-oxotestosterone.

According to some embodiments of the invention, the 16-hydroxy steroid compound may be 16-beta-hydroxyandrosta-4-ene-3, 17-dione and/or 16-alpha-hydroxytestosterone.

According to some embodiments of the invention, the preparation method may comprise the steps of:

(1) Inoculating the genetically engineered bacterium in a seed culture medium for seed culture to obtain a seed culture;

(2) Inoculating the seed culture obtained in the step (1) into a fermentation medium containing a steroid compound for culturing to obtain a fermentation broth;

(3) And (3) separating and purifying the fermentation broth obtained in the step (2).

Preferably, in step (1), the seed culture comprises inoculating the genetically engineered bacterium according to the present invention into a seed culture medium for primary seed culture, and then transferring into the seed culture medium for secondary seed culture.

Preferably, in step (1), the seed medium comprises: beef extract 0.1-0.5g/L, peptone 0.5-2.0g/L, yeast powder 0.1-0.5g/L, glycerol 1.0-3.0g/L, and regulating pH to 6.5-7.5.

Preferably, in step (1), the seed culture is shake culture; more preferably, the shake culture is performed under the following conditions: the temperature is 30-35 ℃, the rotating speed is 200-250 rpm, and the time is 2-5 days.

Preferably, in step (2), the fermentation medium comprises: 1-5g/L soybean peptone, 0.5-2g/L yeast extract, 0.5-2g/L glucose, 0.1-0.3g/L citric acid, 0.01-0.05g/L ferric ammonium citrate, K ₂ HPO ₄ 0.5-1.5g/L，MgSO ₄ ·7H ₂ O 0.01-0.1g/L，NH ₄ NO ₃ 0.1-0.5g/L, and adjusting pH to 6.5-7.5.

Preferably, in step (2), the steroid containing fermentation medium comprises 0.05-2g/L steroid.

Preferably, in step (2), the culturing is shake culturing; more preferably, the shake culture is performed under the following conditions: the temperature is 30-35 ℃, the rotating speed is 200-250 rpm, and the time is 7-12 days.

Preferably, in step (3), the separation and purification comprises the steps of: and (3) extracting the fermentation liquor obtained in the step (2) by using ethyl acetate, and spin-drying the extract liquor.

The present invention provides a novel Mycobacterium aurum P450 oxidase capable of hydroxylating steroid such as AD, ADD, 9-OHAD or TS at position 16, which enzyme can carry out 16 beta hydroxylation of steroid, finally isomerizing it to 16-oxo-TS in Mycobacteria, which is further reduced to 16 alpha OH-TS under the reducing condition of Mycobacteria hypoxia. The invention also utilizes the gene recombination technology to obtain the strain expressing the P450 gene obtained by the invention, AD can be converted into 16-oxo-TS, the biological activity of the substance can be further researched, and simultaneously, the 16-oxo-TS can be converted into 16 alpha OH-TS under the reducing condition.

Compared with the prior art, the invention has at least the following beneficial effects:

the P450 expression strain provided by the invention can efficiently produce 16-oxo-TS and 16 alpha OH-TS, and the purity can reach more than 90% at most. Therefore, the invention can obviously reduce the production raw material cost and energy consumption of the steroid medicine, improve the utilization rate of the prodrug, greatly simplify the preparation process of the steroid medicine such as AD and the like, and obtain the derivative products of AD and the like with high purity and yield. The invention also discloses the effect of the P450 gene in the sterol metabolism process of mycobacterium, and the explanation of the gene function lays a new foundation for the application of metabolic engineering and synthetic biology in the steroid conversion process.

Drawings

Embodiments of the present invention are described in detail below with reference to the attached drawing figures, wherein:

FIG. 1 is a pathway of Mycobacterium engineering bacteria for degrading AD to 16-oxo-TS and 16αOH-TS;

FIG. 2 is a nucleic acid electrophoretogram of the steroid 16-position hydroxylase gene cyp105X-1 amplified from the genome of Mycobacterium auricum (Mycobacterium neoaurum); wherein lane 1 is the standard molecular weight of nucleic acids; lane 2 shows the amplified cyp105X-1 and tandem iron-sulfur protein fdx1 genes;

FIG. 3 is a graph showing the results of 16. Alpha. OH-Ts generated after two days of anaerobic transformation after AD4 days of aerobic transformation of BTAD-16 a.

Preservation of biological materials

The new Mycobacterium aurum BTAD-16a constructed by the invention is preserved in China general microbiological culture Collection center (CGMCC) with a preservation unit address: the collection number of the institute of microbiology of China academy of sciences is CGMCC No.25582, and the collection date is 2022, 8 and 24 days.

Detailed Description

The invention will be further illustrated with reference to specific examples. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. Furthermore, it is to be understood that various changes and modifications may be made by one skilled in the art after reading the disclosure of the present invention, and that such equivalents are intended to fall within the scope of the claims appended hereto.

The experimental methods used in the following examples are conventional methods unless otherwise specified. The strains, plasmids, kits, etc., used in the examples described below, were all commercially available products unless otherwise specified.

The following are the sources of the main materials used for the experiments:

the new golden mycobacterium (Mycobacterium neoaurum) MN-L01 strain is screened by the laboratory, and the strain is preserved in China general microbiological culture Collection center (CGMCC) of 1 month and 23 days in 2019, and the preservation unit address: the collection number of the Beijing Chaoyang area North Chen Xili No.1 and 3 institute of microbiology, china academy of sciences is CGMCC No.17227, and the strain is a mutant strain of Mycobacterium neogold DSM 44074, and mainly accumulates AD.

LB medium: 10.0g/L peptone, 5.0g/L yeast extract, 10.0g/L NaCl, pH 7.0.

Seed culture medium BPYG: beef extract 0.3g/L, peptone 1.0g/L, yeast powder 0.3g/L, glycerol 1.5g/L, and adjusting pH to 7.0.

Transformation fermentation medium: 3g/L soybean peptone, 1.2g/L yeast extract, 1.2g/L glucose, 0.2g/L citric acid, 0.03g/L ferric ammonium citrate, K ₂ HPO ₄ 1.2g/L，MgSO ₄ ·7H ₂ O 0.05g/L，NH ₄ NO ₃ 0.3g/L, AD 0.1g/L, and pH was adjusted to 7.0.

Coli DH 5. Alpha. Strain and nucleic acid tool enzyme were purchased from Thermo Scientific, and primer synthesis was carried out by Souzhou gold only biosciences, inc., and gene sequencing was carried out by the present laboratory.

Mycobacterium aurum (Mycobacterium neoaurum) DSM 44074 is purchased from German collection of strains.

The tool plasmid used in the invention: the gene expression plasmid was pMV261.

The gene operation technology adopted by the invention is mainly gene expression technology, and the molecular biology operation method is according to the handbook of molecular cloning laboratory. Other experimental methods not specifying specific conditions were performed according to conventional conditions or according to the conditions recommended by the manufacturer.

Example 1: acquisition of novel Mycobacterium aureofaciens cyp105X-1 gene and construction of expression strain

By taking PCR and enzyme digestion methods as an example, the complete P450 gene and the corresponding iron redox protein gene are obtained by analyzing the whole genome information of the novel Mycobacterium aurum DSM 44074, and the DNA sequence of cloning P450 from the novel Mycobacterium aurum DSM 44074 mutant is designed by PCR amplification primers. Through sequencing and sequence comparison, the P450 gene in the MN-L01 original strain is not mutated, and the nucleotide sequence is shown as SEQ ID NO. 2.

The specific implementation steps are as follows:

construction of P450 Gene expression plasmid

The information for the P450-iron redox protein primer is as follows:

upstream Mn-cyp 105X-1-f-L5 '-3': AAAAA (AAAAA)CATATGACAGCCAGCCAAATG NdeI

Downstream Mn-cyp 105X-1-f-R5 '-3': AAAA (AAAA)AAGCTTATCTTGACGCTCTACTCG HindIIIPCR the reaction system is as follows:

1. Mu.L of the novel Mycobacterium aurum MN-L01 genome template, 1.25. Mu.L of each primer (10. Mu. Mol/L), 1. Mu.L of DMSO, and 12.5. Mu.L of Q5 Hot Start 2 XMaster Mix were taken and the total volume was made up to 25. Mu.L.

The reaction process comprises the following steps: 98 ℃ for 30s;98 ℃ for 10s;60 ℃ for 30s;72 ℃,30s,34 cycles; 72℃for 3min.

The obtained PCR product (shown in FIG. 2) was subjected to gel recovery and digested with NdeI/HindIII, and the digested product was ligated to NdeI/HindIII digested pMV261 vector and transformed into clone E.coli DH 5. Alpha. And the kanamycin-resistant screened clone was subjected to digestion verification, and the correct expression vector was sequenced. After sequencing, a 1403bp gene fragment is obtained, and 401P 450 oxidase amino acids (the amino acid sequence is shown as SEQ ID NO. 1) and 63 iron redox protein amino acids (the amino acid sequence is shown as SEQ ID NO. 7) are completely encoded, and the nucleotide sequence for encoding the amino acid sequence is shown as SEQ ID NO. 8.

2. Preparation of novel Mycobacterium aureofaciens competent cells and plasmid transformation

The plate activated new golden mycobacterium MN-L01 is inoculated in 10mL LB culture medium for overnight at 1% inoculum size, 20mL LB culture medium is added in the morning for the next day to continue culturing until OD 600 is about 0.8, the thalli are collected by centrifugation, washed twice with 2 times volume deionized double distilled water, and finally suspended with 10% glycerol for each 100 mu L of thalli are split-packed. Then 1 mu L of the constructed expression plasmid is added into 100 mu L of competent cells, and the mixture is added into a 2mm electrorotating cup after blowing and sucking evenly, and the electrorotating conditions are as follows: 2500V, 25. Mu.F, 600Ω.

3. Screening and verification of recombinants

Immediately adding 1mL of precooled LB medium into the product after electrotransformation, culturing for 3-4h, coating the product on a NAK (kanamycin) plate containing 50 mug/mL of kanamycin, adding kanamycin into a nutrient broth medium, inoculating a single colony to culture in the LB medium containing 50 mug/mL of kanamycin for two days after 3-5d, and preserving bacteria, wherein the constructed over-expression strain is named as new golden mycobacterium (Mycobacterium neoaurum) BTAD-16a and is preserved in China General Microbiological Culture Center (CGMCC) for 24 days in 2022, and the preservation number is CGMCC NO.25582.

Example 2: application of engineering strain for expressing P450 in preparation of 16-oxo-TS or 16 alpha OH-TS

The experimental strain (obtained in example 1) and the control strain MN-L01 were each subjected to primary seed culture and secondary seed culture in this order: shake culturing with seed culture medium BPYG at 32deg.C at 220 rpm for 3d, transferring 1% of inoculating amount to seed culture medium BPYG at 32deg.C at 220 rpm for 3d;

transferring the substrate AD into a transformation fermentation culture medium containing the substrate AD in an inoculum size of 5%, dissolving the substrate AD in N, N-dimethylformamide, adding the substrate with the final concentration of 0.1g/L to the substrate AD, supplementing the substrate every 12 hours, and vibrating and transforming the substrate AD at the temperature of 32 ℃ at the rotating speed of 220 rpm for 8d;

after the conversion is finished, the conversion solution is extracted twice by using twice volume of ethyl acetate, and the extraction solution is combined, dried by spinning and then redissolved by methanol or acetonitrile for HPLC analysis.

The high performance liquid chromatography column is Agilent ZORBAX SB C18 (5 μm, 4.6X106 mm), the chromatography condition adopts gradient elution, water is phase A, methanol is phase B, and the flow rate is 1.0ml/min. The volume concentration of the phase B is as follows: 30-95% for 0-15.0min, 95% for 15.0-20.0min, and 5min for balancing. The final HPLC showed up to 90% yield of 16-oxo-TS produced using the method of the present invention, whereas the control species had no significant product formation.

The over-expression strain BTAD-16a can convert AD into 16-oxo-TS with the conversion rate reaching 90%, and the over-expression strain almost completely converts 16-oxo-TS into 16 alpha OH-TS under the condition of hypoxia or anaerobic fermentation in the later period of fermentation as shown in figure 3.

EXAMPLE 3 application of homologous Gene of the P450 Gene cyp105X-1 in the preparation of 16-oxo-TS or 16 alpha OH-TS by AD

It should be noted that the P450 gene cyp105X-1 of the present invention includes homologous genes with homology exceeding 73.60%, which can be derived from other strains, can be obtained by mutation from the gene sequence shown in SEQ ID NO.2, and has very wide universality.

The cyp105X-1 (MF) in Mycobacterium fortuitum Mycobacterium fortuitum ATCC 6841 has 73.60% similarity to the cyp105X-1 protein in DSM 44074, and under the same experimental conditions as in example 2, the products are 16-oxo-TS, which shows that the functions of the two are the same, the final concentration of the conversion substrate AD is 0.1g/L at most, and the molar yield is higher than 95%. The protein sequence and the gene sequence are respectively shown as SEQ ID NO.3 and SEQ ID NO. 4.

The cyp105X-1 (AS) in Arthrobacter simplicissimus Arthrobacter sp SLBN-53 has a similarity of 96.50% to the cyp105X-1 protein in DSM 44074, and under the same experimental conditions AS in example 2, the product is 16-oxo-TS, which indicates that the two are functionally identical, the final concentration of the conversion substrate AD is 0.1g/L at most, and the molar yield is 88%. The protein sequence and the gene sequence are respectively shown as SEQ ID NO.5 and SEQ ID NO. 6.

Although the present invention has been described to a certain extent, it is apparent that various changes can be made in the conditions without departing from the spirit and scope of the invention. It is to be understood that the invention is not to be limited to the described embodiments, but is to be given the full breadth of the claims, including equivalents of each of the elements described.

Claims

1. A cytochrome P450 oxidase with steroid 16-position hydroxylation activity, which has the amino acid sequence:

(1) As shown in SEQ ID NO. 1;

(3) An amino acid sequence having a homology of 73.60% or more with the amino acid sequence shown in SEQ ID NO. 1;

preferably, the amino acid sequence with the homology of 73.60% with the amino acid sequence shown in SEQ ID NO.1 is shown in SEQ ID NO.3 or 5.

2. A gene encoding the cytochrome P450 oxidase of claim 1;

preferably, the nucleotide sequence of the gene is a nucleotide sequence encoding an amino acid sequence of the cytochrome P450 oxidase according to claim 1 or a nucleotide sequence comprising a partial amino acid sequence encoding the cytochrome P450 oxidase according to claim 1;

preferably, the nucleotide sequence of the gene is a nucleotide sequence of cytochrome P450 oxidase with the coded amino acid sequence shown in SEQ ID NO.1, 3 or 5.

3. The gene according to claim 2, the nucleotide sequence of which:

(1) As shown in SEQ ID NO.2, 4 or 6;

(3) And SEQ ID NO:2, a nucleotide sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to the nucleotide sequence shown in seq id no;

preferably, the nucleotide sequence of the gene is shown as SEQ ID NO. 2.

4. A genetically engineered strain which is a strain comprising or expressing the cytochrome P450 oxidase according to claim 1 or the gene according to claim 2 or 3;

preferably, the genetically engineered strain is a strain selected from the group consisting of streptomyces, bacillus, pseudomonas, corynebacterium, arthrobacter, rhodococcus, mycobacterium, escherichia coli or saccharomyces, expressing the gene according to claim 2 or 3 in the genome;

preferably, the genetically engineered strain is a mycobacterium expressing the gene according to claim 2 or 3 in the genome;

preferably, the steroid compound 16-position hydroxylation activity obtained by the genetically engineered strain can produce a 16-position ketosteroid compound and/or a 16-position hydroxysteroid compound with high efficiency;

preferably, the cytochrome P450 oxidase gene is introduced into the genome of the genetically engineered strain; more preferably, the cytochrome P450 oxidase gene is introduced into the genome of the genetically engineered strain by an expression plasmid or genomic insertion; more preferably, the genetically engineered strain overexpresses the cytochrome P450 oxidase gene.

Preferably, the genetically engineered strain is novel Mycobacterium aurum with a preservation number of CGMCC No.25582.

5. Use of the cytochrome P450 oxidase according to claim 1 or the genetically engineered bacterium according to claim 4 for the preparation of a ketosteroid compound at position 16 and/or a hydroxysteroid compound at position 16.

6. The use according to claim 5, wherein the ketosteroid at position 16 is 16-oxo testosterone; preferably, the 16-hydroxy steroid compound is 16-beta-hydroxy androsta-4-ene-3, 17-dione and/or 16-alpha-hydroxy testosterone.

7. A method for producing a 16-position ketosteroid and/or a 16-position hydroxysteroid, which comprises catalyzing the conversion of a steroid into a 16-position ketosteroid and/or a 16-position hydroxysteroid using the cytochrome P450 oxidase according to claim 1, or converting a steroid into a 16-position ketosteroid and/or a 16-position hydroxysteroid using the genetically engineered bacterium according to claim 4.

8. The method of manufacture according to claim 7, wherein the steroid compound is selected from one or more of phytosterol, cholesterol, androsta-4-ene-3, 17-dione, androstenedione, 9-hydroxy androstenedione, androsterone, andronone, dehydroepiandrosterone, badanone, and testosterone;

preferably, the 16-ketosteroid compound is 16-oxotestosterone;

preferably, the 16-hydroxy steroid compound is 16-beta-hydroxy androsta-4-ene-3, 17-dione and/or 16-alpha-hydroxy testosterone.

9. The production method according to claim 7 or 8, wherein the production method comprises the steps of:

(1) Inoculating the genetically engineered bacterium of claim 4 into a seed culture medium for seed culture to obtain a seed culture;

10. The production method according to claim 9, wherein, in the step (1), the seed culture comprises inoculating the genetically engineered bacterium into a seed medium for primary seed culture, and then transferring into a seed medium for secondary seed culture;

preferably, in step (1), the seed medium comprises: beef extract 0.1-0.5g/L, peptone 0.5-2.0g/L, yeast powder 0.1-0.5g/L, glycerol 1.0-3.0g/L, and regulating pH to 6.5-7.5;

preferably, in the step (1), the seed culture is shake culture; more preferably, the shake culture is performed under the following conditions: the temperature is 30-35 ℃, the rotating speed is 200-250 rpm, and the time is 2-5 days;

preferably, in step (2), the fermentation medium comprises: 1-5g/L soybean peptone, 0.5-2g/L yeast extract, 0.5-2g/L glucose, 0.1-0.3g/L citric acid, 0.01-0.05g/L ferric ammonium citrate, K ₂ HPO ₄ 0.5-1.5g/L，MgSO ₄ ·7H ₂ O 0.01-0.1g/L，NH ₄ NO ₃ 0.1-0.5g/L, and regulating pH to 6.5-7.5;

preferably, in step (2), the steroid containing fermentation medium comprises 0.05-2g/L steroid;

preferably, in step (2), the culturing is shake culturing; more preferably, the shake culture is performed under the following conditions: the temperature is 30-35 ℃, the rotating speed is 200-250 rpm, and the time is 7-12 days;