CN105838730A - Engineered bacteria for phytosterol conversion and construction method and application of engineered bacteria - Google Patents
Engineered bacteria for phytosterol conversion and construction method and application of engineered bacteria Download PDFInfo
- Publication number
- CN105838730A CN105838730A CN201510016289.0A CN201510016289A CN105838730A CN 105838730 A CN105838730 A CN 105838730A CN 201510016289 A CN201510016289 A CN 201510016289A CN 105838730 A CN105838730 A CN 105838730A
- Authority
- CN
- China
- Prior art keywords
- gene
- alpha
- engineering bacteria
- construction method
- transformation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention relates to industrial microorganisms and fermentology, specifically, to a construction method and application of mycobacterium foruitum genetically engineered bacteria having a catalytic function. The genetically engineered bacteria are obtained through construction of dehydrogenase genes located at 1 and 2 sites of wild-type mycobacterium foruitum having the inactivation accession number being CGMCC No. 9657 and can catalyze phytosterol to generate 9[alpha]-hydroxylandrostenedione. The selectivity is 70-80%, and the by-product of 9[alpha]-hydroxytestosterone can be reduced.
Description
Technical field
The invention belongs to biotechnology and biological chemical field, specially industrial microorganism and fermentology field, a kind of Mycobacterium fortuitum with catalysis and application thereof.
Background technology
Steroid hormone class medicine refers in molecular structure containing the hormone medicine of steroidal structure, is the medicine that a class is important clinically, has the pharmacological actions such as the strongest infection, antiallergic, antiviral and shock, is one of the prior development direction of pharmaceuticals industry.This kind of drug main adrenocortical hormone to be included and the big class of gonadal hormone two.Corticosteroids medicine has cortisone acetate (cortisone acetate), hydrocortisone (hydrocortisone), dexamethasone acetate (oexamethasone acetate), fluocinonide (fluocinonide) etc. for clinical.
The important source material of steroid hormone class drug manufacture is plant sterol.It is converted into 9 Alpha-hydroxies-androstenedione (9 Alpha-hydroxies-androstenedione, 9OH-AD, 9 α-OH AD) through mycobacterium from plant sterol.9 Alpha-hydroxies-androstenedione can be as the synthesis material of multiple important steroidal drug.
The method complex manufacturing productivity of chemosynthesis is the highest, and therefore bioprocess technology fermentation process produces 9 Alpha-hydroxies-androstenedione is developing direction.
In existing report, new golden mycobacteria (M ycobacterium sp.) microorganism catalysis plant sterol is used to be converted into androstenedione, i.e. androstane-4-alkene-3,17-diketone (AD) or androstane-1,4-alkene-3,17-diketone (ADD), by mutagenesis screening to bacterial strain after ADD yield can significantly improve.Androstenedione need to generate 9 Alpha-hydroxies-androstenedione through reaction further.
Preserving number is a kind of Mycobacterium fortuitum of CGMCC No.9657,9 hydroxylases therein, 4,5 dehydrogenases can be catalyzed plant sterol with steroidal side chain cleavage enzyme and be converted into 9 Alpha-hydroxies-androstenedione, conversion process creates the by-product such as 9 Alpha-hydroxy testosterone of more amount simultaneously, producing unit consumption is 2.2～2.5, total conversion reaches 95%, selectivity 50%～60%.The main cause causing selectivity relatively low is as the prolongation of fermentation time, and product 9 Alpha-hydroxies-androstenedione can be by 1, and 2 dehydrogenases are converted into 9 Alpha-hydroxies-1,4-AD, 9 Alpha-hydroxies-Isosorbide-5-Nitrae-androstenedione produces other by-products further, and reaction is shown below.
Accordingly, it would be desirable to this bacterial strain is improved, it is thus achieved that the genetic engineering bacterium of product degradation can be reduced, reduce 9-hydroxyl-Isosorbide-5-Nitrae-androstenedione and generate and degrade further, to reduce unit consumption.
Summary of the invention
It is an object of the invention to provide a kind of method building new Mycobacterium fortuitum engineering bacteria, this bacterial strain has catalysis plant sterol and produces the function of 9 Alpha-hydroxy androstenedione, can reduce unit consumption and reduce by-product.
A kind of new engineering bacteria of offer is provided.
Above-mentioned engineering bacteria is also used for producing 9 Alpha-hydroxy androstenedione by the present invention.
Technical scheme is, by the method for at least one 1,2 dehydrogenase gene in inactivation Mycobacterium fortuitum, builds the engineering bacteria of transformation phytosterin.
Preferably, by inactivating the method for at least one 1,2 dehydrogenase gene in the Mycobacterium fortuitum that preserving number is CGMCC No.9657, the engineering bacteria of transformation phytosterin is built.
The preserving number of above-mentioned Mycobacterium fortuitum (latin name Mycobacterium foruitum) is CGMCC No.9657, preservation date is JIUYUE in 2014 15, preservation mechanism: China Committee for Culture Collection of Microorganisms's common micro-organisms center, address: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3.
The condition of culture of this bacterial strain is Carnis Bovis seu Bubali cream 0.2%, peptone 0.4%, glycerol 2%, agar powder 2% (pH is natural), cultivates 6-7 days for 28 DEG C.Storage conditions is vacuum lyophilization (long term storage).
This engineering bacteria can be used for being catalyzed plant sterol and is converted into 9 Alpha-hydroxy androstenedione, and conversion ratio is more than 95% and reduces by-product, and selectivity brings up to 70%～80%, and unit consumption is 1.8～2.0.
Make at least one 1,2 the dehydrogenase gene inactivation in the Mycobacterium fortuitum of wild type transformation phytosterin, build the engineering bacteria of transformation phytosterin.
By inactivating the method for at least one 1,2 dehydrogenase gene in the Mycobacterium fortuitum that preserving number is CGMCC No.9657, build the engineering bacteria of transformation phytosterin.
At least one in following 6 genes of 1,2 dehydrogenase genes inactivated: the nucleotide sequence more than 99% of the nucleic acid sequence homology corresponding to GenBank accession number EJZ14836, EJZ16093, EJZ16098, EJZ14570, EJZ14467 and EJZ13173；It is furthermore preferred that the gene inactivated is at least one in 1,2 dehydrogenase SEQ ID No.1～No.6.
Preferably, making 1 by inserting inactivation plasmid, 2 dehydrogenase genes interrupt inactivation.Particularly as follows:
(1) expand the homeologous sequence of 1,2 dehydrogenase genes and insert inactivation plasmid；
(2) the wild type Mycobacterium fortuitum of Plastid transformation preserving number CGMCC No.9657 step (1) obtained.
Described engineering bacteria construction method is, to above-mentioned 6 kinds
Described homeologous sequence with preserving number be CGMCC No.9657 wild type Mycobacterium fortuitum genomic DNA as template, with in following group of upstream and downstream primer least one set expand obtain fragment or the nucleotide sequence identical with this fragment:
(a) gene 1 forward primer: 5 '-AAAGAATTCCGGAGATGCTGTCGTTCGTG
Gene 1 downstream primer: 5 '-AAAAAGCTTCGCCGGATTCCATCCACTT
(b) gene 2 forward primer: 5 '-AAAGAATTCTCGAAGTTGTCTGCCTTGACTG
Gene 2 downstream primer: 5 '-AAAAAGCTTCCGCTGGCTGAACCTGATG
(c) gene 3 forward primer: 5 '-AAAGAATTCGACGGTCTTGCCGGGTTC
Gene 3 downstream primer: 5 '-AAAAAGCTTCGGACGGTCAGTGAGTGGATT
(d) gene 4 forward primer: 5 '-AAAGAATTCTGTGCCCAGATCGGAAATGC
Gene 4 downstream primer: 5 '-AAA AAGCTTTGCCTCGCTTCGGCTCAAC
(e) gene 5 forward primer: 5 '-AAAGAATTCGACACCGACCTGGTGGAGACA
Gene 5 downstream primer: 5 '-AAA AAGCTTTTCAACGTGGCGGCAATC
(f) gene 6 forward primer: 5 '-AAAGAATTCAGGGTCGGCTGCTTCTG
Gene 6 downstream primer: 5 '-AAAAAGCTT TTCTCACTTCGGCGGTTC.
Can be obtained the Mycobacterium fortuitum engineering bacteria of transformation phytosterin by said method, cultivation and the method for preserving of this bacterial strain are identical with the Mycobacterium fortuitum that preserving number is CGMCC No.9657.
The preparation technology of a kind of 9 Alpha-hydroxy androstenedione, with plant sterol as raw material, converts with above-mentioned engineering bacterium fermentation, and the condition of fermentation is: at 25～34 DEG C, (preferably 26～32 DEG C) are passed through air and stir；Ventilation ratio is 1:0.3～0.85, microbe conversion 48～168 hours.
Preferably ventilation ratio is 1:0.5～0.75；More preferably 1:0.55～0.65.Preferably mixing speed is 300～600rpm, more preferably 450～500rpm.Preferably fermentation time is 84～168 hours, more preferably 84～120 hours or 136～168 hours.
The condition of one preferred microbe conversion cultivation is: temperature 29 ± 1 DEG C, ventilation ratio 1:0.6, mixing speed 480rpm, the microbe conversion time is 84～120 hours or 136～168 hours.
Microbe conversion culture medium contains: (a) glycerol 0.5%～2%, (b) sodium phosphate or acid phosphate sodium salt 0.75%～0.9%, and potassium phosphate or acid phosphate potassium salt 0.35%～0.5%, (d) ammonium salt such as NH4Cl 0.15%～0.3%, (e) MgSO40.02%～0.06%, (f) analysis for soybean powder 0.05%～0.2% or the peptone of 0.5%～1% or yeast extract；(g) dispersant (such as Tween 80) 0.05%～0.2%；H () kanamycin 15～25ppm, is mass percent.
Possibly together with plant sterol 0.7%～2% in microbe conversion culture medium, surplus is water.
Preferably, microbe conversion culture medium is: glycerol 1%, Na2HPO40.84%, KH2PO40.45%, NH4Cl 0.2%, MgSO40.03%, analysis for soybean powder 0.1%, plant sterol 1%, dispersant such as Tween 80 0.1%, kanamycin 20ppm, the rest is water, pH 8.5.
Preferably, first Mycobacterium fortuitum is inoculated in seed culture medium, is passed through air under 25～34 DEG C (preferably 26～32 DEG C) and stirs, after cultivating 48～120 hours, being inoculated in fermentation culture.Ventilation ratio is 1:0.3～0.85, preferably 1:0.5～0.75, and mixing speed is 300～600rpm, preferably 450～500rpm.Take the volume ratio inoculation fermentation culture fluid that seed culture fluid is with 5%～12%, preferably 10%.
The seed culture medium used in fermentation contains: peptone 0.8%～1.4%, Carnis Bovis seu Bubali cream 0.2%～0.5%, NaCl 0.45%～0.6% (being mass percent), kanamycin 40～60ppm, pH6.8～7.3.Preferably, seed culture medium pH=6.9～7.0, containing peptone 1%, Carnis Bovis seu Bubali cream 0.3%, NaCl 0.5%, kanamycin 50ppm,.
Preferably, seed culture condition is: temperature 29 ± 1 DEG C, ventilation ratio 1:0.6, mixing speed 480rpm, cultivates 96 hours.
Fermentation liquid organic solvent, such as ethyl acetate, dichloromethane or dichloroethane extraction.Fermentation liquid and organic solvent volume are than for 1:2～2:1, preferably 1:1.2～1.2:1.
After testing, it is 9 Alpha-hydroxy androstenedione with the primary product of the Mycobacterium fortuitum microbe conversion plant sterol of the present invention, conversion ratio more than 95%, selectivity reaches more than 80%, produces the unit consumption of 9 Alpha-hydroxy androstenedione 1.8～2, compared with wild-type strain, genetic engineering bacterium blocks 1,2 dehydrogenases and is allowed to inactivate, thus reduces 9-hydroxyl-1,4-AD generates and degraded further, makes the unit consumption of conversion reduce；It is 8:1～12:1 that genetic engineering bacterium converts the production ratio of produced 9 α-OH AD and by-product d (9 Alpha-hydroxy testosterone), the amount of by-product d (9 Alpha-hydroxy testosterone) declines more than 50% than wild-type strain, and genetic engineering bacterium converts late-stage products and stablizes, do not have original wild type bacterial strain and convert the phenomenon of late-stage products fast degradation.Compared with original strain, genetic engineering bacterium has more preferably performance, can improve production efficiency.Process is simple, and efficiency is high, has good application prospect.
Accompanying drawing explanation
Fig. 1 is the schematic diagram of homologous recombination gene disruption inactivation.
After Fig. 2 was for fermentation 96 hours, extracting liquid chromatograph (HPLC) figure of fermentation liquid detection, in Fig. 2, (A) is genetic engineering bacterium, and in Fig. 2, (B) is wild-type strain.
Wherein, a by-product 1；B ethyl acetate；C 9 Alpha-hydroxy androstenedione；D 9 Alpha-hydroxy testosterone (by-product 2)；E by-product 3；F by-product 4
When Fig. 3 is the different fermentations time, the product amount that wild-type strain and genetic engineering bacterium are converted into.
Specific embodiments
Embodiment 1
The Mycobacterium fortuitum of wild type, gathers from Zhangjiajie, Hunan in August, 2011
Latin name: Mycobacterium foruitum
Preserving number: CGMCC No.9657
Preservation date: on JIUYUE 15th, 2014
China Committee for Culture Collection of Microorganisms of preservation mechanism common micro-organisms center
Address: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3
The storage conditions of above-mentioned Mycobacterium fortuitum is: vacuum lyophilization (long term storage)
Condition of culture is: can be by general accidental mycobacterium culture medium, 25～30 DEG C (preferably 28 DEG C) slant culture 6～7 days in Fructus Solani melongenae bottle.Typical slant culture based component: Carnis Bovis seu Bubali cream 0.2%, peptone 0.4%, glycerol 2%, agar powder 2% (pH is natural).
The clone of the Homo~logous exchange fragment that 2 1,2 dehydrogenase genes of embodiment are relevant
In the accidental mycobacterium of wild type, it is cloned into six genes relevant with 1,2 dehydrogenases.Its sequence has the homology of 99%～100% with the nucleotide sequence corresponding to GenBank accession number EJZ13173, EJZ14467, EJZ14570, EJZ14836, EJZ16098 and EJZ16093 respectively.
Clone a part of fragment in inside of six genes respectively, build six gene disruption plasmids.First according to accidental mycobacterium corresponding sequence design primer (sequence is respectively as shown in SEQ ID No.1～12) delivered:
Gene 1 (EJZ13173) forward primer: 5 '-AAAGAATTCCGGAGATGCTGTCGTTCGTG
Gene 1 downstream primer: 5 '-AAAAAGCTTCGCCGGATTCCATCCACTT
Gene 2 (EJZ14467) forward primer: 5 '-AAAGAATTCTCGAAGTTGTCTGCCTTGACTG
Gene 2 downstream primer: 5 '-AAAAAGCTTCCGCTGGCTGAACCTGATG
Gene 3 (EJZ14570) forward primer: 5 '-AAAGAATTCGACGGTCTTGCCGGGTTC
Gene 3 downstream primer: 5 '-AAAAAGCTTCGGACGGTCAGTGAGTGGATT
Gene 4 (EJZ14836) forward primer: 5 '-AAAGAATTCTGTGCCCAGATCGGAAATGC
Gene 4 downstream primer: 5 '-AAA AAGCTTTGCCTCGCTTCGGCTCAAC
Gene 5 (EJZ16098) forward primer: 5 '-AAAGAATTCGACACCGACCTGGTGGAGACA
Gene 5 downstream primer: 5 '-AAA AAGCTTTTCAACGTGGCGGCAATC
Gene 6 (EJZ16093) forward primer: 5 '-AAAGAATTCAGGGTCGGCTGCTTCTG
Gene 6 downstream primer: 5 '-AAAAAGCTT TTCTCACTTCGGCGGTTC
Above-mentioned primer is synthesized by Mai Pu bio tech ltd, Shanghai.The total genome of wild type accidental mycobacterium with preserving number being is as template.Use the Primerstart high-fidelity DNA polymerase of precious biotech firm to carry out the clone of fragment.PCR condition is: 98 DEG C of degeneration 10S, 65 DEG C of annealing 15S, 30 circulations, 72 DEG C extend 7min.After PCR primer loading electrophoresis, reclaim purpose band.The purpose band reclaimed is attached with plasmid, is connected into the HindIII/EcoRI site of pSP72 plasmid, and named pSL-2-1, pSL-2-2, pSL-2-3, pSL-2-4, pSL-2-5 and pSL-2-6 also check order.Each cloned sequence and sequence phase comparison in GenBank (accession number: the nucleotide sequence corresponding to EJZ13173, EJZ14467, EJZ14570, EJZ14836, EJZ16098 and EJZ16093), homology is more than 99%.
By Homo~logous exchange purpose fragment with same restriction enzyme site HindIII/EcoRI from pSL-2-1, pSL-2-2, pSL-2-3, pSL-2-4, pSL-2-5 and pSL-2-6 cuts out, reclaim purpose fragment, it is connected into respectively the pET28a plasmid of HindIII/EcoRI restriction enzyme site, obtains novel plasmid and be respectively designated as pSL-3-1, pSL-3-2, pSL-3-3, pSL-3-4, pSL-3-5 and pSL-3-6.
The electricity conversion of embodiment 3 gene disruption plasmid
Cultivate about 48 hours from the wild type accidental mycobacterium inclined-plane appropriate thalline of picking that preserving number is CGMCC No.9657 with 50ml seed culture medium, reach exponential phase.Bacterium solution shaking flask being taken out, pour 50ml centrifuge tube into, 3800rpm is centrifuged 15min, after centrifugal end, washs thalline with containing 10% glycerol, then 3800rpm is centrifuged；Repeated washing, centrifugal 1 time；Supernatant is outwelled, takes thalline respectively about in six cups that shock by electricity (200 μ l/), take 2 μ l plasmid (pSL-2-1, pSL-2-2, pSL-2-3, pSL-2-4, pSL-2-5 and pSL-2-6) it is separately added into mixing in electric shock cup, electroporation condition is 2.5kv, 2ms, after electric shock terminates, adds 500 μ l seed culture mediums, in after mixing, sucking-off is respectively placed in little centrifuge tube, 37 DEG C of incubators are cultivated about 2 hours.Six parts of electric converted products are coated with respectively the slant medium flat board containing 200 μ g/ml kanamycin, after 37 DEG C are cultivated two weeks, picking positive transformant.The bacterial strains proceeding to 6 kinds of inactivation plasmids are respectively designated as bacterial strain I～VI, and the cultivation of above-mentioned bacterial strains and method for preserving are with the wild type Mycobacterium fortuitum of CGMCC No.9657.
The extracting of mutant STb gene and the verification method of genotype be: six plasmid (pSL-2-1 of picking respectively, pSL-2-2, pSL-2-3, pSL-2-4, pSL-2-5 and pSL-2-6) positive transformant (Kan 200 μ g/ml) in seed fluid medium carry out resistance checking, 30 DEG C, after 220rpm cultivates 3 days, filter out the bacterial strain that can grow.Take above-mentioned bacterium solution 1ml that can grow in kalamycin resistance culture fluid, it is centrifuged and removes supernatant, with the STE buffer solution of 0.5ml once, and with after the resuspended thalline of STE buffer of 0.5ml, lysozyme (final concentration 1mg/ml) is added, 37 DEG C of temperature are bathed 15 minutes, add 0.4mL E.C. 3.4.21.64 (5mg/mL, with lysis buffer Fresh), 0.1mL10%SDS, 70 DEG C of water-bath 15mim are put into rapidly, in clarification after mixing.Put cooled on ice, add 0.1mL 5M KAc, cooled on ice 15min.Add the saturated phenol of 0.5mL, mixing, add 0.5mL chloroform, mixing, 12000rpm, 4 DEG C of centrifugal 20min.With the rifle head of cut, aqueous phase sucking-off is placed in new centrifuge tube, adds the dehydrated alcohol of 2 times, mixing, there is the DNA of bulk to occur.It is placed on new centrifuge tube, adds 1mL70% washing with alcohol, liquid is poured out, exhaust with rifle, add 50 μ L TE and dissolve, add RNase A and make final concentration of 50 μ g/mL, 37 DEG C of incubations 0.5 hour.
With these six STb gene converting positive strain as template, it is utilized respectively T7 promoter universal primer (as forward primer) and gene disruption plasmid Homo~logous exchange fragment downstream primer, carries out PCR checking.PCR program: 95 DEG C, 3min；94 DEG C, 1min；55 DEG C, 1min；72 DEG C, 1min (step 2 is to step 4 30 circulation)；Last 72 DEG C, 5min.PCR primer is sent and is carried out sequencing by Mai Pu bio tech ltd, Shanghai, obtains including part plasmid fragments and the purpose band of gene disruption Homo~logous exchange segment composition, shows that gene disruption plasmid, already inserted into genes of interest inside, is interrupted inactivation.
Embodiment 4
Produce 9 Alpha-hydroxy androstenedione with bacterial strain V (i.e. inactivating the Mycobacterium fortuitum engineering bacteria of EJZ16098 gene) the catalysis plant sterol obtained in embodiment 3 and verify.
Adding the kanamycin through filtration sterilization after genetic engineering bacterium all culture fluid sterilizing, final concentration of 50ppm in seed culture medium, is 20ppm in fermentation medium.
Take bacterial strain V (inactivating wherein EJZ16098 gene) and be inoculated in seed culture medium: 20L seed culture medium is positioned in 35L seed tank, access the bacterium (inclined-plane area is about 8cm × 8cm) on a Fructus Solani melongenae bottle inclined-plane.Seed culture medium contains peptone 1%, Carnis Bovis seu Bubali cream 0.3%, NaCl 0.5% (being mass percent), kanamycin 50ppm, and pH is adjusted to 7.0.
Seed culture condition is: temperature 29 ± 1 DEG C, ventilation ratio 1:0.6, rotating speed 480rpm, cultivates 96 hours.
Take cultured seed liquor, be inoculated in fermentation culture by 10% volume ratio, be placed in fermentation (charging 30L) in 50 liters of fermentation tanks, for transformation phytosterin.The pH=8.5 of fermentation culture, and contain: analysis for soybean powder 0.1%, glycerol 1%, Na2HPO40.84%, KH2PO40.45%, NH4Cl 0.2%, MgSO40.03%, kanamycin 20ppm, plant sterol 1%, Tween 80 0.1% (being mass percent).
The condition that microbe conversion is cultivated is: temperature 29 ± 1 DEG C, ventilation ratio 1:0.6, rotating speed 480rpm.
Transformation time takes fermentation liquid for 48,72,96,120,144,168 hours respectively, and extracts by equal-volume ethyl acetate.The content of ethyl acetate middle product mutually is detected, in every milliliter of ethyl acetate (being equivalent to every milliliter of fermentation liquid), as shown in Figure 3 by high performance liquid chromatography.During the different fermentations time, the product amount contrast display that wild-type strain and genetic engineering bacterium are converted into, fermentation time is the highest in 72～144 hourly outputs.After wild-type strain fermentation time was more than 96 hours, in fermentation liquid, the content of 9 Alpha-hydroxy androstenedione continues to decline.
The fermentation liquid equal-volume ethyl acetate taking bacterial strain V after fermenting 96 hours is extracted, content with high performance liquid chromatography detection ethyl acetate middle product mutually, in result such as Fig. 2 (B), the primary product of microbe conversion is 9 Alpha-hydroxy androstenedione (9 α-OH AD), and by-product is mainly 9 Alpha-hydroxy testosterones (d in liquid chromatogram)；9 Alpha-hydroxy androstenedione and 9 Alpha-hydroxy testosterone production ratio are at 8:1 to 12:1.Conversion ratio reaches more than 95%, and the unit consumption producing 9 Alpha-hydroxy androstenedione is 1.8～2.0, and selectivity is 70%～80%.
Wild type Mycobacterium fortuitum (CGMCC No.9657) uses same process conditions to carry out fermenting and detecting product after fermenting 96 hours, in liquid chromatogram such as Fig. 2 (A), the primary product of microbe conversion is 9 Alpha-hydroxy androstenedione (9 α-OH AD), and by-product is mainly 9 Alpha-hydroxy testosterones (d in liquid chromatogram)；9 Alpha-hydroxy androstenedione and 9 Alpha-hydroxy testosterone production ratio are at 3:1 to 5:1.Conversion ratio reaches more than 95%, and the unit consumption producing 9 Alpha-hydroxy androstenedione is 2.2～2.5, and selective conversion rate 50%～60%.
Conversion ratio %=conversion of substrate amount ÷ puts into amount of substrate × 100
Yield %=actual product amount ÷ theoretical product amount × 100
Selectivity %=yield ÷ conversion ratio × 100
Unit consumption=actual product amount ÷ puts into amount of substrate
Above substrate is plant sterol, and product is 9 Alpha-hydroxy androstenedione；Conversion of substrate amount=input amount of substrate-residue amount of substrate；Theoretical product amount=input amount of substrate ÷ substrate molecule amount × molecular weight of product, substrate mean molecule quantity 414, molecular weight of product 302.
The Other Engineering bacterium obtained by embodiment 3 replaces above-mentioned bacterial strains V to ferment, and result is identical.Primary product is 9 Alpha-hydroxy androstenedione, and by-product is mainly 9 Alpha-hydroxy testosterones；Both mol ratios are at 8:1 to 12:1.Conversion ratio reaches more than 95%, and the unit consumption producing 9 Alpha-hydroxy androstenedione is 1.8～2.0, and selectivity is at 70-80%, and effect is superior to wild type Mycobacterium fortuitum.
The unit consumption that the unit consumption that genetic engineering bacterium converts converts than original strain reduces, the amount of the by-product d (9 Alpha-hydroxy testosterone) that the former produces in converting declines more than 50% than the latter, and genetic engineering bacterium converts late-stage products and stablizes, do not have original strain and convert the phenomenon of late-stage products fast degradation.Compared with original strain, genetic engineering bacterium has more preferably performance, uses genetic engineering bacterium to convert and can improve production efficiency.
Claims (13)
1. the construction method of the engineering bacteria of transformation phytosterin, it is characterised in that make wild type convert plant steroid
1,2 dehydrogenase gene inactivations of at least one in the Mycobacterium fortuitum of alcohol.
2. the construction method of the engineering bacteria of transformation phytosterin described in claim 1, it is characterised in that described
The Mycobacterium fortuitum of wild type transformation phytosterin is the bacterial strain of preserving number CGMCC No.9657.
3. the construction method of the engineering bacteria of transformation phytosterin described in claim 1, it is characterised in that described
At least one in following 6 genes: GenBank accession number is EJZ13173, EJZ14467,
EJZ14570, EJZ14836, EJZ16098, EJZ16093 and corresponding nucleotide sequence or homology are 99%
Above nucleotide sequence.
4. the construction method of the engineering bacteria of transformation phytosterin described in claim 3, it is characterised in that described
The nucleotide sequence of 1,2 dehydrogenase genes is as shown in SEQ ID No.1～6.
5. the construction method of the engineering bacteria of transformation phytosterin described in claim 1 or 2, it is characterised in that
1,2 dehydrogenase genes are made to interrupt inactivation by inserting inactivation plasmid.
6. the construction method of the engineering bacteria of transformation phytosterin described in claim 5, it is characterised in that pass through
Following methods makes 1,2 dehydrogenase genes interrupt inactivating:
(1) expand the homeologous sequence of 1,2 dehydrogenase genes and insert inactivation plasmid；
(2) accidental point of the wild type of Plastid transformation preserving number CGMCC No.9657 step (1) obtained
Branch bacillus.
7. the construction method of the engineering bacteria of transformation phytosterin described in claim 5, it is characterised in that described
Homeologous sequence be CGMCC No.9657 with preserving number wild type Mycobacterium fortuitum genomic DNA
For template, expand the fragment or the nucleoside identical with this fragment obtained by the least one set in following group of primer
Acid sequence:
(a) gene EJZ13173 forward primer: 5 '-AAAGAATTCCGGAGATGCTGTCGTTCGTG
Gene EJZ13173 downstream primer: 5 '-AAAAAGCTTCGCCGGATTCCATCCACTT
(b) gene EJZ14467 forward primer: 5 '-AAAGAATTCTCGAAGTTGTCTGCCTTGACTG
Gene EJZ14467 downstream primer: 5 '-AAAAAGCTTCCGCTGGCTGAACCTGATG
(c) gene EJZ14570 forward primer: 5 '-AAAGAATTCGACGGTCTTGCCGGGTTC
Gene EJZ14570 downstream primer: 5 '-AAAAAGCTTCGGACGGTCAGTGAGTGGATT
(d) gene EJZ14836 forward primer: 5 '-AAAGAATTCTGTGCCCAGATCGGAAATGC
Gene EJZ14836 downstream primer: 5 '-AAA AAGCTTTGCCTCGCTTCGGCTCAAC
(e) gene EJZ16098 forward primer: 5 '-AAAGAATTCGACACCGACCTGGTGGAGACA
Gene EJZ16098 downstream primer: 5 '-AAA AAGCTTTTCAACGTGGCGGCAATC
(f) gene EJZ16093 forward primer: 5 '-AAAGAATTCAGGGTCGGCTGCTTCTG
Gene EJZ16093 downstream primer: 5 '-AAAAAGCTT TTCTCACTTCGGCGGTTC.
8. the engineering bacteria of a transformation phytosterin, it is characterised in that for Mycobacterium fortuitum, pass through right
Require that the method described in 1～7 builds.
9. the Mycobacterium fortuitum described in claim 8 is used for being catalyzed plant sterol to be converted into 9 Alpha-hydroxies male
Alkene diketone.
10. the method preparing 9 Alpha-hydroxy androstenedione, it is characterised in that be initial with plant sterol
Raw material, generates 9 Alpha-hydroxy androstenes two with the Mycobacterium fortuitum fermentation catalysis plant sterol described in claim 1
Ketone.
The method preparing 9 Alpha-hydroxy androstenedione described in 11. claim 10, it is characterised in that fermentation bar
Part is: be inoculated in the fermentation culture containing plant sterol by the engineering bacteria described in claim 8,25～
It is passed through air at 34 DEG C and stirs；The microbe conversion time is 48～168 hours.
The method preparing 9 Alpha-hydroxy androstenedione described in 12. claim 11, it is characterised in that by engineering
Bacterium is inoculated in seed culture fluid or seed culture medium, is passed through air and stirs at 25～34 DEG C, cultivates 48～120
Fermentation culture it is inoculated in after hour.
The method preparing 9 Alpha-hydroxy androstenedione described in 13. claim 11, it is characterised in that fermentation turns
The change time is 84～120 hours or 136～168 hours.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510016289.0A CN105838730A (en) | 2015-01-13 | 2015-01-13 | Engineered bacteria for phytosterol conversion and construction method and application of engineered bacteria |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510016289.0A CN105838730A (en) | 2015-01-13 | 2015-01-13 | Engineered bacteria for phytosterol conversion and construction method and application of engineered bacteria |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105838730A true CN105838730A (en) | 2016-08-10 |
Family
ID=57177996
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510016289.0A Withdrawn CN105838730A (en) | 2015-01-13 | 2015-01-13 | Engineered bacteria for phytosterol conversion and construction method and application of engineered bacteria |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105838730A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108587997A (en) * | 2018-05-11 | 2018-09-28 | 江南大学 | A method of producing 9-OH-AD using recombination Corynebacterium glutamicum resting cell |
| CN109652338A (en) * | 2019-01-24 | 2019-04-19 | 天津科技大学 | The mycobacterium fortutitum of 9 α-OH-AD of high yield and its application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101565710A (en) * | 2009-05-20 | 2009-10-28 | 华东理工大学 | 3-sterone-Delta[1]-dehydrogenase gene, relevant carriers, engineering strains and applications thereof |
-
2015
- 2015-01-13 CN CN201510016289.0A patent/CN105838730A/en not_active Withdrawn
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101565710A (en) * | 2009-05-20 | 2009-10-28 | 华东理工大学 | 3-sterone-Delta[1]-dehydrogenase gene, relevant carriers, engineering strains and applications thereof |
Non-Patent Citations (2)
| Title |
|---|
| KANG YAO 等: ""Characterization and engineering of 3-ketosteroid-△1-dehydrogenase and 3-ketosteroid-9α-hydroxylase in Mycobacterium neoaurum ATCC 25795 to produce 9α-hydroxy-4-androstene-3,17-dione through the catabolism of sterols "", 《METABOLIC ENGINEERING》 * |
| 姚抗: ""分枝杆菌甾醇代谢机制的解析以及其代谢工程改造应用于制备重要甾药中间体的研究"", 《中国博士学位论文数据库（电子期刊）工程科技Ⅰ辑》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108587997A (en) * | 2018-05-11 | 2018-09-28 | 江南大学 | A method of producing 9-OH-AD using recombination Corynebacterium glutamicum resting cell |
| CN108587997B (en) * | 2018-05-11 | 2021-03-02 | 江南大学 | Method for producing 9-OH-AD by utilizing whole cell transformation of recombinant corynebacterium glutamicum |
| CN109652338A (en) * | 2019-01-24 | 2019-04-19 | 天津科技大学 | The mycobacterium fortutitum of 9 α-OH-AD of high yield and its application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102421890B (en) | For the production of recombinant bacteria and the application thereof of ethanol | |
| CN104232722B (en) | The method that microbial fermentation produces 9 Alpha-hydroxy androstenedione | |
| CN111518806B (en) | Acetobacter pasteurianus promoter and application thereof | |
| CN109706107B (en) | Method for producing steroid precursor by high-efficiency fermentation | |
| CN108753669A (en) | A kind of adenine production bacterial strain and its construction method and application | |
| CN105420154A (en) | Double knockout recombinant rhodococcus as well as construction method and application thereof | |
| CN101974441A (en) | Alpha-glucosidase genetic engineering bacterium and application thereof | |
| CN111484962B (en) | Genetic engineering bacterium for efficiently producing 5 alpha-androstane dione and application thereof | |
| CN105838730A (en) | Engineered bacteria for phytosterol conversion and construction method and application of engineered bacteria | |
| CN111500479B (en) | Construction and application of non-methanol-induced dual-promoter pichia pastoris engineering bacteria | |
| CN105483034A (en) | Saccharomyces cerevisiae mating type conversion method | |
| CN103555646B (en) | Genetic engineering bacterium for co-expressing L-arabinose isomerase gene and mannose-6-phosphate isomerase | |
| CN116064352A (en) | Construction method and application of Klebsiella engineering bacteria for high yield of 1, 3-propanediol | |
| CN105349441A (en) | Trichoderma sp T23-Ovell bacterial strain high in spore yield, and construction method thereof | |
| CN105838633A (en) | Mycobacterium foruitum and application thereof | |
| JP4927297B2 (en) | Method for producing ethanol using recombinant coryneform bacteria | |
| CN111394396B (en) | Method for producing 1, 3-propylene glycol by using glycerol fermentation by microorganisms | |
| CN108949760B (en) | Composite promoter and application thereof in increasing yield of 3-hydroxypropionic acid of klebsiella pneumoniae | |
| CN101892228B (en) | Engineering bacteria with high tolerance to acrylamide and acrylonitrile for producing nitrile hydratase and application thereof | |
| CN107083375B (en) | Medium-temperature alpha-amylase and gene and application thereof | |
| CN109370972A (en) | A kind of acetobacter engineering bacteria and its application | |
| CN101792779B (en) | Method for producing isoflavones by fermenting lactic acid galactococcus engineering bacteria | |
| CN110713940B (en) | High-yield heavy oil aureobasidium pullulans strain and construction method and application thereof | |
| CN115011626B (en) | Genetically engineered bacterium for producing steroid drug precursor and application thereof | |
| CN115851795B (en) | High-yield plasmid, construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20160810 |
|
| WW01 | Invention patent application withdrawn after publication |