CN116397025A - Primer probe, kit and detection method for methylation detection of cervical cancer - Google Patents
Primer probe, kit and detection method for methylation detection of cervical cancer Download PDFInfo
- Publication number
- CN116397025A CN116397025A CN202211410411.9A CN202211410411A CN116397025A CN 116397025 A CN116397025 A CN 116397025A CN 202211410411 A CN202211410411 A CN 202211410411A CN 116397025 A CN116397025 A CN 116397025A
- Authority
- CN
- China
- Prior art keywords
- dapk2
- probe
- cadm2
- primer
- actin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 239000000523 sample Substances 0.000 title claims abstract description 116
- 206010008342 Cervix carcinoma Diseases 0.000 title claims abstract description 53
- 208000006105 Uterine Cervical Neoplasms Diseases 0.000 title claims abstract description 53
- 201000010881 cervical cancer Diseases 0.000 title claims abstract description 53
- 238000001514 detection method Methods 0.000 title claims abstract description 36
- 230000011987 methylation Effects 0.000 title claims abstract description 35
- 238000007069 methylation reaction Methods 0.000 title claims abstract description 35
- 101000760622 Homo sapiens Cell adhesion molecule 2 Proteins 0.000 claims abstract description 72
- 102000005721 Death-Associated Protein Kinases Human genes 0.000 claims abstract description 57
- 108010031042 Death-Associated Protein Kinases Proteins 0.000 claims abstract description 57
- 108020004414 DNA Proteins 0.000 claims abstract description 49
- 102100024646 Cell adhesion molecule 2 Human genes 0.000 claims abstract description 48
- 238000000034 method Methods 0.000 claims abstract description 17
- 108091028043 Nucleic acid sequence Proteins 0.000 claims abstract description 7
- 108010085238 Actins Proteins 0.000 claims description 62
- 102000007469 Actins Human genes 0.000 claims description 62
- 238000006243 chemical reaction Methods 0.000 claims description 54
- 101100276971 Homo sapiens DAPK2 gene Proteins 0.000 claims description 27
- 108090000623 proteins and genes Proteins 0.000 claims description 19
- 230000003321 amplification Effects 0.000 claims description 14
- 239000000872 buffer Substances 0.000 claims description 14
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 14
- 102000004190 Enzymes Human genes 0.000 claims description 13
- 108090000790 Enzymes Proteins 0.000 claims description 13
- 238000012408 PCR amplification Methods 0.000 claims description 13
- 238000001917 fluorescence detection Methods 0.000 claims description 12
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 8
- 239000013642 negative control Substances 0.000 claims description 7
- 239000013641 positive control Substances 0.000 claims description 7
- 230000009466 transformation Effects 0.000 claims description 7
- 238000005070 sampling Methods 0.000 claims description 6
- LSNNMFCWUKXFEE-UHFFFAOYSA-M Bisulfite Chemical compound OS([O-])=O LSNNMFCWUKXFEE-UHFFFAOYSA-M 0.000 claims description 5
- 238000002474 experimental method Methods 0.000 claims description 5
- 239000003112 inhibitor Substances 0.000 claims description 5
- 102220002645 rs104894309 Human genes 0.000 claims description 4
- 230000035945 sensitivity Effects 0.000 abstract description 6
- 239000000243 solution Substances 0.000 description 13
- 239000007788 liquid Substances 0.000 description 8
- 239000002699 waste material Substances 0.000 description 7
- 238000001179 sorption measurement Methods 0.000 description 6
- 241000701806 Human papillomavirus Species 0.000 description 5
- LSNNMFCWUKXFEE-UHFFFAOYSA-N Sulfurous acid Chemical compound OS(O)=O LSNNMFCWUKXFEE-UHFFFAOYSA-N 0.000 description 5
- 230000003902 lesion Effects 0.000 description 5
- 238000000605 extraction Methods 0.000 description 4
- 230000008569 process Effects 0.000 description 4
- 238000000746 purification Methods 0.000 description 4
- 238000012216 screening Methods 0.000 description 4
- 206010008263 Cervical dysplasia Diseases 0.000 description 3
- 108700039887 Essential Genes Proteins 0.000 description 3
- 201000011510 cancer Diseases 0.000 description 3
- 208000007951 cervical intraepithelial neoplasia Diseases 0.000 description 3
- 230000002380 cytological effect Effects 0.000 description 3
- 239000000203 mixture Substances 0.000 description 3
- 238000007400 DNA extraction Methods 0.000 description 2
- 230000007067 DNA methylation Effects 0.000 description 2
- WSFSSNUMVMOOMR-UHFFFAOYSA-N Formaldehyde Chemical compound O=C WSFSSNUMVMOOMR-UHFFFAOYSA-N 0.000 description 2
- 101000613575 Homo sapiens Paired box protein Pax-1 Proteins 0.000 description 2
- 206010028980 Neoplasm Diseases 0.000 description 2
- 102100040851 Paired box protein Pax-1 Human genes 0.000 description 2
- 241000700605 Viruses Species 0.000 description 2
- 238000004458 analytical method Methods 0.000 description 2
- 239000012295 chemical reaction liquid Substances 0.000 description 2
- 239000003153 chemical reaction reagent Substances 0.000 description 2
- 238000007796 conventional method Methods 0.000 description 2
- 238000005516 engineering process Methods 0.000 description 2
- 238000002156 mixing Methods 0.000 description 2
- 239000002773 nucleotide Substances 0.000 description 2
- 125000003729 nucleotide group Chemical group 0.000 description 2
- 230000036285 pathological change Effects 0.000 description 2
- 231100000915 pathological change Toxicity 0.000 description 2
- 238000003908 quality control method Methods 0.000 description 2
- 238000010791 quenching Methods 0.000 description 2
- 230000000171 quenching effect Effects 0.000 description 2
- 239000006228 supernatant Substances 0.000 description 2
- 238000012360 testing method Methods 0.000 description 2
- 210000001519 tissue Anatomy 0.000 description 2
- 239000011534 wash buffer Substances 0.000 description 2
- 101150061050 CIN1 gene Proteins 0.000 description 1
- 101150070189 CIN3 gene Proteins 0.000 description 1
- 108091029523 CpG island Proteins 0.000 description 1
- 108091029430 CpG site Proteins 0.000 description 1
- 230000004544 DNA amplification Effects 0.000 description 1
- 108010067770 Endopeptidase K Proteins 0.000 description 1
- 241001293164 Eutrema japonicum Species 0.000 description 1
- 108020002230 Pancreatic Ribonuclease Proteins 0.000 description 1
- 102000005891 Pancreatic ribonuclease Human genes 0.000 description 1
- 235000000760 Wasabia japonica Nutrition 0.000 description 1
- 238000010521 absorption reaction Methods 0.000 description 1
- 239000012148 binding buffer Substances 0.000 description 1
- 239000012620 biological material Substances 0.000 description 1
- 230000033228 biological regulation Effects 0.000 description 1
- 239000012472 biological sample Substances 0.000 description 1
- 230000008859 change Effects 0.000 description 1
- 101150005988 cin2 gene Proteins 0.000 description 1
- 239000012084 conversion product Substances 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000003745 diagnosis Methods 0.000 description 1
- 238000004090 dissolution Methods 0.000 description 1
- 238000013399 early diagnosis Methods 0.000 description 1
- 230000012010 growth Effects 0.000 description 1
- 208000020082 intraepithelial neoplasia Diseases 0.000 description 1
- 230000007774 longterm Effects 0.000 description 1
- 125000002496 methyl group Chemical group [H]C([H])([H])* 0.000 description 1
- 230000004660 morphological change Effects 0.000 description 1
- 239000012188 paraffin wax Substances 0.000 description 1
- 230000007170 pathology Effects 0.000 description 1
- 239000008188 pellet Substances 0.000 description 1
- 239000000843 powder Substances 0.000 description 1
- 238000002360 preparation method Methods 0.000 description 1
- 238000004321 preservation Methods 0.000 description 1
- 210000002307 prostate Anatomy 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 238000007790 scraping Methods 0.000 description 1
- 230000001568 sexual effect Effects 0.000 description 1
- 239000007787 solid Substances 0.000 description 1
- 238000010186 staining Methods 0.000 description 1
- 238000007619 statistical method Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention relates to a primer and probe combination for cervical cancer methylation detection, a kit and a using method thereof. The primer and the probe are used for detecting DAPK2 and CADM2 gene combinations; the primer probe combination comprises a DAPK2 forward primer F, DAPK2 reverse primer R, DAPK2 probe P, CADM2 forward primer F, CADM2 reverse primer R, CADM2 probe P; the nucleotide sequences of the nucleotide sequences are respectively shown in SEQ ID NO: 1-SEQ ID NO: shown at 6. The primer probe combination adopted by the invention has the advantages of high sensitivity and high specificity, and can accurately and stably detect samples with the concentration as low as 1 ng/mu L and the methylation rate of 6.67 percent; and the probe has single base resolution, and can specifically distinguish methylated and unmethylated DNA.
Description
Technical Field
The invention relates to the technical field of tumor gene detection, in particular to a primer probe, a kit and a detection method for methylation detection of cervical cancer.
Background
Cervical cancer is always the prostate of gynaecological malignant tumors, one of the most common malignant tumors in women. Most cervical cancer is caused by a virus called Human Papillomavirus (HPV) which is transmitted by sexual contact with the person who already carries the virus, but not all types of HPV cause cervical cancer.
At present, cervical cancer is mainly detected and screened, and according to a screening strategy of cervical cancer, problems are found when precancerous lesions are found when cervical cancer does not develop yet, and then early diagnosis and treatment of cervical cancer and precancerous lesions are carried out, so that the incidence rate and death rate of cervical cancer are reduced. The cervical cancer screening technology adopts cytological screening at the earliest, and can effectively find early cervical cancer. The cytological examination uses cervical scraping plate or cervical brush to collect cervical exfoliated cells, and its accuracy is greatly affected by the factors of sampling, smearing, staining and reading. Cytologic techniques are based on morphological changes of cervical cells with a high degree of level dependence on gynaecological or cytopathologists. In addition, HPVDNA detection is a molecular diagnosis technology, has the advantages of objectivity, reliability, easiness in repetition, capability of obtaining results in a short time and the like, and improves screening efficiency. However, HPV detection has low specificity (high false positives) and is prone to excessive treatment wasting money and causing panic. Cervical cancer methylation is a direct detection of the state of cancer cells, and can effectively detect whether cervical cells of a subject are normal or not, and whether the cervical cells progress to precancerous lesions or cervical cancer can be found earlier than in traditional cytological examination and HPV typing detection.
Disclosure of Invention
The invention aims to solve the defects of the prior art and provides a primer probe combination, a kit and a detection method for methylation detection of cervical cancer, wherein the kit has the advantages of high detection sensitivity and good specificity.
In order to achieve the above object, a primer and probe combination for cervical cancer methylation detection is designed, wherein the primer and the probe are used for detecting gene combinations of DAPK2 and CADM 2; the primer and probe combinations include DAPK2 forward primer F, DAPK2 reverse primer R, DAPK2 probe P, CADM2 forward primer F, CADM2 reverse primer R and CADM2 probe P; the nucleotide sequences of the DAPK2 forward primer F, DAPK2 reverse primer R, DAPK2 probe P, CADM2 forward primer F, CADM2 reverse primer R and the CADM2 probe P are respectively shown in SEQ ID NO: 1-SEQ ID NO: shown at 6.
Preferably: the 5' ends of the DAPK2 probe P and the CADM2 probe P are marked by FAM; the 3' ends of the DAPK2 probe P and the CADM2 probe P are marked by BHQ 1.
The invention also provides a kit for methylation detection of cervical cancer, which is characterized by comprising the primer and probe combination of claim 1 or 2, a beta-actin forward primer F, a beta-actin reverse primer R and a beta-actin probe P; the nucleotide sequences of the beta-actin forward primer F, the beta-actin reverse primer R and the beta-actin probe P are shown in SEQ ID NO: 7-SEQ ID NO: shown at 9.
Preferably: the 5' end of the beta-actin probe P adopts VIC marking; the 3' -end of the beta-actin probe P is marked by BHQ 1.
Preferably: the kit also comprises 10 XPCR Buffer, taq enzyme, dNTPs, nuclease-free water, positive control and negative control.
Preferably: the positive control comprises DNA from cervical cancer cell line HELA; the negative control included DNA from cervical cancer cell line C33A.
The invention also provides a detection method of the kit, which comprises the following steps:
s1, extracting DNA of a sample to be detected;
s2, carrying out bisulfite conversion treatment on the DNA of the sample to be detected to obtain converted DNA;
s3, carrying out PCR amplification reaction by using the converted DNA as a template and utilizing the primer and probe combination as shown in the claims 1-4 to obtain a fluorescence detection result;
s4, the fluorescence detection result, wherein the threshold value of FAM is set to 8000, and the threshold value of VIC is set to 12000;
s5, judging a sample to be detected by using the fluorescence detection result; when the beta actin Ct is less than or equal to 34, judging the results of each gene according to the delta Ct values of the DAPK2 gene, the CADM2 gene and the beta actin; the DAPK2 gene delta Ct is more than 5, the DAPK2 gene is negative, the DAPK2 gene delta Ct is less than or equal to 5, and the DAPK2 gene is positive; CADM2 gene is negative when delta Ct is more than 8, and CADM2 gene is positive when delta Ct is less than or equal to 8; if any gene of the DAPK2 and the CADM2 is positive, judging that the sample is positive for cervical cancer methylation, and if the DAPK2 and the CADM2 genes are detected to be negative at the same time, judging that the sample is negative for cervical cancer methylation; when beta actin Ct is more than 34, judging that the sample is insufficient or the inhibitor exists, and the PCR reaction is invalid, and repeating the experiment or sampling; the Δct=fam Ct-VIC Ct.
Preferably: the reaction system used in the PCR amplification reaction in the step S3 comprises a DAPK2 amplification system and a CADM2 amplification system; the DAPK2 amplification system comprises: DAPK2 PCR reaction solution 18.8 mu L, taq enzyme 0.2 mu L and DNA 1 mu L after transformation; the DAPK2 PCR reaction solution comprises the following components in concentration: 1 XPCR Buffer, 0.25mM dNTP, 0.4. Mu.M DAPK2 forward primer F, 0.4. Mu.M DAPK2 reverse primer R, 0.2. Mu.M DAPK2 probe P, 0.4. Mu.M beta-actin forward primer F, 0.4. Mu.M beta-actin reverse primer R, and 0.2. Mu.M beta-actin probe P; the CADM2 amplification system comprises: CADM2 PCR reaction solution 18.8. Mu. L, taq enzyme 0.2. Mu.L and converted DNA 1. Mu.L; the CADM2 PCR reaction solution comprises the following components in concentration: 1 XPCR Buffer, 0.25mM dNTP, 0.4. Mu.M CADM2 forward primer F, 0.4. Mu.M CADM2 reverse primer R, 0.2. Mu.M CADM2 probe P, 0.4. Mu.M beta-actin forward primer F, 0.4. Mu.M beta-actin reverse primer R, and 0.2. Mu.M beta-actin probe P.
Preferably: the specific conditions of the PCR amplification reaction in the step S3 are that the reaction is firstly carried out for 5min at the temperature of 95 ℃; then reacted at 95℃for 10S and 60℃for 30S, respectively, and cycled 40 times, the fluorescence being collected during the reaction at 60℃for 30S.
Compared with the prior art, the invention has the advantages that:
1. the DAPK2 gene and the CADM2 gene selected by the invention are closely related to cervical cancer progress, and the detection probes of each target gene are aimed at a plurality of CpG sites of a core regulation area, so that the randomness of base change is reduced relative to the detection of single base;
2. the invention also provides a primer and probe combination for cervical cancer methylation detection, and the probe adopted by the invention has the advantages of high sensitivity and high specificity, and can accurately and stably detect the methylation rate as low as 1 ng/mu L and 6.67 percent; the probe has single base resolution, and can specifically distinguish methylated DNA and unmethylated DNA;
3. according to the kit disclosed by the invention, the housekeeping gene beta-actin is used as an internal reference gene for quality control of a sample, and the possible methylation condition of the housekeeping gene is considered, so that the area of a CpG island is not selected when an internal reference primer probe is designed, and the requirement of controlling the quality of the sample can be met by the housekeeping gene beta-actin. Moreover, because the occurrence of cervical cancer is a multi-inducement and multi-step process, methylation degrees of the 2 genes of different individuals in the progress process of cervical cancer are obviously different, the invention adopts two-gene combined detection to comprehensively evaluate samples, and has higher sensitivity and specificity compared with single-gene detection. In addition, the whole detection flow of the kit can be completed within 2 hours. The method has the characteristics of simple, quick and sensitive operation, and is suitable for clinical detection;
4. the invention can specifically detect high-grade cervical intraepithelial neoplasia and above pathological change samples, and when the methylation detection result of any gene of DAPK2 or CADM2 is positive, the samples are indicated to have the risk of high-grade cervical intraepithelial neoplasia and above pathological change. The sensitivity of the primer probe combination for detecting the high-level cervical intraepithelial neoplasia and lesions above is 73.24%, the specificity is 77.05%, and the accuracy is 75.21%.
Drawings
FIG. 1 is a methylation PCR amplification curve of a typical cervical cancer shed cell sample;
FIG. 2 is a methylation PCR amplification curve of a typical normal cervical exfoliated cell sample.
Detailed Description
Example 1
In the present invention, the Primer and probe set was designed based on the human whole genome sequence disclosed in NCBI (national center for Biotechnology information), and was synthesized by Shanghai Biotechnology Co., ltd using Methyl Primer press v 1.0.0 and Primer premier5.0 software.
In the invention, the nucleotide sequence of the target gene amplified by the DAPK2 is shown as SEQ ID NO:10, specifically:
GGGCGTTTCGAGTTTCGTTTCGGGTAGTCGGGCGCGTTTTTAGTCGGCGTTTGGGACGGGGTTGGTCGTTTCGTTTTTTCGGTTTTTAGGTTGTTCGGCGGGCGGGTGTCGGGCGTTTTGGGAGGAGAGGATTGTAGGGTCGAG
the nucleotide sequence of the target gene amplified by CADM2 is shown as SEQ ID NO:11, specifically:
CGTTGTCGTTTTTGTTGTCGTCGATTCGAGTTCGCGGGTTCGAATATCGTAGCGGTGGGGACGGTGGGTTCGGCGGGCGTCGGGAGGAGGATATTAGCGGAGTTTTGTATTTTCGTGTTTCGTTTATTAGTATTTATTTGTTTTTTCGTTTTTTTTTTAGTTTTTTAGAGAAGGGATTATGATTTGGAAACG
in the invention, FAM marks are preferably adopted as luminous groups at the 5' ends of the DAPK2 probe P and the CADM2 probe P; the 3' -end of the DAPK2 probe P and the CADM2 probe P preferably use BHQ1 labels as the quenching groups.
The invention also provides a kit for methylation detection of cervical cancer, which comprises the primer and probe combination, the beta-actin forward primer F, the beta-actin reverse primer R and the beta-actin probe P; the nucleotide sequences of the beta-actin forward primer F, the beta-actin reverse primer R and the beta-actin probe P are shown in SEQ ID NO: 7-SEQ ID NO:9, specifically as follows: beta actin forward primer F: TGGTGATGGAGGAGGTTTAGTAAGT; beta actin reverse primer R: AACCAATAAAACCTACTCCTCCCTTAA; beta actin probe P: ACCACCACCCAACACACAATAACA;
in the invention, the 5' end of the beta actin probe P adopts VIC mark as a luminous group; the 3' -end of the beta-actin probe P preferably adopts BHQ1 mark as a quenching group.
In the invention, the kit also comprises 10 XPCR Buffer, taq enzyme, dNTPs, nuclease-free water, positive control and negative control; the positive control preferably comprises DNA from cervical cancer cell line HELA (wherein the methylation rate of DAPK2 gene and CADM2 gene is 100%); the negative control preferably includes DNA from cervical cancer cell line C33A, wherein the methylation rates of the DAPK2 gene and the CADM2 gene are 0%.
In the present invention, the nuclease-free water, 10 XPCR Buffer, taq enzyme and dNTPs are preferably purchased from Takara Shuzo Co., ltd; the enzyme is preferably
HS Taq enzyme.
The invention also provides a detection method of the kit, which comprises the following steps:
s1, extracting DNA of a sample to be detected;
s2, carrying out bisulfite conversion treatment on the DNA of the sample to be detected to obtain converted DNA;
s3, carrying out PCR amplification reaction by using the converted DNA as a template and utilizing the primer and probe combination as shown in the claims 1-4 to obtain a fluorescence detection result;
s4, the fluorescence detection result, wherein the threshold value of FAM is set to 8000, and the threshold value of VIC is set to 12000;
s5, judging a sample to be detected by using the fluorescence detection result; when the beta actin Ct is less than or equal to 34, judging the results of each gene according to the delta Ct values of the DAPK2 gene, the CADM2 gene and the beta actin; the DAPK2 gene delta Ct is more than 5, the DAPK2 gene is negative, the DAPK2 gene delta Ct is less than or equal to 5, and the DAPK2 gene is positive; CADM2 gene is negative when delta Ct is more than 8, and CADM2 gene is positive when delta Ct is less than or equal to 8; if any gene of the DAPK2 and the CADM2 is positive, judging that the sample is positive for cervical cancer methylation, and if the DAPK2 and the CADM2 genes are detected to be negative at the same time, judging that the sample is negative for cervical cancer methylation; when beta actin Ct is more than 34, judging that the sample is insufficient or the inhibitor exists, and the PCR reaction is invalid, and repeating the experiment or sampling; the Δct=fam Ct-VIC Ct.
Firstly, extracting DNA of a sample to be detected; the sample to be tested comprises cervical exfoliated cells, tissue samples and FFPE (formalin fixed paraffin embedded tissue); the sample to be tested is preferably from the Zhejiang Putuo hospital pathology department; the method for extracting the DNA of the sample to be detected is not particularly limited, and the method can be carried out by adopting a conventional method in the field, and the extraction of the genomic DNA of the company Aishi biotechnology (Hangzhou) is preferably carried out in the specific implementation process of the invention.
After obtaining a sample DNA to be detected, the invention carries out bisulfite conversion treatment on the sample DNA to be detected to obtain converted DNA; the method for carrying out the bisulfite conversion treatment on the DNA of the sample to be detected is not particularly limited, and the method can be carried out by adopting a conventional method in the field, and a EZ DNA Methylation TM Kits conversion kit provided by ZYMO RESEARCH is preferably adopted for treatment in the specific implementation process of the invention.
After the converted DNA is obtained, the invention uses the converted DNA as a template, and uses the primer and probe combination in the scheme to carry out PCR amplification reaction to obtain a fluorescence detection result; the reaction system used in the PCR amplification reaction comprises a DAPK2 amplification system and a CADM2 amplification system.
The DAPK2 amplification system comprises: DAPK2 PCR reaction solution 18.8 mu L, taq enzyme 0.2 mu L and DNA 1 mu L after transformation; the DAPK2 PCR reaction solution comprises the following components in concentration: 1 XPCR Buffer, 0.25mM dNTP, 0.4. Mu.M DAPK2 forward primer F, 0.4. Mu.M DAPK2 reverse primer R, 0.2. Mu.M PAX1 probe P, 0.4. Mu.M beta-actin forward primer F, 0.4. Mu.M beta-actin reverse primer R and 0.2. Mu.M beta-actin probe P.
The CADM2 amplification system comprises: CADM2 PCR reaction solution 18.8. Mu. L, taq enzyme 0.2. Mu.L and converted DNA 1. Mu.L; the CADM2 PCR reaction solution comprises the following components in concentration: 1 XPCR Buffer, 0.25mM dNTP, 0.4. Mu.M CADM2 forward primer F, 0.4. Mu.M CADM2 reverse primer R, 0.2. Mu.M PAX1 probe P, 0.4. Mu.M beta-actin forward primer F, 0.4. Mu.M beta-actin reverse primer R, and 0.2. Mu.M beta-actin probe P.
The specific conditions of the PCR amplification reaction are that the PCR amplification reaction is firstly carried out for 5min at 95 ℃; then reacted at 95℃for 10S and 60℃for 30S, respectively, and cycled 40 times, the fluorescence being collected during the reaction at 60℃for 30S.
After the fluorescence detection result is obtained, the invention judges the sample to be detected according to the fluorescence detection result, and judges the results of all genes according to the delta Ct values of DAPK2, CADM2 genes and beta-actin when the beta-actin Ct is less than or equal to 34. When the delta Ct of the DAPK2 gene is more than 5, the DAPK2 gene is negative, and when the delta Ct of the DAPK2 gene is less than or equal to 5, the DAPK2 gene is positive; CADM2 gene is negative when delta Ct is more than 8, and CADM2 gene is positive when delta Ct is less than or equal to 8; if any gene of the DAPK2 and the CADM2 is positive, judging that the sample is positive for cervical cancer methylation, and if the DAPK2 and the CADM2 genes are detected to be negative at the same time, judging that the sample is negative for cervical cancer methylation; when beta actin Ct is more than 34, the insufficient sample or the existence of inhibitor is judged, the PCR reaction is invalid, and the experiment or sampling is required to be repeated.
Example 2
The embodiment refers to the application of the kit in diagnosing cervical cancer of human.
In the invention, nuclease-free water, 10 XPCR Buffer, taq enzyme and dNTPs are preferably purchased from Bao-organisms; positive control was DNA from cervical cancer cell line HELA, negative control was DNA from cervical cancer cell line C33A.
The DAN extraction kit is a genomic DNA extraction kit from Aishi biotechnology (Hangzhou) Co., ltd; the transformation kit was a EZ DNA Methylation TM Kits transformation kit from ZYMO reserve. The biological materials adopted by the invention are all from the medical department of Zhejiang Putuo Hospital.
The specific method comprises the following steps:
1. biological sample
Cervical exfoliated cells of 159 cervical cancer patients, 138 CIN3 lesion patients, 154 CIN2 and CIN1 patients and 166 normal groups of cervical exfoliated cells are diagnosed in Zhejiang Putuo Hospital in the period of 1 month 2019-2022 month 6.
2. Extraction of cervical exfoliated cell DNA
The following DAN extraction was performed using the genomic DNA extraction kit from Aishi Biotechnology (Hangzhou).
1) The collection tube with the cervical exfoliated cells collected is fully vibrated for 1min.
2) A sterile 2mL EP tube was taken, 1.5mL of the well-shaken sample was added, 12000Xg was centrifuged for 1.5min, the supernatant was discarded, and only the bottom pellet was left.
3) Repeating the step 2) until the samples in the collecting tube are completely processed.
4) 350. Mu.L of PBS and 0.8. Mu.L of RNase A were added, the cells were suspended, and the cells were briefly centrifuged.
5) 150. Mu.L of Buffer C-L and 8. Mu.L of proteinase K were added in sequence, vortexed for 15s, centrifuged briefly and then in a water bath at 56℃for 10min.
6) 350. Mu.L Buffer P-D was added, vortexed for 15s, and then centrifuged at 12000Xg for 10min.
7) The adsorption column is inserted into a collecting pipe, and the supernatant obtained in the last step is transferred into the adsorption column, and is centrifuged for 1min at 12000 Xg.
8) Discarding the waste liquid in the collecting pipe, and putting the adsorption column into the collecting pipe again; add 500. Mu.L Buffer W1 and centrifuge at 12000Xg for 1min.
9) The waste liquid in the collection tube was discarded, and 700. Mu.L Buffer W2 was added thereto, and the mixture was centrifuged at 12000Xg for 1min.
10 Repeating step 9) once.
11 Discarding the waste liquid in the collecting pipe, inserting the adsorption column into the collecting pipe, and centrifuging at 12000xg for 1min.
12 Inserting the adsorption column into a new EP tube, adding 100-200 μl of DNA dissolving solution (preheating at 65deg.C can improve DNA yield), and standing at room temperature for 2min.
13 Centrifuging at 12000Xg for 1min, discarding the adsorption column, collecting the liquid in the EP tube as DNA solution, and preserving at 2-8deg.C, or at-20deg.C or lower if long-term preservation is required.
3. DNA transformation step
1. The extracted DNA is configured into a sulfite conversion system:
the extracted DNA was configured according to the transformation system of table 1:
preparing a conversion reaction liquid: CT Conversion Reagent provided in the kit is a solid powder that needs to be dissolved prior to first use. 900. Mu.L of water, 50. Mu. L M-Dissolving Buffer, and 300. Mu. L M-division Buffer were added to CT Conversion Reagent during dissolution. Dissolving at room temperature, shaking for 10min, and mixing thoroughly. The unused conversion reaction solution was kept at-20℃for no more than one week.
TABLE 1 sulfite conversion System
| Composition of the components | Volume of |
| DNA to be transformed | 1-20μL(500ng-2μg DNA) |
| Conversion reaction liquid | 130μL |
| Rnase-free water | Make up 150. Mu.L |
| Total (S) | 150μL |
2. Sulfite conversion procedure, see Table 2
TABLE 2 sulfite conversion run procedure
| Reaction temperature | Time |
| 98℃ | 10min |
| 64℃ | 2.5h |
| 4℃ | ≤20h |
3. Purification of DNA after sulfite conversion
1) Adding 600 mu L M-Binding Buffer into the purification column, transferring the conversion product into the purification column, and reversing and uniformly mixing for several times;
2) Centrifuging at 10000rpm for 30s, and discarding the waste liquid;
3) Adding 200 mu L of Wash Buffer, centrifuging at 10000rpm for 30s, and discarding the waste liquid;
4) Adding 200 mu L Desulphonation Buffer, standing at room temperature for 15min, centrifuging at 10000rpm for 30s, and discarding the waste liquid;
5) Adding 200 mu L of Wash Buffer, centrifuging at 10000rpm for 30s, and discarding the waste liquid;
6) Repeating step 5);
7) The purification column was inserted into a new EP tube, 20. Mu.L of an absorption Buffer was added, and the mixture was allowed to stand at room temperature for 1min;
8) Centrifuging at 10000rpm for 1min, collecting effluent to obtain converted DNA solution, and storing at-20deg.C.
4. PCR flow
1. The PCR instrument used was ABI 7500, and the reaction system was 20. Mu.L;
2. the preparation of the PCR reaction system and the conditions are shown in the following tables 3 and 4:
TABLE 3 reaction system
TABLE 4 PCR reaction conditions
5. Analysis of results
The threshold FAM is 8000 and VIC is 12000, and Δct=fam Ct-VIC Ct.
And the detection result of the kit meets the quality control requirement, and the sample is judged according to the detection result. When the beta actin Ct is less than or equal to 34, judging the results of each gene according to the delta Ct values of the DAPK2 gene, the CADM2 gene and the beta actin; the DAPK2 gene delta Ct is more than 5, the DAPK2 gene is negative, the DAPK2 gene delta Ct is less than or equal to 5, and the DAPK2 gene is positive; CADM2 gene is negative when delta Ct is more than 8, and CADM2 gene is positive when delta Ct is less than or equal to 8; if any gene of the DAPK2 and the CADM2 is positive, judging that the sample is positive for cervical cancer methylation, and if the DAPK2 and the CADM2 genes are detected to be negative at the same time, judging that the sample is negative for cervical cancer methylation; when beta actin Ct is more than 34, the insufficient sample or the existence of inhibitor is judged, the PCR reaction is invalid, and the experiment or sampling is required to be repeated.
TABLE 5 interpretation of results
The VIC Ct value in all the test cervical exfoliated cell samples is less than or equal to 34, each gene amplification curve is S-shaped, and has obvious exponential growth period and reliable result; the typical cervical cancer exfoliated cell amplification curve and the typical normal population cervical exfoliated cell sample amplification curve are respectively shown in fig. 1 and fig. 2; statistical analysis of the performance of the kit shows that the sensitivity of the kit for detecting cervical cancer and high-grade intraepithelial neoplasia is 73.24%, the specificity is 77.05%, and the accuracy is 75.21%.
Table 6 analysis of test performance
The above description is only specific to the embodiments of the invention, but the scope of the invention is not limited thereto, and any person skilled in the art who is skilled in the art to which the invention pertains shall apply to the technical solution and the novel concept according to the invention, and shall all be covered by the scope of the invention.
Claims (9)
1. A primer and probe combination for methylation detection of cervical cancer, which is characterized in that the primer and the probe are used for detecting gene combinations of DAPK2 and CADM 2; the primer and probe combinations include DAPK2 forward primer F, DAPK2 reverse primer R, DAPK2 probe P, CADM2 forward primer F, CADM2 reverse primer R and CADM2 probe P; the nucleotide sequences of the DAPK2 forward primer F, DAPK2 reverse primer R, DAPK2 probe P, CADM2 forward primer F, CADM2 reverse primer R and the CADM2 probe P are respectively shown in SEQ ID NO: 1-SEQ ID NO: shown at 6.
2. The primer and probe combination for methylation detection of cervical cancer according to claim 1, wherein the 5' ends of the DAPK2 probe P and the CADM2 probe P are labeled with FAM; the 3' ends of the DAPK2 probe P and the CADM2 probe P are marked by BHQ 1.
3. A kit for methylation detection of cervical cancer, characterized in that it comprises the primer and probe combination of claim 1 or 2, a β -actin forward primer F, a β -actin reverse primer R and a β -actin probe P; the nucleotide sequences of the beta-actin forward primer F, the beta-actin reverse primer R and the beta-actin probe P are shown in SEQ ID NO: 7-SEQ ID NO: shown at 9.
4. The kit for methylation detection of cervical cancer according to claim 3, wherein the 5' end of the β -actin probe P is labeled with VIC; the 3' -end of the beta-actin probe P is marked by BHQ 1.
5. A kit for methylation detection of cervical cancer according to claim 3, further comprising 10 x PCR Buffer, taq enzyme, dNTPs, nuclease-free water, positive controls and negative controls.
6. A kit for methylation detection of cervical cancer according to claim 5, wherein said positive control comprises DNA from cervical cancer cell line HELA; the negative control included DNA from cervical cancer cell line C33A.
7. A method of detecting a kit according to any one of claims 3 to 6, comprising the steps of:
s1, extracting DNA of a sample to be detected;
s2, carrying out bisulfite conversion treatment on the DNA of the sample to be detected to obtain converted DNA;
s3, carrying out PCR amplification reaction by using the converted DNA as a template and utilizing the primer and probe combination as shown in the claims 1-4 to obtain a fluorescence detection result;
s4, the fluorescence detection result, wherein the threshold value of FAM is set to 8000, and the threshold value of VIC is set to 12000;
s5, judging a sample to be detected by using the fluorescence detection result; when the beta actin Ct is less than or equal to 34, judging the results of each gene according to the delta Ct values of the DAPK2 gene, the CADM2 gene and the beta actin; the DAPK2 gene delta Ct is more than 5, the DAPK2 gene is negative, the DAPK2 gene delta Ct is less than or equal to 5, and the DAPK2 gene is positive; CADM2 gene is negative when delta Ct is more than 8, and CADM2 gene is positive when delta Ct is less than or equal to 8; if any gene of the DAPK2 and the CADM2 is positive, judging that the sample is positive for cervical cancer methylation, and if the DAPK2 and the CADM2 genes are detected to be negative at the same time, judging that the sample is negative for cervical cancer methylation; when beta actin Ct is more than 34, judging that the sample is insufficient or the inhibitor exists, and the PCR reaction is invalid, and repeating the experiment or sampling; the Δct=fam Ct-VIC Ct.
8. The method according to claim 7, wherein the reaction system used in the PCR amplification reaction in the step S3 comprises a DAPK2 amplification system and a CADM2 amplification system; the DAPK2 amplification system comprises: DAPK2 PCR reaction solution 18.8 mu L, taq enzyme 0.2 mu L and DNA 1 mu L after transformation; the DAPK2 PCR reaction solution comprises the following components in concentration: 1 XPCR Buffer, 0.25mM dNTP, 0.4. Mu.M DAPK2 forward primer F, 0.4. Mu.M DAPK2 reverse primer R, 0.2. Mu.M DAPK2 probe P, 0.4. Mu.M beta-actin forward primer F, 0.4. Mu.M beta-actin reverse primer R, and 0.2. Mu.M beta-actin probe P; the CADM2 amplification system comprises: CADM2 PCR reaction solution 18.8. Mu. L, taq enzyme 0.2. Mu.L and converted DNA 1. Mu.L; the CADM2 PCR reaction solution comprises the following components in concentration: 1 XPCR Buffer, 0.25mM dNTP, 0.4. Mu.M CADM2 forward primer F, 0.4. Mu.M CADM2 reverse primer R, 0.2. Mu.M CADM2 probe P, 0.4. Mu.M beta-actin forward primer F, 0.4. Mu.M beta-actin reverse primer R, and 0.2. Mu.M beta-actin probe P.
9. The method according to claim 7, wherein the specific conditions for the PCR amplification reaction in step S3 are that the reaction is carried out at 95℃for 5min; then reacted at 95℃for 10S and 60℃for 30S, respectively, and cycled 40 times, the fluorescence being collected during the reaction at 60℃for 30S.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211410411.9A CN116397025A (en) | 2022-11-11 | 2022-11-11 | Primer probe, kit and detection method for methylation detection of cervical cancer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211410411.9A CN116397025A (en) | 2022-11-11 | 2022-11-11 | Primer probe, kit and detection method for methylation detection of cervical cancer |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN116397025A true CN116397025A (en) | 2023-07-07 |
Family
ID=87011006
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211410411.9A Pending CN116397025A (en) | 2022-11-11 | 2022-11-11 | Primer probe, kit and detection method for methylation detection of cervical cancer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116397025A (en) |
-
2022
- 2022-11-11 CN CN202211410411.9A patent/CN116397025A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105586408B (en) | Cancer screening method | |
| CN110452984A (en) | A kind of methylated genes combination for cervical carcinoma DNA methylation assay, primer and probe combination, kit and its application method | |
| CA2883671A1 (en) | Method for screening cancer | |
| CN114672568B (en) | Kit for detecting cervical cell gene methylation | |
| CN113265456B (en) | Primer and probe combination for detecting cervical high-grade lesion and methylation of cervical cancer related genes | |
| CN112646882A (en) | Composition and diagnostic reagent for detecting cervical high-grade lesion and cervical cancer | |
| CN111826446A (en) | Primer, probe and kit for early screening and auxiliary diagnosis of bladder cancer | |
| CN108949923B (en) | Method for amplifying MSF1 gene, kit and application | |
| CN116004831A (en) | Reagent for diagnosing or assisting in diagnosing bladder cancer and detection kit | |
| CN116397025A (en) | Primer probe, kit and detection method for methylation detection of cervical cancer | |
| CN114480655A (en) | DNA methylation marker combination and application thereof, ovarian cancer early detection primer probe and kit | |
| CN113637754A (en) | Application of biomarker in diagnosis of esophageal cancer | |
| CN114959030B (en) | Application of reagent for detecting HCG9 gene methylation in preparation of product for diagnosing bladder cancer | |
| CN117701721B (en) | Detection reagent and kit for methylation of SOX1-SEPTIN9-TAC1 gene of cervical cancer | |
| CN115948556A (en) | Primer-probe combination for cervical cancer methylation detection, kit and use method thereof | |
| CN113943810B (en) | Reagent and kit for detecting endometrial cancer | |
| CN116694765A (en) | Kit for detecting endometrial cancer and application thereof | |
| EP4265738A1 (en) | Dna methylation marker combination, use, primer probe for early detection of ovarian cancer and kit | |
| CN116064797B (en) | Endometrial cancer gene methylation level detection reagent and application thereof | |
| CN114457156A (en) | Primer and probe combination for cervical cancer methylation detection, kit and use method thereof | |
| CN117265096A (en) | Kit for cervical high-grade lesions and early detection of cervical cancer | |
| CN115725733A (en) | ZNF135 gene methylation detection reagent and application thereof | |
| JP4682275B2 (en) | Method for determining prognosis of mammalian neuroblastoma | |
| CN116083586A (en) | Nucleic acid product, kit and application for diagnosing esophageal cancer | |
| CN115838799A (en) | Application of reagent for detecting gene methylation in preparation of product for diagnosing colorectal cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |