CN113265456B - Primer and probe combination for detecting cervical high-grade lesion and methylation of cervical cancer related genes - Google Patents
Primer and probe combination for detecting cervical high-grade lesion and methylation of cervical cancer related genes Download PDFInfo
- Publication number
- CN113265456B CN113265456B CN202110287291.7A CN202110287291A CN113265456B CN 113265456 B CN113265456 B CN 113265456B CN 202110287291 A CN202110287291 A CN 202110287291A CN 113265456 B CN113265456 B CN 113265456B
- Authority
- CN
- China
- Prior art keywords
- methylation
- primer
- gene
- seq
- internal reference
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/708—Specific hybridization probes for papilloma
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Pathology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer and a probe for detecting methylation degrees of cervical high-grade lesions and cervical cancer related genes, which are used for detecting methylation of 425, 427 and 438 sites of human EPB41L3 genes, methylation of 6367 and 6389 sites of HPV16L1 genes and methylation of 4256, 4261, 4265, 4269, 4275 and 4282 sites of HPV18L2 genes. Through a large amount of screening and optimization, the detection limit of the finally obtained methylation specific primers and probes on an EPB41L3 gene, an HPV16L1 gene and an HPV18L2 gene is within 1 percent. The invention solves the problem that the existing methylation detection result is not enough in correlation with cervical high-grade lesion and cervical cancer, realizes more accurate and effective cervical high-grade lesion and cervical cancer auxiliary diagnosis, shunt management and prognosis judgment technology, and improves the cervical cancer screening efficiency.
Description
Technical Field
The invention belongs to the technical field of biological medicines, and particularly relates to a primer and probe combination for detecting cervical high-grade lesion and cervical cancer related gene methylation, in particular to an EPB41L3, HPV16L1 and HPV18L2 methylation specific primer and probe and respective reference gene primers and probes.
Background
Cervical cancer is one of the most common female malignant tumors, and Human Papilloma Virus (HPV) is detected in cervical exfoliated cells of 99 percent of cervical cancer patients, so that cervical advanced lesions and cervical cancer can be used as diseases with definite causes, and early prevention and early intervention can be realized; among HPV infections, 91% of HPV viruses are transient infections and can be eliminated by an autoimmune system, and normal cervical cells have a latent period of 5-10 years from the development of precancerous lesions to invasive cancers, so that early discovery, early diagnosis and early treatment are important means for preventing cervical cancer.
At present, cervical cytology and high-risk HPV DNA screening are first-line screening means of cervical cancer; colposcopically guided biopsy is the "gold standard" for the diagnosis of cervical cancer and precancerous lesions; however, cytology has missed detection, and 60% of patients with CIN1, 40% of patients with CIN2 and 33% of patients with CIN3 are classified in HPV DNA screening except for one-time infection; moreover, the pathological conditions of invasive examination (colposcope) and treatment (conization and the like) are required to judge the cancer risk of the examined person according to the HPV virus detection or the primary screening result of cytology, so that the health state and the life quality of women are not benefited, and a great amount of medical resources are wasted.
Gene methylation is an early event in the process of tumorigenesis and is the result of the combined effects of the genetic nature of the cell and the external environment. For example, CN 110564857A discloses a composition and a kit for detecting early cervical cancer, wherein the composition comprises amplification primers of 3 highly methylated CpG island regions in EPB41L3 gene and 3 highly methylated CpG island regions in JAM3 gene, however, the composition cannot well screen different stages of cervical intraepithelial neoplasia.
In the prior art, the methylation level of each gene in each research, cervical high-level lesion and cervical cancer correlation are less than 80% due to the difference of site selection and analysis systems when the methylation marker of the gene related to human cervical cancer is simply detected, and a large amount of samples are required for verification and confirmation of each site and system. The foreign related products which are on the market at present are Oncgnost ics in Germany
Methylation detection kit for cervical cancer risk assessment and QIAsure methylation detection kit from Qiagen, germany. There is Hunan in ChinaCervi-M cervical cancer gene methylation detection of Hongya gene technology Limited.
The QIAsure methylation detection kit of Qiagen adopts a methylation specific PCR method to detect and analyze the methylation level of FAM19A4 and hsa-mir-124-2 personal genes, and has the sensitivity of 68-71% and the specificity of 68-76% in CIN3+ detection.
The methylation detection of the Hongya Cervi-M cervical cancer gene adopts a methylation specific PCR method to detect and analyze the methylation level of the pax1 gene, and the sensitivity is 77 percent and the specificity is 79 percent in the CIN3+ detection.
Disclosure of Invention
In order to solve the problems of insufficient correlation with high-grade cervical lesions and cervical cancer existing in the existing methylation detection, realize more accurate and effective auxiliary diagnosis, shunt management and prognosis judgment technologies of the high-grade cervical lesions and the cervical cancer and improve the screening efficiency of the cervical cancer, the invention provides a primer, a probe and a PCR amplification reagent for detecting human genome DNA methylation and HPV virus DNA methylation, and a method for analyzing risks of the high-grade cervical lesions and the cervical cancer;
the invention adopts qMSP technology, comprises specific primer probes for detecting human EPB41L3 gene methylation, HPV16L1 gene methylation and HPV18L2 gene methylation, a gene detection system for detecting three internal control primer probes of human conserved genes ACTB, HPV16 type internal reference genes and HPV18 type internal reference genes, and also comprises positive quality control, negative quality control and blank quality control, and is taken as a sample to be detected to synchronously carry out extraction, transformation and methylation PCR, so as to ensure the effectiveness of the whole process of kit preservation, transportation and test, the DNA of cervical exfoliated cells treated by bisulfite is taken as a template, a methylation real-time fluorescence PCR amplification reagent is adopted to detect the methylation of the human genes and the virus HPV16/18 types, and the risk characteristics of the detected sample are judged by calculating the risk coefficient R value and are used for guiding whether the primary screening population carries out microscopic examination or accurate shunting of other subsequent detections in clinic. The sample with the risk coefficient larger than or equal to the positive judgment value is positive, which indicates that the cervical high-grade lesion and/or the advanced cervical cancer has high risk and needs to be subjected to a diagnostic microscopic examination or other follow-up detections; on the contrary, the samples with the risk coefficient smaller than the positive judgment value are negative, which indicates that the risk of cervical high-grade lesion and/or cervical cancer progression is low, and follow-up is recommended to be carried out every 2-3 years.
The specific technical scheme of the invention is as follows:
the invention aims to provide a primer probe composition for methylation specificity detection for cervical high-grade lesion and cervical cancer detection and a reference gene detection primer probe composition.
The methylation specific primer and probe composition is used for detecting human EPB41L3 gene, virus HPV16L1 gene and HPV18L2 gene. The NCBI database of the sequence of the human EPB41L3 gene is numbered as NC-00018.10, and the NCBI database of the HPV16L1 gene and the NCBI database of the HPV18L2 gene are numbered as AF125673.1 and AY262282.1 respectively.
Preferably, the methylation site of the EPB41L3 gene comprises 425, 427 and 438 sites, the methylation site of the viral HPV16L1 gene comprises 6367 and 6389 sites, and the methylation site of the viral HPV18L2 gene comprises 4256, 4261, 4265, 4269, 4275 and 4282 sites.
In a preferred technical scheme of the invention, primer Pre mier 5.0 and methyl Primer Express v1.0 software is used for 425, 427 and 438 sites of a human EPB41L3 gene, and 3 groups of specific primers and probes are respectively designed, wherein the names and nucleotide sequences of the specific primers and probes are shown as follows:
| sequence name | Oligonucleotide sequence 5'-3' | Sequence numbering |
| EPB41L3 Forward primer 1 | GGTTTTTTTGGGATTTTTGGTC | SEQ ID No：1 |
| EPB41L3 reverse primer 1 | ACCCGAAAAACAACTTAAAACATA | SEQ ID No：2 |
| EPB41L3 Probe 1 | TAACGAAAAAAAAACGCGAAAACCGAA | SEQ ID No：3 |
| EPB41L3 Forward primer 2 | TTTTTTTGGGATTTTTGGTC | SEQ ID No：4 |
| EPB41L3 reverse primer 2 | CCGAAAAACAACTTAAAACATAACG | SEQ ID No：5 |
| EPB41L3 Probe 2 | ACGCGGGGATCGAGTCGTTTTTTC | SEQ ID No：6 |
| EPB41L3 reverse primer 3 | CGAAAAACAACTTAAAACAT | SEQ ID No：7 |
| EPB41L3 Forward primer 3 | TAAATTGGCGGAGAAGGGAC | SEQ ID No：8 |
| EPB41L3 Probe 3 | TAAATTGGCGGAGAAGG | SEQ ID No：9 |
According to a preferred technical scheme, aiming at site methylation of the HPV16L1 gene 6367 and 6389 by using Prim er Premier 5.0 and methyl Primer Express v1.0 software, 3 groups of specific primers and probes are respectively designed, and the names and nucleotide sequences of the specific primers and probes are shown as follows:
| sequence name | Oligonucleotide sequence 5'-3' | Sequence numbering |
| HPV16L1 forward primer 1 | TGGCGATAGTTTATTTTTTTATTTAC | SEQ ID No：10 |
| HPV16L1 reverse primer 1 | ACCAACCCTATTAAATAAATA | SEQ ID No：11 |
| HPV16L1 Probe 1 | AAACATTTATTCCCTTCGT | SEQ ID No：12 |
| HPV16L1 forward primer 2 | AAATGGTGTTAGAATTATATGGC | SEQ ID No：13 |
| HPV16L1 reverse primer 2 | TCTAATACATTTTCACCAACAA | SEQ ID No：14 |
| HPV16L1 Probe 2 | ACATTTTCACCAACAACACCAACCCTATT | SEQ ID No：15 |
| HPV16L1 forward primer 3 | TTAAAATGGTGTTAGAATTATATGGC | SEQ ID No：16 |
| HPV16L1 reverse primer 3 | CATTTTCACCAACAACACCAA | SEQ ID No：17 |
| HPV16L1 Probe 3 | CAAACATTTATTCCCTTCGTAA | SEQ ID No：18 |
In a preferred technical scheme, 3 groups of specific primers and probes are respectively designed by using Primer Premier 5.0 and methyl Primer Express v1.0 software aiming at the site methylation of virus HPV18L2 genes 4256, 4261, 4265, 4269, 4275 and 4282, and the names and nucleotide sequences of the specific primers and probes are shown as follows:
furthermore, the composition also comprises primers and probes of reference genes of the EPB41L3 gene, the HPV16 gene and the HPV18 gene respectively.
The EPB41L3 reference gene is selected from ACTB, GAPDH, ALDOA, PGK1, HPV16 and HPV18 reference gene selects a region with low methylation occurrence frequency in HPV16 and HPV18 sequences, preferably a region sequence which is near the methylation site of the gene and has the number of methylated CpG less than or equal to 1.
Preferably, the EPB41L3 reference gene is selected from ACTB, NCBI database No. NC — 000007.14, and 2 sets of specific primers and probes are designed using Primer Premier 5.0 and Primer expression 2.0 software, respectively. The names and nucleotide sequences of the specific primers and probes are as follows:
| sequence name | Oligonucleotide sequence 5'-3' | Sequence numbering |
| Internal reference ACTB forward primer 1 | GTGATGGAGGAGGTTTAGTAAGTT | SEQ ID No：28 |
| Internal reference ACTB reverse primer 1 | CTTAAAAATTACAAAAACCACAACCTA | SEQ ID No：29 |
| Internal reference ACTB probe | ACCACCACCCAACACACAATAACAAACACA | SEQ ID No：30 |
| Internal reference ACTB forward primer 2 | TGGTGATGGAGGAGGTTTA | SEQ ID No：31 |
| Internal reference ACTB reverse primer 2 | AACCAATAAAACCTACTCCT | SEQ ID No：32 |
The HPV16 reference gene is selected from HPV16E1, HPV16L1, HPV16E6 and HPV16E7 genes, and a region with low methylation frequency in a sequence is selected, preferably a region sequence which is close to the methylation site of the gene and has the number of methylated CpG less than or equal to 1.
Preferably, the HPV16 reference gene is selected from HPV16E1 and HPV16L1, the NCBI database number is AF 1256.1, and 4 groups of specific primers and probes are respectively designed by using Primer Premier 5.0 and Primer expression 2.0 software. The names and nucleotide sequences of the specific primers and probes are as follows:
the HPV18 reference gene is selected from HPV18E1, HPV18L2, HPV18E6 and HPV18E7 genes, and a region with low methylation frequency in the sequence is selected, preferably a region sequence which is near the methylation site of the gene and has the number of methylated CpG less than or equal to 1.
Preferably, the HPV18 reference gene is selected from HPV18E1 and HPV18L2, the NCBI database number is AY262282.1, and 3 groups of specific primers and probes are respectively designed by using Primer Premier 5.0 and Primer expression 2.0 software. The names and nucleotide sequences of the specific primers and probes are as follows:
| sequence name | Oligonucleotide sequence 5'-3' | Sequence numbering |
| HPV18 internal reference forward primer 1 | GGATTTGGTATAGGTATTGGTAGTG | SEQ ID No：45 |
| HPV18 internal reference reverse primer 1 | TATAAAACCAACATCCACCACTATA | SEQ ID No：46 |
| HPV18 internal reference Probe 1 | AACRCCCACCCAATAAAATATACCCTA | SEQ ID No：47 |
| HPV18 internal reference ForwardPrimer 2 | GATTAGGTTAAYGGGTAATTATGT | SEQ ID No：48 |
| HPV18 internal reference reverse primer 2 | ATATCAAACAAATCATTATCCTCC | SEQ ID No：49 |
| HPV18 internal reference Probe 2 | AACCCTAACACCTATTTATATACCRCTAC | SEQ ID No：50 |
| HPV18 internal reference forward primer 3 | ATTTAGTAAAGGATAATAGATGGTT | SEQ ID No：51 |
| HPV18 internal reference reverse primer 3 | TCTTCCTCTTCCTCATACAAA | SEQ ID No：52 |
| HPV18 internal reference Probe 3 | GTTGTTTTGAAGTGGAAGTA | SEQ ID No：53 |
The most preferred technical scheme of the invention is that aiming at human EPB41L3 gene-related methylation sites and internal reference genes ACTB, virus HPV16L1 gene-related methylation sites and internal reference genes and HPV18L2 gene-related methylation sites and internal reference genes, the names and nucleotide sequences of specific primers and probes of target gene methylation sites and internal reference genes are designed as follows:
the second purpose of the invention is to provide a PCR detection kit for detecting cervical high-grade lesion and cervical cancer, which comprises the composition.
Furthermore, the PCR detection kit also comprises methylation specific fluorescent quantitative PCR reaction solution and hot start enzyme. The methylation specificity fluorescent quantitative PCR reaction solution comprises a PCR reaction solution 1 and a PCR reaction solution 2, the PCR reaction solution 1 is used for detecting methylation of EPB41L3, and the PCR reaction solution 2 is used for detecting methylation of HPV16 and HPV 18.
Wherein the PCR reaction solution 1 comprises:
EPB41L3 forward primer, EPB41L3 reverse primer, EPB41L3 probe, internal reference ACTB forward primer, internal reference ACTB reverse primer, internal reference ACTB probe, tris, (NH 4) 2 SO 4 、KCl、dNTP。
Wherein the PCR reaction solution 2 comprises:
HPV16L1 forward primer, HPV16L1 reverse primer, HPV16L1 probe, HPV16 internal reference forward primer, HP V16 internal reference reverse primer, HPV16 internal reference probe, HPV18L2 forward primer, HPV18L2 reverse primer, HPV18L2 probe, HPV18 internal reference forward primer, HPV18 internal reference reverse primer, HPV18 internal reference probe, tris (human papilloma Virus) and (NH 4) 2 SO 4 、 KCl、dNTP。
Wherein the final concentration of the primer is 0.1-0.4. Mu.M, and the final concentration of the probe is 0.05-0.2. Mu.M.
Wherein the final concentration of Tris is 10mM-40mM, and the pH value is 8.0-9.0.
Wherein said (NH 4) 2 SO 4 The final concentration is 10mM-40mM.
Wherein the final concentration of KCl is 30mM-70mM.
Wherein the final concentration of dNTP is 100-500. Mu.M.
Further, the amplification reaction program of the PCR detection reagent of the invention is as follows: 10 minutes at 94 ℃;94 ℃,2 seconds, 62 ℃,45 seconds, 45 cycles; 10 seconds at 12 deg.C, and collecting fluorescence signal at 62 deg.C in the second stage
The third objective of the invention is to provide a diagnostic method for detecting cervical high-grade lesion and cervical cancer, which comprises the composition of the invention.
Further, the diagnostic method of the present invention comprises the steps of:
the method comprises the following steps: taking a sample to be detected to extract DNA;
step two: carrying out bisulfite conversion on the DNA of the sample to be detected to obtain converted DNA;
step three: and (3) performing PCR amplification reaction by using the DNA converted from the sample to be detected as a template and using the methylation PCR detection kit in the scheme to obtain a detection result.
Wherein the sample to be detected in the step one is female cervical exfoliated cells preserved in a cell preservation solution;
preferably, the sample to be tested in the first step is sampled in a volume of 100. Mu.L to 500. Mu.L.
Preferably, the sample to be detected in the first step is sampled in a volume of 200 μ L.
Preferably, the DNA extraction reagent of step one comprises a suspension of magnetic beads.
Preferably, the sample extraction in the step one is semi-automatic extraction.
Preferably, the sample DNA to be detected in step two has a template volume participating in transformation of 10. Mu.L-40. Mu.L.
Most preferably, the sample DNA to be detected in step two has a template volume participating in transformation of 40. Mu.L.
Preferably, the bisulfite conversion reaction conditions of step two are 95 ℃ for 5 minutes; 60 to 180 minutes at 64 ℃.
Preferably, the bisulfite conversion reagent of step two comprises a suspension of magnetic beads.
Preferably, the method for obtaining bisulfite converted DNA in step two is a semi-automatic purification method.
Preferably, the volume of the DNA transformed from the sample to be detected in the third step is 2 μ L-10 μ L.
Optimally, the volume of the DNA converted from the sample to be detected in the step three is 5 muL.
The fourth purpose of the invention is to provide a diagnosis method for detecting cervical high-grade lesion and cervical cancer containing a quality control system, which comprises the composition.
Furthermore, the quality control system comprises a positive quality control product, a negative quality control product and a blank quality control product, and the samples to be detected are subjected to extraction, transformation and methylation PCR synchronously, so that the effectiveness of the whole process of storage, transportation and test of the kit is ensured.
Wherein the positive quality control product contains components with high methylation levels of three target genes of EPB41L3, HPV16L1 and HPV18L2.
Preferably, the positive quality control substance consists of human methylated cell line DNA, a methylated HPV16 full-length plasmid and a methylated HPV18 full-length plasmid.
Most preferably, the human methylated cell line DNA is Hela cell line DNA.
Preferably, the negative quality control product consists of human non-methylated cell line DNA, HPV16 full-length plasmid and HPV18 full-length plasmid.
Most preferably, the human unmethylated cell line DNA is 293T cell line DNA.
Preferably, the blank quality control product is a cell preservation solution.
The fifth object of the present invention is to provide a method for diagnosing cervical high-grade lesions and cervical cancer, which comprises a result judgment rule, comprising the composition of the present invention.
Furthermore, the invention provides a method for judging the test effectiveness, and all channels of the positive quality control product are required to have obvious 'S' -type amplification curves, the Ct value of an internal reference ACTB gene channel is less than or equal to 32, and the Ct value of EPB41L3 delta Ct is more than-4; the Ct value of an internal reference channel of the HPV16 is less than or equal to 32, and the Ct value of delta of HPV16L1 is > -4; the Ct value of an HPV18 internal reference channel is less than or equal to 32, and the Ct value of HPV18L2 delta is > -4; the negative quality control is required to be: the internal reference gene channels have obvious S-type amplification curves, the Ct value of the internal reference ACTB gene channel is less than or equal to 32, and the EPB41L3 delta Ct value is less than or equal to-4; the Ct value of an HPV16 internal reference channel is less than or equal to 32, and the delta Ct value of HPV16L1 is less than or equal to-4; the Ct value of an HPV18 internal reference channel is less than or equal to 32, and the delta Ct value of HPV18L2 is less than or equal to-4; the blank quality control product is required to be: all channels had no obvious 'S' type amplification curve or Ct value was not less than 40.
Furthermore, the invention provides a method for judging the effectiveness of the sample, and the reference ACTB gene in the sample to be detected is required to have an obvious 'S' type amplification curve, and the Ct value is less than 36.
Further, on the premise that the sample is effective, the invention provides a data effectiveness judgment method, when the internal reference of the sample HPV16 or the internal reference of the HPV18 to be detected has an obvious 'S' -type amplification curve and the Ct value of the internal reference channel of the HPV16 is less than 36 or the Ct value of the internal reference channel of the HPV18 is less than 36, the data is effective, and effective data is further subjected to risk analysis; the Ct value of the HPV16 internal reference channel is not less than 36 or the Ct value of the HPV18 internal reference channel is not less than 36, which indicates that the HPV16/18 load of the sample is too low, the HPV16L1 or HPV18L2 data is invalid, and the invalid data is not included in risk calculation.
Furthermore, on the premise that the test meets the requirements of validity of a quality control product, validity of a sample and validity of data, the invention provides a result analysis method, and when a methylated gene detection channel has a smooth S-shaped curve, the Ct value of the gene is recorded; when the methylated gene does not present a smooth S-shaped curve, the methylation of the gene in the sample is negative, and the Ct value of the methylated gene is recorded as 45; calculating the delta Ct value of each gene according to the Ct value recorded by each gene by the following method:
EPB41L3 Δ Ct value = internal reference ACTB Ct value-EPB 41L3 Ct value;
HPV16L1 Δ Ct value = HPV16 internal reference Ct value-HPV 16L1 Ct value;
HPV18L2 Δ Ct value = HPV18 internal reference Ct value-HPV 18L2 Ct value.
The invention has the advantages that:
1. the invention adopts a methylation specificity fluorescence quantitative PCR method to detect methylated target genes EPB41L3, H PV16L1 and HPV18L2, obtains the optimal combination after screening all primers and probes which accord with the design scheme and have methylation specificity, realizes the simultaneous detection of 3 target genes of a plurality of samples through the fluorescence labeling of multi-channel probes, and judges the detection result according to the Ct value of real-time fluorescence quantitative PCR.
2. Aiming at each target gene, a region with low methylation occurrence frequency is respectively selected as an internal reference gene, a multichannel fluorescence marker different from the methylation genes is adopted, the simultaneous detection of 3 methylation genes and corresponding internal reference genes of a plurality of samples is realized, and finally, the methylation level is quantitatively evaluated according to the delta Ct value (internal reference Ct value-target Ct value) of real-time fluorescence quantitative PCR of each gene.
3. Aiming at the combination of each methylated gene and the reference gene, the optimal and suboptimal combination is selected, and the detection limits of the three targets are all verified to be within 1 percent, so that the requirements of clinical detection are met.
4. A set of sample preparation methods is provided, which comprises the extraction of a sample genome and the conversion of bisulfite.
5. A reaction solution and a method for methylation PCR are provided, DNA converted from bisulfite is used as a template, and MSP detection can be simultaneously performed on a plurality of samples by using the PCR reaction solution.
According to the invention, the methylation detection of the human EPB41L3 and the viruses HPV16L1 and HPV18L2 is combined, the methylation level of the high-risk HPV virus serving as the direct pathogenic cause of cervical cancer is brought into a detection system for the first time, and compared with the existing cervical cancer methylation detection technology, the method not only effectively supplements the difference possibly caused by site selection and an analysis system, but also improves the prediction accuracy of cervical high-level lesion and cervical cancer to the greatest extent. The kit combines human EPB41L3 and HPV16L1 and HPV18L2 methylation detection, the sensitivity for detecting CIN3+ is 93.3%, the specificity is 98.5%, the sensitivity for detecting CIN2+ is 92.4%, and the specificity is 82.5%, so that the detection sensitivity and specificity of cervical high-grade lesions and cervical cancer are greatly improved, and the advantages of the prediction capability of the kit in the cervical high-grade lesions and the cervical cancer are fully displayed.
Detailed Description
The following examples illustrate specific steps of the present invention, but are not intended to limit the invention.
Terms used in the present invention generally have meanings commonly understood by those of ordinary skill in the art, unless otherwise specified.
The present invention is described in further detail below with reference to specific examples and with reference to the data. It will be understood that these examples are intended to illustrate the invention and are not intended to limit the scope of the invention in any way.
In the following examples, various procedures and methods not described in detail are conventional methods well known in the art.
Example 1 reaction steps and reaction System for detecting cervical advanced disease and cervical cancer according to the present invention
One) collecting a biological sample:
the cervical cells brushed off by the cervical cell brush are preserved in the cell preservation solution.
Wherein the cell preservation solution may be a Sample Transfer Medium (STM), a careHPV Collection Medium (careHPV Collection Medium), a SurePath cell preservation solution and a PreservCyt cell preservation solution.
II) extraction of cellular DNA
200. Mu.L of cell preservation solution containing exfoliated cervical cells was used as a sample, and DNA extraction and purification were carried out using a nucleic acid extraction kit for a paramagnetic particle method animal tissue genome DNA extraction kit provided by Tiangen Biochemical technology Co., ltd.
Three) DNA transformation
DNA extracted from cells is used as a sample, and the DNA bisulfite conversion kit provided by Tiangen Biochemical technology limited company is used for carrying out bisulfite conversion and purification on genome DNA and HPV virus DNA. After treatment, the C bases on the methylated CpG island in DNA remain as C bases, while the non-methylated C bases become U bases, which results in a difference in the sequence between methylated and unmethylated DNA.
Tetra) methylation specific fluorescent quantitative PCR
Using bisulfite converted DNA as a sample, fluorescent quantitative PCR reaction systems were configured according to table 1 and table 2:
TABLE 1 EPB methylation reaction System
| Name of reagent | Composition of |
| EPB-PCR reaction solution | 20μL |
| Hot start enzyme | 0.2μL |
| DNA transformed with bisulfite | 5μL |
TABLE 2 methylation reaction System of HPV16, 18
| Name of reagent | Make up of |
| HPV16, 18-PCR reaction solution | 20μL |
| Hot start enzyme | 0.25μL |
| DNA transformed with bisulfite | 5μL |
Running the fluorescent quantitative PCR reaction conditions on an ABI7500 fluorescent quantitative PCR instrument:
TABLE 3 PCR reaction conditions and parameters
The collection of the fluorescence signal is set at 58-64 ℃ as described therein.
The EPB fluorescent quantitative PCR reaction system is used for detecting methylation of EPB41L3 of a human genome, and the fluorescent channels are set to be FAM and VIC and respectively correspond to EPB41L3 and internal reference ACTB.
The HPV16 and 18 fluorescent quantitative PCR reaction system is used for detecting HPV16L1 and HPV18L2 methylation, and fluorescent channels are set to be FAM, VIC, ROX and CY5 and respectively correspond to HPV16L1, HPV16 internal reference, HPV18L2 and HPV18 internal reference.
Five) analysis of results
Firstly, judging the effectiveness of a sample: determining whether the reference ACTB gene of the VIC channel of the sample has a typical 'S' -type amplification curve, if so, if the Ct value is less than 36, the sample is effective and further analyzed; if the Ct value is greater than or equal to 36 or there is no typical ` S ` type amplification curve, the sample is not effective, possibly due to low concentration of added DNA or the presence of PCR inhibitors or failure of DNA treatment, requiring DNA re-extraction and bisulfite treatment.
Further, the data validity is judged, when the Ct value of the HPV16 internal reference gene of the VIC channel of the sample is less than 36 or the Ct value of the HPV18 internal reference gene of the CY5 channel is less than 36, the sample data is valid, and further risk analysis is carried out; the Ct value of the HPV16 internal reference gene of the VIC channel is not less than 36 or/and the Ct value of the HPV18 internal reference gene of the CY5 channel is not less than 36, which indicates that the HPV16 or/and HPV18 load of the sample is too low, and the data of the HPV16 or/and HPV18 of the sample are invalid and are not included in the risk calculation.
Furthermore, the recording of Ct values of effective samples with effective data is regulated, if the methylation genes EPB41L3, HPV16L1 and HPV18L2 have Ct values, the Ct value of each methylation gene is recorded according to the PCR result; if the result of methylated gene PCR has no Ct value, the Ct value is recorded as 45.
Analyzing the result according to the delta Ct value of each gene, wherein the delta Ct value of each gene = internal reference Ct value corresponding to each gene-methylation Ct value of each gene; the Δ Ct value of each gene is proportional to the methylation ratio of each gene.
Example 2 screening and verification of primer probes for detecting cervical high-grade lesions and cervical cancer according to the present invention
One) design of primers and probes
Specific primers and probes were designed for positions 425, 427, 438 of the human EPB41L3 gene and the internal reference ACTB gene (see sequences at NCBI database numbers NC — 00018.10 and NC — 000007.14), as well as positions 6367, 6389 of the viral HPV16L1 gene (see sequences at NCBI database numbers AF 125673.1) and positions 4256, 4261, 4265, 4269, 4275 and 4282 of the HPV18L2 gene (see sequences at NCBI database numbers AY 262282.1), respectively, using Primer Premier 5.0 and methyl Primer Express v1.0 software.
The primers and the probes are shown as SEQ ID No: 1-53; specific primer and probe names, nucleotide sequences and combination names, as shown in table 4 below:
TABLE 4 primer and Probe designations, nucleotide sequences and combinations
II) Positive control selection
In order to truly reflect the methylation level of human genome and virus genes, a positive control is prepared to be used as a template to participate in methylation PCR reaction of each gene, and the positive control consists of four parts:
1) DNA extracted from careHPV negative clinical specimens;
2) Cloning to obtain HPV16 full-length plasmids which can represent HPV16L1 gene 100% methylation control after participating in M.SssI methylase methylation reaction, represent HPV16L1 gene 0% methylation control after not participating in methylation reaction, quantitatively unifying the two plasmids and mixing according to the proportion of 0%/1%/50%/100%;
3) Cloning to obtain HPV18 full-length plasmids which can represent 100% methylation control of HPV18L2 genes after participating in methylation reaction of M.SssI methylase, represent 0% methylation control of HPV18L2 genes after not participating in methylation reaction, quantitatively unifying the two plasmids and mixing according to the proportion of 0%/1%/50%/100%;
4) Mixing genomic DNA of Hela cell line with 99% of cytosines methylated to form CpG methylated sequences and genomic DNA of 293T cell line with less than 1% of cytosines, wherein the genomic DNA of Hela cell line and the genomic DNA of 293T cell line are methylated according to the proportion of 0%/1%/50%/100%;
the final positive control sample group contains three genes of EPB41L3, HPV16L1 and HPV18L2 on the basis of clinical samples, and the three genes are close to real clinical samples in a whole genome form, and each sample contains different methylation ratios.
Wherein the positive control sample group is:
epb positive control sample group: genomic DNA with 99% of cytosines methylated to form CpG methylated sequences and genomic DNA with less than 1% methylation were mixed in a ratio of 0%/1%/50%/100% and incorporated into DNA extracted from careHPV negative clinical specimens.
Hpv16 positive control sample group: cloning to obtain HPV16 full-length plasmids, wherein the full-length plasmids participating in M.SssI methylase methylation reaction can represent HPV16L1 gene 100% methylation control, the full-length plasmids not participating in methylation reaction represent HPV16L1 gene 0% methylation control, and after the two are quantitatively normalized, mixing the plasmids according to the proportion of 0%/1%/50%/100%, and doping the plasmids into DNA extracted from careHPV negative clinical samples.
Hpv18 positive control sample group: cloning to obtain HPV18 full-length plasmids, wherein the full-length plasmids participating in M.SssI methylase methylation reaction can represent HPV18L2 gene 100% methylation control, the full-length plasmids not participating in methylation reaction represent HPV18L2 gene 0% methylation control, and after the two are quantitatively normalized, mixing the plasmids according to the proportion of 0%/1%/50%/100%, and doping the plasmids into DNA extracted from careHPV negative clinical samples.
Thirdly) researching and optimizing the performance of the EPB41L3 primer probe
In order to verify that the invention can accurately and effectively detect the methylation of the human EPB41L3 gene and the level of the internal reference ACTB, an EPB positive control sample group is extracted and transformed according to the method described in the invention, an EPB PCR reaction system containing different primer probe combinations of the EPB41L3 and the internal reference ACTB is configured, the transformation product of the EPB positive control sample is detected, the different primer probe combinations are compared, and the combination with the best sensitivity and specificity is selected.
The detection results of the EPB41L3 primer probe combination in the EPB PCR reaction system on the transformation products of the EPB positive control sample group are shown in the following table 5:
TABLE 5 EPB methylation Ct values for different EPB41L3 primer Probe combinations
The positive control Ct value of the EPB41L3 primer probe combination 1 and the combination 3 at the methylation ratio of 100% is smaller, the positive control Ct value at the methylation ratio of 0% is larger, and the sensitivity, the specificity, the PCR amplification efficiency and the linear correlation are all superior to those of the combination 2.
The detection results of the internal reference ACTB primer probe combination in the EPB PCR reaction system on the transformation products of the EPB positive control sample group are shown in the following table 6:
TABLE 6 Ct values for different internal reference ACTB primer-probe combinations
The internal reference ACTB primer probe combination 1 has the smallest Ct value of a positive control product in all methylation ratios, has the best precision and the sensitivity superior to that of the combination 2, and has no influence on the detection of the EPB due to methylation, and the internal reference ACTB primer probe combination 1 has the performance of being used as an internal reference.
Four) HPV16L1 and HPV16 internal reference primer probe performance research and optimization
In order to verify that the kit can accurately and effectively detect HPV16L1 methylation and HPV16 internal reference levels, an HPV16 positive control sample group is extracted and transformed according to the method described in the invention, an HPV16 PCR reaction system containing different primer probe combinations of HPV16L1 and HPV16 internal reference is configured, the transformation product of the HPV16 positive control sample is detected, different primer probe combinations are compared, and the combination with the best sensitivity and specificity is selected;
the detection results of the HPV16L1 primer probe combination in the HPV16 PCR reaction system on the HPV16 positive control sample group transformation products are shown in the following table 7:
TABLE 7 HPV16L1 methylation Ct values for different HPV16L1 primer-probe combinations
The positive control Ct value of the HPV16L1 primer probe combination 1 and the combination 3 at the methylation ratio of 100% is smaller, the positive control Ct value at the methylation ratio of 0% is larger, and the sensitivity, specificity, PCR amplification efficiency and linear correlation are all superior to those of the combination 2.
The detection results of the HPV16 internal reference primer probe combination in the HPV16 PCR reaction system on the HPV16 positive control sample group transformation products are shown in the following table 8:
TABLE 8 HPV16 internal reference Ct values for different HPV16 internal reference primer probe combinations
The positive control Ct values of all methylation ratios of the HPV16 internal reference primer probe combination 1 and the HPV16 internal reference primer probe combination 3 are small, the precision is good, the sensitivity is superior to that of the combination 2 and the combination 4, whether the HPV16L1 gene is methylated or not has no influence on the detection of the HPV16L1 gene, and the HPV16 internal reference primer probe combination 1 and the HPV16 internal reference primer probe combination 3 have the performance of being used as internal references.
Fifthly) research and optimization of HPV18L2 and HPV18 internal reference primer probe performance
In order to verify that the kit can accurately and effectively detect HPV18L2 methylation and HPV18 internal reference levels, an HPV18 positive control sample group is extracted and transformed according to the method described by the invention, an HPV18PCR reaction system containing different primer probe combinations of HPV18L2 and HPV18 internal reference is configured, the transformation product of the HPV18 positive control sample is detected, different primer probe combinations are compared, and the combination with the best sensitivity and specificity is selected;
the detection results of HPV18L2 primer probe combination in HPV18PCR reaction system on the HPV18 positive control sample group conversion products are shown in the following table 9:
TABLE 9 HPV18L2 methylation Ct values for different HPV18L2 primer-probe combinations
The positive control Ct value of the HPV18L2 primer probe combination 1 and the HPV18L2 primer probe combination 3 at the methylation ratio of 100% is smaller, the positive control Ct value at the methylation ratio of 0% is larger, and the sensitivity, the specificity, the PCR amplification efficiency and the linear correlation are superior to those of the combination 2.
The detection results of HPV18 internal reference primer probe combination in HPV18PCR reaction system on the HPV18 positive control sample group conversion products are shown in the following table 10:
TABLE 10 HPV18 internal reference Ct values for different HPV18 internal reference primer probe combinations
The positive control Ct values of all methylation ratios of the HPV18 internal reference primer probe combination 1 and the HPV18 internal reference primer probe combination 3 are small, the precision is good, the sensitivity is superior to that of the combination 2, whether the HPV18L2 gene is methylated or not has no influence on the detection of the HPV18L2 gene, and the HPV18 internal reference primer probe combination 1 and the HPV18 internal reference primer probe combination 3 have the performance of being used as internal references.
Example 3 verification of the Performance of the detection of cervical high-grade lesions and cervical cancer according to the invention
One) design of primers and probes
Screening optimized specific primers and probes according to the method, dividing the combination 1 of the internal reference ACTB primer probe, the combination 1 of the EPB41L3 primer probe, the HPV16L1 primer probe, the HPV16 internal reference primer probe, the combination 1 and the combination 3 of the HPV18L2 primer probe and the HPV18 internal reference primer probe into two groups for combination:
combination 1: internal reference ACTB primer-probe combination 1, combination 1 of an HPV16L1 primer-probe, an HPV16 internal reference primer-probe, an HPV18L2 primer-probe, and an HPV18 internal reference primer-probe;
combination 3: internal reference ACTB primer probe combination 1, epb41l3 primer probe, HPV16L1 primer probe, HPV16 internal reference primer probe, HPV18L2 primer probe, and HPV18 internal reference primer probe combination 3.
Two) Positive control selection
In order to truly reflect the methylation levels of human genome and virus genes, a positive control sample is prepared to be used as a template to participate in methylation PCR reaction of each gene, and the positive control sample group comprises:
epb positive control sample group: mixing genomic DNA with 99% of cytosines methylated to form CpG methylated sequences and genomic DNA with less than 1% of cytosines methylated to form CpG methylated sequences in a ratio of 0%/0.2%/0.4%/0.6% and incorporating into DNA extracted from a careHPV negative clinical specimen;
hpv16 positive control sample group: cloning to obtain HPV16 full-length plasmids which can represent HPV16L1 gene 100% methylation control after participating in M.SssI methylase methylation reaction, represent HPV16L1 gene 0% methylation control after not participating in methylation reaction, quantitatively unifying the two, mixing according to the proportion of 0%/0.6%/1%/1.5%, and doping into DNA extracted from careHPV negative clinical samples;
hpv18 positive control sample group: cloning to obtain HPV18 full-length plasmids, wherein the full-length plasmids which participate in M.SssI methylase methylation reaction can represent 100% methylation control of HPV18L2 genes, the full-length plasmids which do not participate in methylation reaction represent 0% methylation control of HPV18L2 genes, and after the two plasmids are quantitatively normalized, the plasmids are mixed according to the proportion of 0%/0.4%/0.8%/1.2%, and are doped into DNA extracted from careHPV negative clinical samples.
Third) research on detection limit performance of EPB reaction system
In order to verify that the invention can accurately and effectively detect the methylation of the human EPB41L3 gene and the level of the internal reference ACTB, the EPB positive control sample group is extracted and transformed according to the method described in the invention, and then an EPB PCR reaction system containing the optimal and better primer probe combination of the EPB41L3 and the internal reference ACTB is configured to detect the transformation product of the EPB positive control sample, and the lowest detection limit and the precision are evaluated;
1, minimum detection Limit study
The results of detecting the conversion products of EPB positive control sample group with methylation ratios of 0%/0.2%/0.4%/0.6% in EPB PCR reaction system for EPB primer probe combinations 1 and 3 are shown in Table 11 below, and the methylation ratio samples were repeated 20 times:
TABLE 11 Ct values of EPB41L3 and internal reference ACTB for different EPB methylation ratios of primer probe combination 1
TABLE 12 Ct values of primer Probe combination 3 for detection of EPB41L3 and internal reference ACTB at different EPB methylation ratios
Wherein the EPB delta Ct value of the EPB primer probe combination 1 and the EPB primer probe combination 3 at the methylation ratio of 0.2%/0.4%/0.6% is significantly larger than the EPB delta Ct value at the methylation ratio of 0% (p is less than 0.01), and the minimum detection limit of the EPB primer probe combination 1 and the EPB primer probe combination 3 is 0.2%.
2, study of precision
EPB primer probe combination 1 and combination 3 in the EPB PCR reaction system carry out 20 times of detection on the transformation products of the EPB positive control sample group with the methylation ratio of 5 percent, and the results are shown in the following tables 13 and 14:
TABLE 13 Ct values of EPB41L and internal reference ACTB for EPB positive samples of EPB primer Probe combination 1
TABLE 14 Ct values of EPB41L and internal reference ACTB of primer-probe combination 3 on EPB positive samples
Wherein, the coefficient of variation CV of the EPB primer probe combination 1 in the precision research of the EPB positive control sample is 2.20 percent, and the coefficient of variation CV of the EPB primer probe combination 3 in the precision research is 2.32 percent, which meets the requirement that the CV in the precision research is less than or equal to 5 percent.
Four) detection limit performance study of HPV16 reaction system
In order to verify that the HPV16L1 gene methylation and the HPV16 internal reference level can be accurately and effectively detected, an HPV16 positive control sample group is extracted and transformed according to the method described in the invention, an HPV16 PCR reaction system containing the optimal and better HPV16L1 and HPV16 internal reference primer-probe combination is configured to detect the transformation product of the HPV16 positive control sample, and the minimum detection limit and the precision are evaluated;
1, minimum detection Limit study
The detection results of HPV16 primer probe combination 1 and combination 3 in HPV16 PCR reaction system for the conversion products of HPV16 positive control sample group with methylation ratio of 0%/0.6%/1%/1.5% are shown in the following tables 15 and 16, and each sample with methylation ratio is repeated 20 times:
TABLE 15 primer Probe combination 1 detection of HPV16L1 and HPV16 internal reference Ct values for different HPV16 methylation ratios
TABLE 16 primer Probe combination 3 HPV16L1 and HPV16 internal reference Ct values for detection of different HPV16 methylation ratios
Wherein the HPV16 delta Ct value of the HPV16 primer probe combination 1 and the HPV16 primer probe combination 3 at the methylation ratio of 0.6%/1%/1.5% is obviously greater than the HPV16 delta Ct value at the methylation ratio of 0% (p is less than 0.01), and the minimum detection limit ratio of the HPV16 primer probe combination is 0.6%.
2, study of precision
The HPV16 primer probe combination 1 and the HPV16 primer probe combination 3 in the HPV16 PCR reaction system are used for detecting the HPV16 positive control sample group transformation products with the methylation ratio of 10% for 20 times, and the results are shown in the following tables 17 and 18:
TABLE 17 Ct values of HPV16L1 and HPV16 internal reference of HPV16 positive samples with HPV16 primer probe combination 1
TABLE 18 Ct values of HPV16L1 and HPV16 internal references of HPV16 positive samples with HPV16 primer probe combination 3
Wherein the coefficient of variation CV in the precision research of the HPV16 positive control sample by the HPV16 primer probe combination 1 is 2.23 percent, and the coefficient of variation CV in the precision research of the HPV16 primer probe combination 3 is 3.60 percent, which meets the requirement that the CV in the precision research is less than or equal to 5 percent.
Five) detection limit performance study of HPV18 reaction system
In order to verify that the invention can accurately and effectively detect HPV18L2 gene methylation and HPV18 internal reference level, an HPV18 positive control sample group is extracted and transformed according to the method described in the invention, then an HPV18PCR reaction system containing HPV18L2 and HPV18 internal reference optimal and suboptimal primer probe combination is configured, the transformation product of the HPV18 positive control sample is detected, and the lowest detection limit and precision are evaluated;
1, minimum detection Limit study
The detection results of HPV18 primer probe combinations in HPV18PCR reaction system for HPV18 positive control sample group transformation products with methylation ratio of 0%/0.4%/0.8%/1.2% are shown in the following tables 19 and 20, and each sample with methylation ratio is repeated 20 times:
TABLE 19 primer Probe combination 1 detection of HPV18L2 and HPV18 internal reference Ct values for different HPV18 methylation ratios
TABLE 20 primer Probe combination 3 detection of HPV18L2 and HPV18 internal reference Ct values for different HPV18 methylation ratios
Wherein the HPV18 delta Ct values of the HPV18 primer probe combination 1 and the HPV18 primer probe combination 3 in the methylation ratio of 0.4%/0.8%/1.2% are obviously greater than the HPV18 delta Ct value in the methylation ratio of 0% (p is less than 0.01), and the minimum detection limit ratio of the HPV18 primer probe combination is 0.4%.
2, study of precision
HPV18 primer probe combination 1 and combination 3 in the HPV18PCR reaction system carry out 20 detections on the conversion products of the HPV18 positive control sample group with the methylation ratio of 10%, and the results are shown in the following tables 21 and 22:
TABLE 21 Ct values of HPV18L2 and HPV18 internal references of HPV18 positive samples with HPV18 primer probe combination 1
TABLE 22 Ct values of HPV18L2 and HPV18 internal reference of HPV18 positive samples with HPV18 primer probe combination 3
Wherein the coefficient of variation CV in the precision research of the HPV18 positive control sample by the HPV18 primer probe combination 1 is 1.25%, and the coefficient of variation CV in the precision research of the HPV18 primer probe combination 3 is 2.75%, which meets the requirement that the CV in the precision research is less than or equal to 5%.
The invention combines the methylation detection of human EPB41L3 and the methylation detection of the HPV16L1 and the HPV18L2, and brings the methylation level of the high-risk HPV virus which is the direct pathogenic cause of cervical cancer into an epigenetic detection system for the first time. The invention amplifies the methylated sites by methylation specific primers and probes, and realizes the simultaneous detection of 3 target genes by multi-channel probe fluorescence labeling; in addition, aiming at each target gene, a region with low methylation occurrence frequency is respectively selected as an internal reference gene, and the simultaneous detection of 3 internal reference genes and 3 target genes is realized by adopting a multichannel fluorescent marker different from the methylation genes; and finally, quantitatively evaluating the methylation level according to the delta Ct value (internal reference Ct value-target Ct value) of the real-time fluorescence quantitative PCR of each gene.
Sequence listing
<110> Kaai health science and technology Limited, suzhou
<120> primer and probe combination for detecting cervical high-grade lesion and cervical cancer related gene methylation
<141> 2021-03-09
<160> 53
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 1
ggtttttttg ggatttttgg tc 22
<210> 2
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 2
acccgaaaaa caacttaaaa cata 24
<210> 3
<211> 27
<212> DNA
<213> Artificial Sequence
<400> 3
taacgaaaaa aaaacgcgaa aaccgaa 27
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 4
tttttttggg atttttggtc 20
<210> 5
<211> 25
<212> DNA
<213> Artificial Sequence
<400> 5
ccgaaaaaca acttaaaaca taacg 25
<210> 6
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 6
acgcggggat cgagtcgttt tttc 24
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 7
cgaaaaacaa cttaaaacat 20
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 8
taaattggcg gagaagggac 20
<210> 9
<211> 17
<212> DNA
<213> Artificial Sequence
<400> 9
taaattggcg gagaagg 17
<210> 10
<211> 26
<212> DNA
<213> Artificial Sequence
<400> 10
tggcgatagt ttattttttt atttac 26
<210> 11
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 11
accaacccta ttaaataaat a 21
<210> 12
<211> 19
<212> DNA
<213> Artificial Sequence
<400> 12
aaacatttat tcccttcgt 19
<210> 13
<211> 23
<212> DNA
<213> Artificial Sequence
<400> 13
aaatggtgtt agaattatat ggc 23
<210> 14
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 14
tctaatacat tttcaccaac aa 22
<210> 15
<211> 29
<212> DNA
<213> Artificial Sequence
<400> 15
acattttcac caacaacacc aaccctatt 29
<210> 16
<211> 26
<212> DNA
<213> Artificial Sequence
<400> 16
ttaaaatggt gttagaatta tatggc 26
<210> 17
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 17
cattttcacc aacaacacca a 21
<210> 18
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 18
caaacattta ttcccttcgt aa 22
<210> 19
<211> 25
<212> DNA
<213> Artificial Sequence
<400> 19
taaaagtatg gtattttatc gtgtc 25
<210> 20
<211> 29
<212> DNA
<213> Artificial Sequence
<400> 20
tataccaaaa cttaaccatt acaatattt 29
<210> 21
<211> 19
<212> DNA
<213> Artificial Sequence
<400> 21
cgtaaayggg tttcggtaa 19
<210> 22
<211> 23
<212> DNA
<213> Artificial Sequence
<400> 22
tatggtattt tatcgtgtcg tac 23
<210> 23
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 23
aacgtaatac cctccacctt a 21
<210> 24
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 24
cgtaaacggg tttcggtaat 20
<210> 25
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 25
cgtacgacgt aaacgggttt c 21
<210> 26
<211> 25
<212> DNA
<213> Artificial Sequence
<400> 26
tatctactaa cgtaataccc tccac 25
<210> 27
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 27
aaatcaatta ccgaaacccg 20
<210> 28
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 28
gtgatggagg aggtttagta agtt 24
<210> 29
<211> 27
<212> DNA
<213> Artificial Sequence
<400> 29
cttaaaaatt acaaaaacca caaccta 27
<210> 30
<211> 30
<212> DNA
<213> Artificial Sequence
<400> 30
accaccaccc aacacacaat aacaaacaca 30
<210> 31
<211> 19
<212> DNA
<213> Artificial Sequence
<400> 31
tggtgatgga ggaggttta 19
<210> 32
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 32
aaccaataaa acctactcct 20
<210> 33
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 33
gggaatattg gggtaaagga tt 22
<210> 34
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 34
taaaatccat aacaccaaaa ccaa 24
<210> 35
<211> 25
<212> DNA
<213> Artificial Sequence
<400> 35
catatcacca tcctaaataa ctata 25
<210> 36
<211> 26
<212> DNA
<213> Artificial Sequence
<400> 36
aattatttat aggggaatat tggggt 26
<210> 37
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 37
taaaatccat aacaccaaaa ccaa 24
<210> 38
<211> 27
<212> DNA
<213> Artificial Sequence
<400> 38
ttttatgtat taatgttgta gtaawtt 27
<210> 39
<211> 27
<212> DNA
<213> Artificial Sequence
<400> 39
ggtatgttag atgatgttat agtgttt 27
<210> 40
<211> 26
<212> DNA
<213> Artificial Sequence
<400> 40
cataaaaact aaatttccat ccaata 26
<210> 41
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 41
atcatctata taattccaac 20
<210> 42
<211> 26
<212> DNA
<213> Artificial Sequence
<400> 42
tgtaaggtat atttaaaaaa aattgt 26
<210> 43
<211> 26
<212> DNA
<213> Artificial Sequence
<400> 43
acaaaacata ttacaaaccc ttacaa 26
<210> 44
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 44
tggtgtagtt aatataggta aatt 24
<210> 45
<211> 25
<212> DNA
<213> Artificial Sequence
<400> 45
ggatttggta taggtattgg tagtg 25
<210> 46
<211> 25
<212> DNA
<213> Artificial Sequence
<400> 46
tataaaacca acatccacca ctata 25
<210> 47
<211> 27
<212> DNA
<213> Artificial Sequence
<400> 47
aacrcccacc caataaaata tacccta 27
<210> 48
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 48
gattaggtta aygggtaatt atgt 24
<210> 49
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 49
atatcaaaca aatcattatc ctcc 24
<210> 50
<211> 29
<212> DNA
<213> Artificial Sequence
<400> 50
aaccctaaca cctatttata taccrctac 29
<210> 51
<211> 25
<212> DNA
<213> Artificial Sequence
<400> 51
atttagtaaa ggataataga tggtt 25
<210> 52
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 52
tcttcctctt cctcatacaa a 21
<210> 53
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 53
gttgttttga agtggaagta 20
Claims (6)
1. A primer and a probe for detecting cervical high-grade lesion and cervical cancer are composed of a specific primer for detecting the methylation of 425, 427 and 438 sites of a human EPB41L3 gene, a specific primer for detecting the methylation of 6367 and 6389 sites of a virus HPV16L1 gene, a specific primer for detecting the methylation of 4256, 4261, 4265, 4269, 4275 and 4282 sites of an HPV18L2 gene, respective primers of an internal reference gene and a probe marked with a fluorescent group, and are characterized in that:
the EPB41L3 reference gene is selected from ACTB, the HPV16 reference gene is selected from HPV16E1 and HPV16L1, the HPV18 reference gene is selected from HPV18E1 and HPV18L2,
the primer and the probe comprise:
EPB41L3 primer pair 1: SEQ ID No: 1.EPB 41L3 forward primer 1, SEQ ID No:2, EPB41L3 reverse primer 1;
the probe of EPB41L3 gene is shown as SEQ ID No:3 is shown in the specification;
HPV16L1 primer pair 1: SEQ ID No: 10. HPV16L1 forward primer 1, SEQ ID No:11 HPV16L1 reverse primer 1;
the probe of HPV16L1 gene is shown as SEQ ID No:12 is shown in the specification; HPV18L2 primer pair 1: SEQ ID No:19 HPV18L2 forward primer 1, seq ID No:20 HPV18L2 reverse primer 1;
probes of HPV18L2 gene are shown as SEQ ID No:21 is shown in the figure;
ACTB primer pair 1: SEQ ID No: 28. ACTB forward primer 1, SEQ ID No:29 ACTB reverse primer 1;
the ACTB gene probe is shown in SEQ ID No:30 is shown;
HPV16 internal reference primer pair 1: SEQ ID No:33, 1, SEQ ID No:34 HPV16 internal reference reverse primer 1;
the HPV16 internal reference probe is shown as SEQ ID No:35 is shown in the figure;
HPV18 internal reference primer pair 1: SEQ ID No:45, 1, SEQ ID No:46 of HPV18 reference reverse primer 1;
the HPV18 internal reference probe is shown as SEQ ID No: shown at 47.
2. The primers and probes as claimed in claim 1, characterized in that the probes for EPB41L3 gene, HPV16L1 gene and HPV18L2 gene and the 5' luminescent groups of the respective probes for reference genes are the same or different and are selected from FAM, HEX, ROX, JOE, VIC, TET, NED, FITC, CY3 or CY5; the 3' end quenching groups are the same or different and are selected from BHQ1, BHQ2, BHQ3, TAMRA, eclipse and DABCYL.
3. The use of the primers and probes of claim 1 or 2 in the preparation of diagnostic reagents for cervical high-grade lesions and cervical cancer.
4. A diagnostic reagent or kit for detecting cervical high-grade lesions and cervical cancer, characterized by comprising the primer and probe of claim 1 or 2.
5. The diagnostic reagent or kit of claim 4, further comprising a methylation specific fluorescent quantitative PCR reaction solution and a hot start enzyme.
6. The diagnostic reagent or kit as claimed in claim 5, wherein said methylation specific fluorescent quantitative PCR reaction solution comprises PCR reaction solution 1 and PCR reaction solution 2, PCR reaction solution 1 is used for amplifying methylated EPB41L3, and PCR reaction solution 2 is used for amplifying methylated HPV16L1 and HPV18L2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110287291.7A CN113265456B (en) | 2021-03-17 | 2021-03-17 | Primer and probe combination for detecting cervical high-grade lesion and methylation of cervical cancer related genes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110287291.7A CN113265456B (en) | 2021-03-17 | 2021-03-17 | Primer and probe combination for detecting cervical high-grade lesion and methylation of cervical cancer related genes |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113265456A CN113265456A (en) | 2021-08-17 |
| CN113265456B true CN113265456B (en) | 2022-12-06 |
Family
ID=77228328
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110287291.7A Active CN113265456B (en) | 2021-03-17 | 2021-03-17 | Primer and probe combination for detecting cervical high-grade lesion and methylation of cervical cancer related genes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113265456B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114214415A (en) * | 2021-12-29 | 2022-03-22 | 广州安必平医药科技股份有限公司 | Primer probe combination for methylation detection of cervical cancer related genes and application thereof |
| CN115896027A (en) * | 2022-04-07 | 2023-04-04 | 广州燃石医学检验所有限公司 | Biological composition, preparation method and application thereof |
| CN116024349B (en) * | 2023-03-30 | 2023-06-23 | 杭州迪安生物技术有限公司 | Primer probe combination and kit for methylation detection of cervical cancer |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107287294A (en) * | 2017-06-14 | 2017-10-24 | 广州中心法则生物科技有限公司 | A kind of detection primer, probe, kit and its application of cervical cancer-related genes methylation |
| CN110452984A (en) * | 2019-07-29 | 2019-11-15 | 韩林志 | A kind of methylated genes combination for cervical carcinoma DNA methylation assay, primer and probe combination, kit and its application method |
| CN110578001B (en) * | 2019-09-23 | 2023-04-11 | 广州滴纳生物科技有限公司 | Detection kit for detecting methylation of cervical cancer related genes and use method thereof |
| CN110564857B (en) * | 2019-10-21 | 2020-06-09 | 北京鑫诺美迪基因检测技术有限公司 | Composition and kit for early cervical cancer detection |
-
2021
- 2021-03-17 CN CN202110287291.7A patent/CN113265456B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN113265456A (en) | 2021-08-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113265456B (en) | Primer and probe combination for detecting cervical high-grade lesion and methylation of cervical cancer related genes | |
| CN112646882B (en) | Composition and diagnostic reagent for detecting cervical high-grade lesion and cervical cancer | |
| CN110564857B (en) | Composition and kit for early cervical cancer detection | |
| WO2021073029A1 (en) | Method, kit and system for auxiliary diagnosis of bladder cancer based on connecting driver gene mutations and adn methylation, and uses thereof | |
| CN115896289A (en) | Detection primer, probe, kit and method for methylation of cervical cancer related genes | |
| CN111826446A (en) | Primer, probe and kit for early screening and auxiliary diagnosis of bladder cancer | |
| CN113337608B (en) | Combined marker for early diagnosis of liver cancer and application thereof | |
| CN114214415A (en) | Primer probe combination for methylation detection of cervical cancer related genes and application thereof | |
| CN116970705B (en) | Nucleic acid product for methylation detection of urothelial oncogene, kit and application | |
| AU2020445677A1 (en) | Tumor detection reagent and kit | |
| CN116555427A (en) | Methylation gene combination, primer, probe and kit for early detection of cervical cancer | |
| CN109837344A (en) | The EphA7 nucleotide fragments and its detection method of a kind of methylation and application | |
| CN117701720B (en) | Cervical cancer CLIP3 gene methylation detection reagent and kit | |
| CN117701721B (en) | Detection reagent and kit for methylation of SOX1-SEPTIN9-TAC1 gene of cervical cancer | |
| CN114634981B (en) | Liver cancer gene methylation detection primer probe combination, kit and application thereof | |
| CN118667953A (en) | Primer pair, primer probe combination, kit and application for detecting cervical cancer | |
| CN118726584A (en) | Polygene methylation detection kit and detection system for cervical cancer or precancerous lesions detection | |
| CN118581218A (en) | Nucleic acid product and kit for HPV negative cervical cancer detection and application | |
| CN117144012A (en) | Methylation molecular marker for lung adenocarcinoma detection, kit and application | |
| CN116083586A (en) | Nucleic acid product, kit and application for diagnosing esophageal cancer | |
| CN118421800A (en) | Product and kit for methylation detection of cervical adenocarcinoma and application of product and kit | |
| CN117757946A (en) | Kit for detecting methylation of cervical cancer | |
| CN117327794A (en) | Reagent and kit for detecting benign and malignant lung nodules and application of reagent and kit | |
| CN117778582A (en) | Nucleic acid combination for detecting gastric cancer, kit and application | |
| CN116694765A (en) | Kit for detecting endometrial cancer and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |