CN117757946A

CN117757946A - Kit for detecting methylation of cervical cancer

Info

Publication number: CN117757946A
Application number: CN202410169447.5A
Authority: CN
Inventors: 林协; 朱兆奎; 涂火林; 王琪
Original assignee: Shanghai Berger Medical Technology Co ltd
Current assignee: Shanghai Berger Medical Technology Co ltd
Priority date: 2024-02-06
Filing date: 2024-02-06
Publication date: 2024-03-26

Abstract

The invention discloses a primer, a probe and a kit for detecting cervical cell methylation genes. Specifically, the invention develops a fluorescent quantitative PCR kit for detecting PCDHGB7 methylation genes, SOX1 methylation genes and PAX1 methylation genes of cervical cells. The kit has the advantages of strong specificity, high sensitivity, good repeatability and accurate detection and identification results.

Description

Kit for detecting methylation of cervical cancer

Technical Field

The invention relates to the field of biomedical detection, in particular to a kit for detecting methylation of cervical cancer.

Background

Cervical cancer is one of the most common cancers in women, and occurs mostly at the cervical scaly column junction (the transitional zone). Worldwide, it is estimated that 57 thousands of new cases are present in 2018, accounting for 7.5% of all cancer-dead women. The cervical cancer cases in China account for more than 28% of the world, and the high-rise age is 50-55 years. In recent years, the incidence and mortality rate of cervical cancer in China have been on the rise. Of these, 85-90% are squamous cell carcinoma, and the remaining 10-15% are adenocarcinoma. The clinical manifestations of cervical cancer are usually not obvious, or only symptoms similar to cervicitis are caused, so that missed diagnosis is easy to cause; once symptoms appear, they have often progressed to late stages, thereby losing the optimal therapeutic window.

Numerous large studies have shown that regular screening for cervical cancer is the best method for preventing cervical cancer. There are two main screening methods for cervical cancer, one is a common cervical cytology examination, which includes the traditional Pap test (Pap test) and the liquid-based thin-layer cell technology (TCT), and the cervical cancer can be detected early by observing secretion of the cervical part to screen atypical cells which may become cancerous. However, the pap smear method is a cause of low sensitivity due to the problems existing in the processes of material taking, sheet making and sheet reading, and the traditional pap five-stage classification method, so that clinically false negative patients are more frequent; liquid-based thin-layer cell technology is difficult to popularize because of the high price of related equipment and inspection consumables.

The other is human papillomavirus detection (HPV testing), i.e. the observation of the presence or absence of infection by high-risk HPV subtypes in cervical exfoliated cells. Human papillomavirus detection, while highly sensitive, is prone to high false positives, which can lead to clinically excessive treatment and increased patient burden.

Therefore, there is an urgent need in the art to develop early detection techniques for cervical cancer that have the advantages of rapidness, simplicity, high sensitivity, high specificity, and the like.

Disclosure of Invention

The invention aims to provide an early detection technology for cervical cancer, which has the advantages of rapidness, simplicity, convenience, high sensitivity, high specificity and the like.

In a first aspect of the present invention, there is provided a detection reagent for detecting a cervical cell methylation gene, the detection reagent comprising:

a first primer probe combination for detecting a PCDHGB7 methylation gene, the first primer probe combination selected from the group consisting of: (a 1), (a 2), (a 3), or a combination thereof;

wherein, (a 1) an upstream primer shown as SEQ ID NO.1, a downstream primer shown as SEQ ID NO.2 and a fluorescent probe shown as SEQ ID NO. 3;

(a2) An upstream primer shown as SEQ ID NO.4, a downstream primer shown as SEQ ID NO.5 and a fluorescent probe shown as SEQ ID NO. 6;

(a3) An upstream primer shown as SEQ ID NO.7, a downstream primer shown as SEQ ID NO.8 and a fluorescent probe shown as SEQ ID NO. 9.

In another preferred embodiment, the detection reagent further comprises a primer probe combination selected from the group consisting of:

(b) A second primer probe combination for detecting a SOX1 methylation gene, the second primer probe combination selected from the group consisting of: (b 1), (b 2), (b 3), or a combination thereof;

wherein, (b 1) an upstream primer shown as SEQ ID NO.10, a downstream primer shown as SEQ ID NO.11 and a fluorescent probe shown as SEQ ID NO. 12;

(b2) An upstream primer shown as SEQ ID NO.13, a downstream primer shown as SEQ ID NO.14 and a fluorescent probe shown as SEQ ID NO. 15;

(b3) An upstream primer shown as SEQ ID NO.16, a downstream primer shown as SEQ ID NO.17 and a fluorescent probe shown as SEQ ID NO. 18; and/or

(c) A third primer probe combination for detecting a PAX1 methylation gene, the third primer probe combination selected from the group consisting of: (c 1), (c 2), (c 3), or a combination thereof;

wherein, (c 1) an upstream primer shown as SEQ ID NO.19, a downstream primer shown as SEQ ID NO.20 and a fluorescent probe shown as SEQ ID NO. 21;

(c2) An upstream primer shown as SEQ ID NO.22, a downstream primer shown as SEQ ID NO.23 and a fluorescent probe shown as SEQ ID NO. 24;

(c3) An upstream primer shown as SEQ ID NO.25, a downstream primer shown as SEQ ID NO.26 and a fluorescent probe shown as SEQ ID NO. 27.

In another preferred embodiment, the 5' end of the fluorescent probe comprises a fluorescent reporter group, the fluorescent reporter group being selected from the group consisting of: FAM, HEX, NED, ROX, TET, JOE, TAMRA, CY3, CY5, VIC.

In another preferred embodiment, the 3' end of the fluorescent probe comprises a fluorescence quenching group selected from the group consisting of: MGB, BHQ-1, BHQ-2, and BHQ-3.

In another preferred embodiment, one end of the fluorescent probe is labeled with a fluorescent reporter group, and the other end is labeled with a fluorescence quenching group.

In another preferred embodiment, the fluorescence quenching group is MGB.

In another preferred embodiment, the primer probe combination is selected from the group consisting of:

(Z1) primer probe combinations 3,5 and 8, i.e., (a 3), (b 2) and (c 2);

(Z2) primer probe combinations 1,3 and 7, i.e., (a 1), (a 3) and (c 1);

(Z3) primer probe combinations 2,5 and 8, i.e., (a 2), (b 2) and (c 2);

(Z4) primer probe combinations 3,5 and 7, i.e., (a 3), (b 2) and (c 1).

(N1) primer probe combinations 1,5 and 8, i.e., (a 1), (b 2) and (c 2);

(N2) primer probe combinations 3,5 and 8, i.e., (a 3), (a 2) and (c 2);

(N3) primer probe combinations 3,4 and 7, i.e., (a 3), (b 1) and (c 7);

(N4) primer probe combinations 1,3 and 7, i.e., (a 1), (a 3) and (c 1);

(N5) primer probe combinations 3,5 and 7, i.e., (a 3), (b 2) and (c 1).

In a second aspect, the present invention provides the use of a detection reagent according to the first aspect of the present invention for the preparation of a kit for the detection of cervical cancer.

In another preferred embodiment, the detection of cervical cancer comprises cervical cancer screening.

In another preferred embodiment, the detection of cervical cancer is cervical cancer-assisted screening.

In another preferred embodiment, the kit is for detection of cervical exfoliated cells.

In a third aspect of the invention, there is provided a test kit for detecting a cervical cell methylation gene, the test kit comprising a first container containing a test reagent according to the first aspect of the invention.

In another preferred embodiment, the first container includes a plurality of first containers, and each first container contains a different primer probe combination.

In another preferred embodiment, the first container is a single container containing a plurality of different primer probe combinations.

In another preferred embodiment, the detection kit further comprises a primer pair and a probe for an internal standard.

In another preferred example, the primer pair and probe for internal standard are primer probe combinations for internal reference gene beta-actin: an upstream primer shown as SEQ ID NO.28, a downstream primer shown as SEQ ID NO.29, and a fluorescent probe shown as SEQ ID NO. 30.

In another preferred embodiment, the detection kit further comprises one or more additional experimental reagents selected from the group consisting of:

(i) PCR buffer system (liquid or lyophilized form);

(ii) A polymerase or a polymerase solution;

(iii) Purifying the reagent.

In another preferred embodiment, the concentration of the upstream primer, the downstream primer and the fluorescent probe in the detection reagent is 10 to 500nmol/L, preferably 100 to 200nmol/L.

In another preferred embodiment, the detection kit further comprises a positive quality control and a negative quality control.

In another preferred embodiment, the positive quality control is cervical cancer tissue DNA.

In another preferred embodiment, the negative quality control is leukocyte DNA.

In another preferred embodiment, the PCR buffer system comprises Mg ²⁺ Deoxyribose core triphosphateAnd (3) a nucleotide.

In another preferred example, the Mg ²⁺ Added as magnesium sulfate.

In another preferred example, the magnesium sulfate (or Mg ²⁺ ) The concentration of (C) is 1 to 4mmol/L, preferably 2.5 to 3.5mmol/L.

In another preferred embodiment, the concentration of deoxyribonucleotide triphosphates is 10 to 500. Mu. Mol/L, preferably 100 to 200. Mu. Mol/L.

In another preferred embodiment, the polymerase solution contains or consists of Taq polymerase and nuclease free water.

In another preferred embodiment, the test kit is used for in vitro testing of cervical cell methylation.

In another preferred embodiment, the detection kit further comprises instructions describing threshold setting and judgment criteria.

In another preferred embodiment, the threshold setting comprises (1) an adjustment Baseline (Baseline): using an automatic baseline; and (2) an adjustment Threshold (Threshold): the thresholds of the Texas Red, FAM, VIC and CY5 channels are generally set to 19000, and can be specifically adjusted according to the actual situation of the sample to be detected.

In another preferred embodiment, the judgment standard includes a kit validity judgment standard, a sample validity judgment standard, and a judgment standard of a detection result of the kit.

In another preferred embodiment, the assay kit validity judgment criteria are: (i) positive quality control: the CT value of the internal reference is less than or equal to 35, and the CT value of the target gene is less than or equal to 35; (ii) negative quality control: the CT value of the internal reference is less than or equal to 35, and the CT value of the target gene is more than 35.

In another preferred embodiment, the sample validity judgment criteria are: (i) The internal reference gene is amplified, and the CT value CT is less than or equal to 35, so that the analysis can be continued; (ii) And if the CT value of the reference gene is more than or equal to 35 or no amplification is carried out, judging that the sample is an invalid sample, and resampling and detection are needed.

In another preferred embodiment, the determination criteria of the detection result of the detection kit are:

(i) The CT value of the internal reference is less than or equal to 35; at least one CT value of the target gene is less than or equal to 35, and the sample is judged to be a positive sample;

(ii) The CT value of the reference is less than or equal to 35; CT values of target genes are all more than 35, and the sample is judged to be a negative sample;

(iii) And judging that the sample is unqualified if the internal reference CT value is more than 35 or the amplification curve has no obvious logarithmic growth phase.

In a fourth aspect of the invention, there is provided a method for detecting cervical cell methylation genes in vitro, the method comprising:

(s 1) obtaining a sample to be tested;

(s 2) performing a fluorescent quantitative PCR reaction on the sample to be tested using the detection kit according to the third aspect of the present invention, thereby detecting a cervical cell methylation gene.

In another preferred embodiment, the sample to be tested is subjected to a bisulfite conversion treatment.

In another preferred embodiment, the method is non-diagnostic and non-therapeutic.

In another preferred embodiment, the sample to be tested is from a human.

In another preferred embodiment, the sample to be tested comprises one of a tissue and a cell.

In another preferred embodiment, the test sample comprises cervical exfoliated cells.

In another preferred example, the method sets the thresholds of the Texas Red, FAM, VIC and CY5 channels to 19000.

In another preferred embodiment, the PCR reaction is performed by the following reaction procedure: 95 ℃ for 10 minutes; 95℃for 10 seconds, 64℃for 30 seconds, 45 cycles.

In another preferred embodiment, the PCR reaction is performed by the following reaction procedure: 95 ℃ for 10 minutes; 95℃for 10 seconds, 62℃for 30 seconds, 45 cycles.

In another preferred embodiment, the validity judgment criteria of the method are: (i) positive quality control: the CT value of the internal reference is less than or equal to 35, and the CT value of the target gene is less than or equal to 35; (ii) negative quality control: the CT value of the internal reference is less than or equal to 35, and the CT value of the target gene is more than 35.

In another preferred embodiment, the sample validity criterion of the method is: (i) The internal reference gene is amplified, and the CT value CT is less than or equal to 35, so that the analysis can be continued; (ii) And if the CT value of the reference gene is more than or equal to 35 or no amplification is carried out, judging that the sample is an invalid sample, and resampling and detection are needed.

In another preferred embodiment, the determination criteria for the detection result of the method are:

In another preferred embodiment, the sensitivity of the method is equal to or greater than 85%, preferably equal to or greater than 90%, more preferably equal to or greater than 92%.

In another preferred embodiment, the specificity of the method is greater than or equal to 85%, preferably greater than or equal to 90%, more preferably greater than or equal to 93%.

It is understood that within the scope of the present invention, the above-described technical features of the present invention and technical features specifically described below (e.g., in the examples) may be combined with each other to constitute new or preferred technical solutions. And are limited to a space, and are not described in detail herein.

Drawings

FIG. 1 shows an amplification curve of a clinically positive sample with PAX1 as the detection target. Wherein, blue is PAX1 amplification curve, and red is internal reference amplification curve.

FIG. 2 shows an amplification curve of a clinically positive sample with SOX1 as a detection target. Wherein, green is SOX1 amplification curve, and red is internal reference amplification curve.

FIG. 3 shows an amplification curve of a clinically positive sample with PCDHGB7 as the detection target. Orange is PCDHGB7 amplification curve, and red is internal reference amplification curve.

FIG. 4 shows amplification curves of clinical positive samples with PAX1, SOX1 and PCDHGB7 as detection targets. Wherein, blue is PAX1 amplification curve, green is SOX1 amplification curve, orange is PCDHGB7 amplification curve, and red is internal reference amplification curve.

Detailed Description

The inventors have conducted extensive and intensive studies and have unexpectedly found that detection of methylation of a specific target region for PCDHGB7 can provide highly sensitive and specific detection information for detection of cervical cancer. In addition, the inventors have further developed the joint inspection combination of the PCR primer probe combination of the present invention through a large number of screening and experiments. The different primers and probes in the joint inspection combination can not interfere with each other in the PCR reaction process, so that the kit can be used for multiplex fluorescence quantitative PCR, and has higher sensitivity and higher specificity. On this basis, the present invention has been completed.

Terminology

As used herein, the terms "fluorogenic group", "fluorescent reporter group", "fluorophore" are used interchangeably and refer to a structure of a compound capable of absorbing external excitation energy and converting it into a fluorescent signal. Common fluorophores include (but are not limited to): FAM, HEX, NED, ROX, TET, JOE, TAMRA, CY3, CY5 or VIC.

As used herein, the terms "fluorescence quenching group", "quenching group" are used interchangeably and refer to a group that causes fluorescence quenching of the corresponding fluorescent group by physical or chemical action. Common quenching groups include (but are not limited to): BHQ1, BHQ2, MGB, BHQ3 or TAMARA.

As used herein, the terms "annihilation probe" and "quenching probe" are used interchangeably and refer to a probe that fluorescence quenches the corresponding fluorophore by physical or chemical action.

As used herein, the terms "CT value," "CT value," and "CT value" are used interchangeably to refer to the number of cycles that each fluorescent signal within a reaction tube undergoes when reaching a set threshold.

DNA methylation

DNA methylation changes are one of the earliest molecular changes occurring in the course of cancer and have tissue specificity, and the high methylation level of tumor suppressor genes has been identified as an important mechanism to suppress gene expression and promote cancer cell growth and expansion.

PCDHGB7 Gene

PCDHGB7 (protocadherin gamma subfamily B, 7) is a member of the protoadhesin gamma gene cluster and plays a key role in the establishment and function of specific neuronal connections. Research shows that the methylation of PCDHGB7 is closely related to cervical cancer, and has good application in cervical cancer screening.

The genome of human PCDHGB7 has an accession number NC_000005.10:141412677-141518975 on chromosome 5, GRCh38.p14.

The nucleotide sequence of the human PCDHGB7 gene, untreated with Bisulfite (BS), is: AACAGAAAAGAAAACCAGCTCCCACACAGAGGCTCCCGGCTGCGCAGACCTTGCCCAGCACACCAGATTGCCAGCTCCGAGACCCGGGACTCCTCCTGTCCTGGGCCGAATGCTCTTTTAGCGCGGTAGAGTGCACTTTCTCCAACTGGAAAAGCGGGGACCCAGCGAGAACCCGAGCGAACGATGGGAGGGAGCTGCGCGCAGAGGCGCCGGGCCGGCCCGCGGCAGGTACTATTTCCTTTGCTGCTGCCTTTGTTCTACCCCACGCTGTGTGAGCCGATCCGCTACTCGATTCCGGAGGAGCTGGCCAAGGGCTCGGTGGTGGGGAACCTCGCTAAGGATCTAGGGCTTAGTGTCCTGGATGTGTCGGCTCGCGAGCTGCGAGTGAGCGCGGAGAAGCTGCACTTCAGCGTAGACGCGCAGAGCGGGGACTTACTTGTGAAGGACCGAATAGACCGTGAGCAAATATGCAAAGAGAGAAGAAGATGTGAGTTGCAATTGGAAGCTGTGGTGGAAAATCCTTTAAATATTTTTCATGTCATTGTGGTGATTGAGGATGTTAATGACCACGCCCCTCAATTCCGGAAAGATGAAATAAACTTAGAAATCAGTGAATCCGTCAGCCTGGGGATGGGAACAATTCTTGAGTCTGCAGAAGATCCTGATATTAGTATGAATTCGCTGAGCAAATACCAACTAAGTCCTAACGAGTATTTCTCATTGGTGGAGAAAGACAATCCTGATGGTGGCAAATATCCAGAATTAGTATTGCAGAAGACTCTGGACCGAGAAACGCAGAGCGCTCACCACTTGGTACTGACCGCCTTAGATGGTGGGGACCCTCCCCGAAGCGGTACTGCTCAGATAAGAATCCTGGTAATAGATGCCAATGACAACCCCCCAGTGTTCAGCCAGGACGTGTACAGGGTTAGCCTTCGGGAAGACGTGCCTCCAGGCACCTCCATCCTGAGAGTGAAGGCCACTGACCAGGACGAGGGCATCAACTCAGAGATCACTTATTCCTTCTTTGGTGTGGCTGACAAAGCTCAGCACGTGTTCTCTCTGGATTACACTACAGGAAACATTCTAACTCAGCAGCCTTTGGATTTTGAAGAAGTAGAAAGATATACGATAAACATAGAAGCAAAAGACCGAGGATCTCTCTCAACACGGTGTAAAGTAATTGTAGAAGTTGTAGACGAAAACGACAACAGCCCAGAAATAATCATCACGTCACTCTCTGATCAGATTATGGAGGATTCCCCTCCAGGAGTGGTTGTTGCCCTCTTCAAAACACGGGACCAAGACTCAGGGGAAAATGGGGAAGTCAGGTGTAGCTTAAGTAGAGGTGTTCCATTTAAGATTCATTCTTCTTCTAATAATTACTACAAGCTAGTAACAGATGAGGCCCTGGATCGGGAGCAGACCCCAGAGTACAACGTCACCATCGCAGCCACAGACAGGGGCAAGCCTCCGTTATCCTCCAGCAAAACCATAACCCTGCACATTACTGACGTCAATGACAACGCGCCGGTTTTCGGACAGTCAGCCTACCTGGTCCACGTGCCAGAAAACAACCAGCCGGGTGCCTCCATAGCGCAAGTCAGTGCCTCTGACCCAGACTTCGGGCTCAACGGCCGTGTCTCCTACTCTCTCATTGCCAGCGACCTGGAGTCACGAACGCTGTCGTCCTACGTGTCCGTGAGCGCGCAGAGCGGGGTGGTGTTCGCGCAGCGCGCCTTCGACCACGAGCAGCTGCGCACCTTCGAGCTCACGCTGCAGGCCCGCGACCAGGGCTCGCCCGCGCTCAGCGCCAATGTGAGCCTGCGCGTGTTGGTGGGCGACCGTAACGACAACGCACCGCGGGTGCTGTACCCTGCGCTGGGTCCCGACGGCTCCGCGCTCTTCGACACAGTGCCGCGGGCCGCGCAGCCAGGCTACCTGGTGACCAAGGTGGTGGCCGTGGACGCGGACTCGGGGCACAATGCCTGGCTGTCCTACCACGTGGTGCAGGCCAGTGAGCCCGGGCTCTTCAGCCTGGGGCTGCGAACAGGCGAGGTGCGCATGGTGCGTGCTTTGGGTGACAAGGACTCGGTCCGCCAGCGCCTGCTAGTCGCTGTAAGAGATGGAGGACAGCCACCCCTTTCAGCCACTGCCACGCTGCACCTGGTGTTCGCAGATAGCTTGCAAGAGGTACTGCCGGATTTCAGCGACCATCCCACACCCTCTGACTCCCAGGCTGAGATGCAGTTTTACCTGGTGGTGGCCTTGGCCTTGATTTCTGTGCTCTTTCTCCTCGCGGTGATTCTAGCTATTGCTCTACGCCTGCGACAGTCTTTCAGCCCTACTGCAGGAGACTGCTTTGAGTCAGTTCTCTGCTCCAAGTCCGGACCTGTGGGTCCCCCCAACTACAGTGAGGGAACGTTGCCCTATGCCTATAATTTTTGTGTGCCTGGGGATCAAATGAATCCAGAATTTAATTTTTTCACATCTGTTGATCATTGTCCAGCCACACAAGATAACCTCAACAAAGATAGCATGCTACTGGCTAGCATTTTAACTCCCAGCGTTGAAGCAGATAAGAAGATTCTTAAACAGGTAAGTATTTAAAAATGTATTTAATCCTTTTTATATTACAATATGCCAATATATTCCAATATAGTGGTATTATTTTAAGATTCTAGATAACTTCTTCATAGAGTTCGCAAAATATAGGTCAAATTTATGGTTATCATTATTAAAACAAAAGTTTAAATTAAA (SEQ ID NO: 31)

The inventors have determined by research the methylation-occurring target regions of the PCDHGB7 gene that are closely related to the risk of cervical cancer, and by extensive screening and experimentation, the combination of PCR primers and probes that are preferred for the performance of these closely related regions.

In the present invention, the sequence of the target region of the preferred PCDHGB7 gene is shown in the following table.

TABLE 1

PAX1 gene

PAX1 is a key tumor suppressor gene, regulates cell differentiation and maturation, and has close relation with generation, development and cell canceration of tumors due to abnormal methylation of genes. In cervical cells, once methylated, the PAX1 gene promoter will therefore silence or inactivate the gene, thus losing the function of inhibiting tumor growth, and abnormal cells will lose control, resulting in cervical cancer.

The gene sequence of human PAX1 has accession number NC_000020.11:2170664-21738481, located on chromosome 20 of human (Homo sapiens), GRCh38.p14.

The inventors have further determined, through studies, methylation-occurring target regions of the PAX1 gene that are closely related to the risk of cervical cancer, and have determined, through extensive screening and experimentation, combinations of PCR primers and probes that are preferred for the performance of these closely related regions.

SOX1 gene

The SOX gene family is a family of highly conserved high mobility transcription factors that play an important role in the fine regulation of embryonic development and in the normal function of stem cells. SOX family members are closely related to the occurrence and development of tumors.

The gene sequence of human SOX1 has accession number NC_000013.11:112062149-112076706, located on chromosome 13 of human (Homo sapiens), GRCh38.p14

The present inventors have further determined methylation-occurring target regions of SOX1 gene that are closely related to the risk of cervical cancer by research, and have determined combinations of PCR primers and probes that are preferable for the performance of these closely related regions by extensive screening and experiments.

Primer and probe

The terms "primer (pair)" and "specific primer (pair)" as used herein have the meanings conventionally understood by those skilled in the art, i.e., refer to a primer (pair) that amplifies an amplification product having a complementary strand sequence of a pathogen of interest.

The term "probe" as used herein has the meaning conventionally understood by those skilled in the art, i.e., a small single-stranded DNA or RNA fragment, for detecting a nucleic acid sequence complementary thereto.

The invention provides a detection reagent for detecting cervical cancer cell methylation genes, which comprises a first primer probe combination for detecting PCDHGB7 methylation genes, a second primer probe combination for detecting SOX1 methylation genes and/or a third primer probe combination for detecting PAX1 methylation genes,

wherein the first primer probe combination is selected from the group consisting of: (a 1), (a 2), (a 3), or a combination thereof;

(b) The second primer probe combination is selected from the group consisting of: (b 1), (b 2), (b 3), or a combination thereof;

(c) The third primer probe combination is selected from the group consisting of: (c 1), (c 2), (c 3), or a combination thereof;

(a1) An upstream primer shown as SEQ ID NO.1, a downstream primer shown as SEQ ID NO.2 and a fluorescent probe shown as SEQ ID NO. 3;

(a3) An upstream primer shown as SEQ ID NO.7, a downstream primer shown as SEQ ID NO.8 and a fluorescent probe shown as SEQ ID NO. 9;

(b1) An upstream primer shown as SEQ ID NO.10, a downstream primer shown as SEQ ID NO.11 and a fluorescent probe shown as SEQ ID NO. 12;

(b3) An upstream primer shown as SEQ ID NO.16, a downstream primer shown as SEQ ID NO.17 and a fluorescent probe shown as SEQ ID NO. 18;

(c1) An upstream primer shown as SEQ ID NO.19, a downstream primer shown as SEQ ID NO.20 and a fluorescent probe shown as SEQ ID NO. 21;

The probe of the present invention consists of a single-stranded nucleic acid molecule labeled with a fluorogenic group and a quenching group at both ends, respectively. Preferably, the probe is labeled with a fluorogenic group at the 5 'end and a fluorescence quenching group at the 3' end. The fluorogenic group is selected from the group consisting of: FAM, VIC, TEXAS RED, CY5, JOE, NED, TET, HEX, TAMARA, ROX, CY3, CY5.5, CY7, or VIC. The fluorescence quenching group is selected from the group consisting of: BHQ1, BHQ2, MGB, BHQ3 or TAMARA.

The primer and the probe have excellent detection sensitivity and specificity when being independently applied. When the method is applied to multiple reactions, because the optimized primer probe combinations are not easy to react with each other, the detection sensitivity and the specificity of the method are improved compared with the existing primer probe combinations.

Preferred primer sequences and corresponding target genes of the invention are shown in Table 2.

TABLE 2

Kit for detecting a substance in a sample

The invention provides a fluorescent quantitative PCR kit for detecting cervical cell methylation genes, which is designed to optimize primers and probes aiming at one or a combination of PCDHGB7 genes, PAX1 genes and SOX1 genes, and can synchronously detect cervical cell methylation genes through a reaction system. The kit provided by the invention can be used for rapidly detecting cervical cell methylation genes with high sensitivity and high specificity.

Detection method

The invention provides a method for detecting cervical cell methylation genes by a multiplex fluorescence quantitative PCR method. Compared with the prior art, the invention provides an optimized primer pair probe combination and a detection kit of corresponding multiplex fluorescence quantitative PCR amplification reaction liquid, and the accurate quantitative detection of three cervical cell methylation genes can be realized by one tube through the optimized primer and probe.

Typically, the methods of the invention for detecting methylation of cervical cancer cells comprise:

(s 1) providing a sample to be tested, wherein the sample to be tested is a cervical exfoliated cell;

(s 2) extracting DNA of a sample to be detected;

(s 3) converting the DNA into a template to be detected by bisulphite;

(s 4) carrying out fluorescent quantitative PCR amplification on the template to be detected by using the kit, thereby obtaining a detection result.

In another preferred embodiment, the method of the present invention comprises:

y1. treatment of cervical exfoliated cell samples

This step can be performed using a variety of reagents and equipment, either existing or commercially available. One representative example includes (but is not limited to): sampling by a special cervical exfoliated cell collector. Sample collection methods see collectors used and cell preservation fluid manufacturer-directed methods;

y2. DNA extraction of cervical exfoliated cell sample

This step can be performed using a variety of reagents and equipment, either existing or commercially available. One representative example includes (but is not limited to): taking 1.5mL of cervical exfoliated cell sample, centrifuging for 5min in a 2mL centrifuge tube at 12000rmp, removing the supernatant, and collecting cervical cells; the DNA was then extracted using the nucleic acid extraction and purification kit from Shanghai Berger medical science, inc.

Y3. bisulfite conversion

This step can be performed using a variety of reagents and equipment, either existing or commercially available. One representative example includes (but is not limited to): the extracted DNA was bisulphite treated with a EpiArtTM DNA Methylation Bisulfite Kit (EM 101) kit from nupran company and subsequently purified.

Y4.qPCR amplification

Based on the primer probe combination provided by the invention, various existing or commercial qPCR reagents and instruments can be adopted to carry out qPCR amplification under proper conditions.

In the present invention, a representative example includes (but is not limited to): the bisulphite treated DNA was subjected to qPCR amplification using a Thermo Fisher company ABI 7500 instrument.

In a preferred embodiment, a reaction system for a preferred methylation fluorescent quantitative PCR comprises: the concentration of the divalent magnesium ion is 1-4 mmol/L, preferably 2.5-3.5 mmol/L; the concentration of deoxyribonucleotide triphosphate is 10 to 500. Mu. Mol/L, preferably 100 to 200. Mu. Mol/L; the concentration of each forward primer, each reverse primer and each annihilation probe is 10 to 500nmol/L, preferably 100 to 200nmol/L.

In a preferred embodiment, the preferred amplification procedure is as shown in Table 3 or Table 4:

TABLE 3 Table 3

TABLE 4 Table 4

Y5. threshold setting

This step may employ various existing equipment or methods to determine the baseline and then set the threshold accordingly. One representative example includes (but is not limited to):

(1) Baseline modulation (Baseline): using an automatic baseline;

(2) Adjustment Threshold (Threshold): the thresholds of the Texas Red, FAM, VIC and CY5 channels are generally set to 19000, and can be specifically adjusted according to the actual situation of the sample to be detected.

Y6. criterion

Based on the primer probe combination provided by the invention, the judgment standard with excellent sensitivity and specificity can be set correspondingly.

For positive and negative quality controls, preferred criteria are as follows:

(1) Controlling the nature of yang: the CT value of the internal reference is less than or equal to 35, and the CT value of the target gene is less than or equal to 35;

(2) Negative quality control: the CT value of the internal reference is less than or equal to 35, and the CT value of the target gene is more than 35.

For testing the validity of a sample, a preferred criterion is as follows:

(1) The internal reference gene is amplified and the CT value is less than or equal to 35, so that the analysis can be continued;

(2) And if the CT value of the reference gene is more than or equal to 35 or no amplification is carried out, judging that the sample is an invalid sample, and resampling and detection are needed.

For determination of methylation detection results, a preferred criterion is as follows:

(1) The CT value of the internal reference is less than or equal to 35; at least one CT value of the target gene is less than or equal to 35, and the sample is judged to be a positive sample;

(2) The CT value of the internal reference is less than or equal to 35; CT values of target genes are all more than 35, and the sample is judged to be a negative sample;

(3) And judging that the sample is unqualified if the internal reference CT value is more than 35 or the amplification curve has no obvious logarithmic growth phase.

The main advantages of the invention include:

(1) The single primer probe combination for cervical cell methylation gene has the detection sensitivity of 83.4-93.4% and the specificity of 85-95%.

(2) The combination of the primer probe combination aiming at cervical cell methylation genes has the detection sensitivity of 90-96.7% and the specificity of 85-95%.

(3) The kit can be used for carrying out auxiliary diagnosis of early cervical cancer, and can also be used for detecting the diagnosed cervical cancer patient so as to reduce the frequency of cervical cancer microscopic examination.

(4) The kit of the invention can directly detect the collected cervical epithelial cells, so that the kit can help to diagnose, detect or screen cervical cancer in an early stage by analyzing the gene methylation in the cervical cells, and is easier to operate.

(5) The method and the kit have the advantages of simple and convenient operation, rapidness, low cost and the like, and are beneficial to early screening of cervical cancer.

The invention will be further illustrated with reference to specific examples. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental procedure, which does not address the specific conditions in the following examples, is generally followed by routine conditions, such as Sam brook et al, molecular cloning: conditions described in the laboratory Manual (New York: cold Spring Harbor Laboratory Press, 1989) or as recommended by the manufacturer. Percentages and parts are by weight unless otherwise indicated.

Example 1 sample DNA extraction and bisulfite conversion

1.1 treatment of cervical exfoliated cell samples

The collection of cervical exfoliated cell samples was performed as follows:

(1) Sampling by a special cervical exfoliated cell collector;

(2) Specific sample collection methods refer to the collectors used and the cell preservation fluid manufacturer's instruction methods;

(3) In order to ensure the accuracy of the detection result, the sampling operation accords with the relevant requirements of clinical detection on cervical exfoliated cell collection.

1.2 DNA extraction of cervical exfoliated cell samples

Taking 1.5mL of cervical exfoliated cell sample, centrifuging for 5min in a 2mL centrifuge tube at 12000rmp, removing the supernatant, and collecting cervical cells; the DNA was then extracted using the nucleic acid extraction and purification kit from Shanghai Berger medical science, inc.

1.3 bisulfite conversion

The extracted DNA was bisulphite treated with a EpiArtTM DNA Methylation Bisulfite Kit (EM 101) kit from nupran company and subsequently purified.

Example 2 cervical cancer hypermethylation candidate Gene and specific primer and Probe screening

The existing research results, TCGA methylation chip database and transcriptome sequencing expression profile are comprehensively analyzed, methylation sites with obvious differences are screened, and PCDHGB7, PAX1, SOX1 and the like are finally screened and determined to be cervical cancer hypermethylation candidate genes through multiple data filtering analysis.

Further, according to the nucleic acid sequences of PCDHGB7, PAX1 and SOX1, methylation primers and probes are designed, and for tens of primer probe combinations designed, PCR probes and primer combinations with excellent comprehensive performance are screened through experiments and verification, wherein the specific sequences are shown in Table 2:

TABLE 2

Meanwhile, specific primers and probes aiming at the reference gene beta-actin are arranged, and specific sequences (5 '-3') are as follows:

methyl-B-actin-F primer:

CCACCCAACACACAATAACAAACA(SEQ ID NO.28)、

methyl-B-actin-R primer:

TTGGGGAAGTTTGTTTTTGCGTG(SEQ ID NO.29)、

methyl-B-actin-P probe:

TCCAAAAAACTTACTAAACCTCCTCCATCA(SEQ ID NO.30)。

in the primer probe combination (1-3) of the PCDHGB7 methylation gene, a fluorescent group adopts CY5, and a quenching group is BHQ3.

In the primer probe combination (4-6) of the SOX1 methylation gene, the fluorescent group adopts ROX, and the quenching group is BHQ2.

In the primer probe combination (7-9) of the PAX1 methylation gene, FAM is adopted as a fluorescent group, and BHQ1 is adopted as a quenching group.

In the primer probe combination of the reference gene beta-actin, a fluorescent group adopts VIC and a quenching group is BHQ1.

Example 3 methylation fluorescent quantitative PCR amplification detection of cervical cancer hypermethylation candidate Gene

In this example, qPCR detection was performed using one or more of the primer probe combinations described in example 2. The method comprises the following steps:

the bisulphite treated DNA was subjected to qPCR amplification using a Thermo Fisher company ABI 7500 instrument. The reaction system of methylation fluorescent quantitative PCR is as follows: the concentration of the self-magnesium chloride or magnesium sulfate is 3.5mmol/L; the concentration of the deoxyribonucleotide triphosphate is 200 mu mol/L; the concentration of each forward primer, each reverse primer and each annihilation probe was 200nmol/L, respectively.

The amplification procedure is shown in table 3 or table 4:

TABLE 3 Table 3

TABLE 4 Table 4

The detection result of methylation fluorescent quantitative PCR is interpreted as follows:

threshold setting:

(1) Baseline modulation (Baseline): using an automatic baseline;

And (3) judging the effectiveness of the kit:

Description: the requirements are met in the same experiment, otherwise, the experiment is invalid, and the experiment is repeated after the reasons are removed.

Sample validity determination:

Determination of methylation detection results

Example 4 clinical sample detection verification of Single primer probe combination Effect

In order to verify the detection effect of the cervical cancer methylation detection primer probe combination, clinical samples are adopted for detection.

The clinical samples included: 30 cervical cancer exfoliated cell samples and 20 normal female cervical exfoliated cell samples. Wherein the samples with the numbers of 1 to 20 are cervical exfoliated cell samples of normal females, and the samples with the numbers of 21 to 50 are cervical exfoliated cell samples. The procedure of sample DNA extraction and bisulfite conversion was as in example 1, and the primer probe combination used was selected from the primer probe combinations described in example 2, and the procedure of methylation fluorescent quantitative PCR amplification detection was as in example 3.

Under the condition that the negative quality control product and the positive quality control product accord with the validity judgment of the kit, typical methylation detection result amplification diagrams are shown in fig. 1 (primer probe combination 7), fig. 2 (primer probe combination 5) and fig. 3 (primer probe combination 3), and red amplification curves are internal reference-internal reference primer probe combinations, and detailed results are shown in table 5.

TABLE 5

/>

Based on the above results, the statistical analysis is shown in table 6:

TABLE 6

From the results, the detection sensitivity of the single primer probe combination in the cervical cancer gene methylation detection kit provided by the invention is 83.4-93.4%, and the specificity is 80-95%.

For PCDHGB7 methylation, the detection sensitivity of the primer probe combinations 1, 2 and 3 is between about 83.4 and 86.7 percent, and the specificity is between 85 and 90 percent, so that the primer probe combinations can be used as a useful detection reagent for assisting in detecting cervical cancer.

For SOX1 methylation, the detection sensitivity of primer probe combinations 4, 5 and 6 is between about 83.4-90% and the specificity is between 80-90%, and thus can be used as a useful detection reagent for aiding detection of cervical cancer.

For PAX1 methylation, the detection sensitivity of the primer probe combinations 7, 8 and 9 is between about 86.7 and 93.4 percent, and the specificity is between 90 and 95 percent, so that the primer probe combinations can be used as a useful detection reagent for assisting detection of cervical cancer.

Example 5 clinical sample detection to verify the Effect of multiple primer probe combinations

In this embodiment, the effect of the combination of the plurality of primer probes is further tested. Clinical specimens and experimental methods were the same as in example 4, in which a single tube assay format with a single gene and single detection site was used.

In addition, in the primer probe combination (1-3) of the PCDHGB7 methylation gene, a fluorescent group adopts CY5, and a quenching group adopts BHQ3.

Analysis of the results of single-tube detection based on cervical cancer single-gene single-detection sites shows that the detection sensitivity and specificity of the preferred combination of joint tests shown in Table 7 are above 90% among the 27 combinations.

TABLE 7

The results in table 7 show that the best combination of sensitivity and specificity combined performance includes: primer probe combinations 1,5 and 8; primer probe combinations 3,5 and 8; primer probe combinations 3,4 and 7; primer probe combinations 1,3 and 7; and primer probe combinations 3,5,7.

Example 6 clinical sample detection to verify the Effect of Single tube multiplex detection of primer-probe combinations

The single-tube detection mode of single gene single detection sites needs to consume more reagents and simultaneously increases the operation of experimenters, the experiment cost is higher, and the joint inspection of single-tube multiple-gene methylation detection sites can reduce the reagent consumption to a greater extent, reduce the consumable cost, simultaneously reduce the operation of experimenters and reduce the labor cost. Therefore, in this embodiment, the single tube multiplex assay effect of the combination of the plurality of primer probes is further tested. Clinical samples and experimental methods are the same as in example 4, and the combination of the primer probe adopts the same fluorescent group and quenching group as in example 5, and adopts a single-tube multiplex joint detection mode of single gene and single detection site.

Typically, a single tube multiplex assay results amplification plot is shown in FIG. 4, using primer probe combinations 3,5 and 7.

The results of single tube multiplex gene methylation detection site co-detection are shown in Table 8.

TABLE 8

The results show that the detection sensitivity and the specificity of the partial single-tube multiplex gene methylation detection site joint detection are reduced to a certain extent, so that the primer probe combinations 1,3 and 7, the primer probe combinations 2,5 and 8, the primer probe combinations 3,5 and 7 and the primer probe combinations 3,5 and 8 are preferable for further verification.

By using the above preferred combination, the tissue samples from different sources were tested to further evaluate their effect on the detection of the tissue samples, and the results are shown in Table 9.

TABLE 9

In conclusion, the cervical cancer gene methylation detection reagent and the kit provided by the invention have higher detection sensitivity and detection specificity (especially the primer probe combination in the tables 7, 8 and 9), and have ideal selection for diagnosing and early screening cervical cancer and assisting early diagnosis and early treatment of cervical cancer.

Discussion of the invention

In cervical cancer, hypermethylation of CpG (cytosine (C) followed by guanosine (G)) of some oncogenes has been considered as one of the biomarkers of cancer. Thus, analysis of the methylation status of one or more of these genes can be used to diagnose the status of cervical cancer.

In cervical cancer screening, since cervical epithelial cells can be directly collected, early diagnosis, detection or screening of cervical cancer by analyzing methylation genes in cervical cells is easier to handle than tumors occurring on other organs.

The detection of methylation of specific target areas of PCDHGB7, SOX1 and PAX1 genes based on cervical exfoliated cells developed by the inventor can provide detection information with high sensitivity and specificity for detection of cervical cancer. In addition, the joint inspection combination has higher sensitivity and higher specificity.

The method and the kit have the advantages of simple and convenient operation, rapidness, low cost and the like, and are beneficial to being applied to various application occasions such as early screening of cervical cancer.

All documents mentioned in this application are incorporated by reference as if each were individually incorporated by reference. Further, it will be appreciated that various changes and modifications may be made by those skilled in the art after reading the above teachings, and such equivalents are intended to fall within the scope of the claims appended hereto.

Claims

1. A test reagent for detecting a cervical cell methylation gene, the test reagent comprising:

2. The detection reagent of claim 1, wherein the detection reagent further comprises a primer probe combination selected from the group consisting of:

3. Use of the detection reagent according to claim 1 or 2, for preparing a kit for detecting cervical cancer.

4. A test kit for detecting a cervical cell methylation gene, characterized in that the test kit comprises a first container containing the test reagent according to claim 1 or 2.

5. The test kit of claim 4, further comprising a primer pair and a probe for an internal standard.

6. The detection kit according to claim 5, wherein the primer pair and the probe for the internal standard are primer probe combinations for the internal reference gene beta-actin: an upstream primer shown as SEQ ID NO.28, a downstream primer shown as SEQ ID NO.29, and a fluorescent probe shown as SEQ ID NO. 30.

7. The test kit of any one of claims 4-6, further comprising one or more additional assay reagents selected from the group consisting of:

(i) PCR buffer system (liquid or lyophilized form);

(ii) A polymerase or a polymerase solution;

(iii) Purifying the reagent.

8. The detection kit according to any one of claims 4 to 7, wherein the concentration of the upstream primer, the downstream primer and the fluorescent probe in the detection reagent is 10 to 500nmol/L.

9. A method for detecting cervical cell methylation genes in vitro, the method comprising:

(s 1) obtaining a sample to be tested;

(s 2) performing a fluorescent quantitative PCR reaction on the sample to be tested using the detection kit according to any one of claims 4 to 8, thereby detecting cervical cell methylation genes.

10. The method of claim 9, wherein the sample to be tested is subjected to a bisulfite conversion treatment.